Compare commits

..

511 Commits

Author SHA1 Message Date
Arfon Smith
cf471af677 Merge pull request #2483 from github/cut-release-v4.5.8
v4.5.8 release
2015-07-10 22:57:07 +01:00
Arfon Smith
79a428ab8d Merge pull request #2180 from pchaigno/inc-extension
.inc file extension
2015-07-08 19:25:50 +01:00
Paul Chaignon
9f8c15ed6c Merge branch 'master' into inc-extension 2015-07-05 14:45:35 +02:00
Paul Chaignon
b94eda18ab New .inc Pascal samples 2015-07-05 12:48:22 +02:00
Paul Chaignon
849eb28b01 New .inc SourcePawn samples 2015-07-05 12:48:12 +02:00
Paul Chaignon
b0073d461c New .inc C++ samples 2015-07-05 12:47:57 +02:00
Arfon Smith
21e97cc65c Merge pull request #2170 from pchaigno/mod-extension
.mod extension
2015-07-04 20:57:40 +01:00
Paul Chaignon
06c1033952 Fix error from merge conflicts 2015-07-04 18:04:19 +02:00
Paul Chaignon
8c54f68040 Fix conflicts from merging master into 'mod-extension' 2015-07-04 18:01:56 +02:00
Arfon Smith
4c1f5c490f Merge pull request #2484 from pchaigno/fix-g-code-samples
Remove incorrect G-code samples
2015-07-04 16:58:42 +01:00
Arfon Smith
117735ffb9 Merge pull request #2179 from pchaigno/symlinks
Ignore symbolic links
2015-07-04 16:57:43 +01:00
Paul Chaignon
f98e6bdac7 Use proper format for symlinks, submodules and trees 2015-07-04 17:14:30 +02:00
Paul Chaignon
19d76306d3 Remove incorrect samples 2015-07-04 12:33:41 +02:00
Arfon Smith
a63a609ce1 v4.5.8 release 2015-07-04 10:36:45 +01:00
Arfon Smith
95fce2024d Merge pull request #2482 from github/grammar-updates
Grammar updates
2015-07-04 07:02:29 +01:00
Arfon Smith
f3b65015f4 Grammar updates 2015-07-04 06:55:51 +01:00
Arfon Smith
5431298b0d Merge pull request #2481 from github/1823-local
Isabelle ROOT support (updated PR)
2015-07-04 06:19:02 +01:00
Arfon Smith
8f651bca03 Adding PHP sample file for completeness 2015-07-04 06:01:06 +01:00
Arfon Smith
6c45e5ec19 Merge branch 'master' into 1823-local 2015-07-04 05:46:23 +01:00
Arfon Smith
95d394642c Merge pull request #2478 from mattn/perl-test-more
Append Test::More into strict.t
2015-07-04 05:32:30 +01:00
mattn
6a185a3d3a remove some text contents from test.pl since it affect to heuristic search. 2015-07-04 02:29:01 +09:00
Arfon Smith
6ae353706d Merge pull request #2479 from SRI-CSL/master
SMT-LIB language support
2015-07-01 14:10:28 -05:00
Ian A. Mason
77bc72be14 Added an ace mode, and put the SMT entry in the correct place, maybe. 2015-07-01 11:22:04 -07:00
Bruno Dutertre
0585c880de Example smt2 files 2015-07-01 10:38:17 -07:00
mattn
da5189e7fb Append Test::More into strict.t. Because, most of tap scripts on Perl5 are detected as Perl6. 2015-07-01 16:23:38 +09:00
Ian A. Mason
5f456d8b22 Some part way through the adding a language checklist. 2015-06-30 15:29:02 -07:00
Vicent Marti
a351cdd486 Merge pull request #2477 from github/vmg/release-4.5.7
Rrelease 4.5.7
2015-06-30 14:58:18 +02:00
Arfon Smith
6e71663fd6 Merge pull request #2463 from pchaigno/doc-add-extension
Instructions to add a new extension to a language
2015-06-29 21:18:47 -05:00
Arfon Smith
0b2e43cdee Merge pull request #2457 from drewcrawford/master
Adding some more vendered expressions
2015-06-29 21:16:08 -05:00
Paul Chaignon
9cbd280f79 New .inc SourcePawn sample 2015-06-28 16:05:47 +02:00
Paul Chaignon
947be9db0f New .inc Pascal sample 2015-06-28 15:54:25 +02:00
Paul Chaignon
dd55f929d4 New .inc HTML sample 2015-06-28 15:27:59 +02:00
Paul Chaignon
8b5399d568 New C++ .inc sample 2015-06-28 14:33:54 +02:00
Paul Chaignon
1b8b0c6229 New .inc Assembly samples 2015-06-28 13:24:42 +02:00
Vicent Marti
ee3081fb4c Bump to 4.5.7 2015-06-26 03:34:18 -07:00
Vicent Marti
119770a038 Update grammars 2015-06-26 03:33:37 -07:00
Vicent Marti
9d61487403 gemspec: Loosen up the restriction on Rugged betas 2015-06-26 03:11:31 -07:00
Paul Chaignon
56dec47561 Merge branch 'master' into inc 2015-06-21 14:20:53 +02:00
Paul Chaignon
3e793ab5b7 Precision on requirements to add a language 2015-06-21 10:07:18 +02:00
Garen Torikian
f6b50a67f9 Change Haxe and Ragel colors to pass tests 2015-06-20 09:55:33 -07:00
Zalim Bashorov
cd47798d13 try to fix conflicts 2015-06-20 09:49:51 -07:00
Zalim Bashorov
3b54df2cde Change color for Kotlin based on color in logo
IMHO it's more suitable.
2015-06-20 09:49:51 -07:00
Drew Crawford
8845b266de Adding some more vendered expressions
* `Vendor/`, the capitalized path
* Crashlytics, a common iOS framework
* Fabric, a common iOS framework
2015-06-17 21:25:54 -05:00
Arfon Smith
4757da73f0 Merge pull request #2456 from github/cut-release-v4.5.6
Cut release v4.5.6
2015-06-17 09:45:38 -05:00
Arfon Smith
468fd425fc Bumping to v4.5.6 2015-06-17 09:03:29 -05:00
Arfon Smith
5604d658b2 Bringing dart scopes up to date 2015-06-17 08:59:27 -05:00
Arfon Smith
37222d5622 Updating grammars 2015-06-17 08:54:56 -05:00
Arfon Smith
ec38b54023 Merge pull request #2449 from larsbrinkhoff/picolisp
Add PicoLisp language
2015-06-16 09:10:21 -05:00
Lars Brinkhoff
260e90401d Add samples for .l.
array.l by NANRI southly; MIT license.
simul.l by Alexander Burger; MIT license.
2015-06-16 06:51:58 +02:00
Lars Brinkhoff
8c66f0a5da Heuristic for PicoLisp. 2015-06-16 06:51:58 +02:00
Lars Brinkhoff
78efc2d0de Add PicoLisp language. 2015-06-16 06:51:57 +02:00
Arfon Smith
656c1e6ba6 Merge branch 'rneatherway-move-fsharp-grammar' 2015-06-15 16:09:19 -05:00
Arfon Smith
65e932016b Merge branch 'move-fsharp-grammar' of https://github.com/rneatherway/linguist into rneatherway-move-fsharp-grammar 2015-06-15 16:08:07 -05:00
Arfon Smith
fc602b1d42 Merge pull request #2383 from larsbrinkhoff/troff
More file extensions for Groff
2015-06-15 15:40:45 -05:00
Lars Brinkhoff
0e882900d7 Samples for .ms.
hello.ms by FSF; GPL license.
fsinterface.ms by the NetBSD project; BSD license.
2015-06-15 07:18:43 +02:00
Lars Brinkhoff
28103ee25b Add .ms to GAS. 2015-06-15 07:18:43 +02:00
Lars Brinkhoff
0a0d2ddb1a Heuristics for Groff and Nemerle. 2015-06-15 07:18:43 +02:00
Lars Brinkhoff
3bf4cb721e Add .n Groff sample.
From the Tcl/Tk project; BSD-like license.
2015-06-15 07:18:43 +02:00
Lars Brinkhoff
ba1ab64b56 More Groff file extensions. 2015-06-15 07:18:43 +02:00
Paul Chaignon
786d1e4cfc Instructions to add a new extension to a language 2015-06-12 21:22:55 +02:00
Arfon Smith
eb82e022ba Merge pull request #2443 from wcandillon/patch-4
Improved XQuery and JSONiq support
2015-06-12 11:35:53 -05:00
William Candillon
753bfd1dc5 ⬆️ 2015-06-11 19:07:19 +02:00
Robin Neatherway
6b11655db8 Switch to using atom-fsharp language definition
The previous definition used at fsharpbinding is no longer maintained.
That repository has been split into separate parts for each editor. Atom
now has the most complete compatible grammar.
2015-06-09 18:07:51 +01:00
William Candillon
d1ae098c08 ⬆️ 2015-06-08 15:22:32 +02:00
William Candillon
e1a8b5db1d 🆕 XQuery & JSONiq support based on the Atom language-jsoniq package 2015-06-08 14:50:28 +02:00
William Candillon
302cfea295 Update languages.yml 2015-06-08 14:32:07 +02:00
Garen Torikian
0946fecd82 Merge pull request #2439 from alexweber/patch-1
fix anchor link to vim & emacs modelines section
2015-06-05 09:43:21 -07:00
Alex Weber
9afdcddfc9 fix anchor link to vim & emacs modelines section
regression introduced in 5382c1b795
2015-06-05 12:53:15 -03:00
Arfon Smith
4d162f88bd Merge pull request #2432 from jakepetroules/qbs
.qbs extension for QML.
2015-06-04 11:45:16 -05:00
Jake Petroules
2806987f2f .qbs extension for QML. 2015-06-02 00:46:56 -07:00
Arfon Smith
f380aa2e5e Merge pull request #2426 from tamird/generated-go-bindata
Detect Go files generated by go-bindata
2015-05-31 15:53:49 +02:00
Arfon Smith
a2ce1972ec Merge pull request #2429 from larsbrinkhoff/kbuild
Make filename: Kbuild
2015-05-31 15:51:51 +02:00
Arfon Smith
aa8cf7e6bb Merge pull request #2431 from pchaigno/al-perl
New .al extension for Perl
2015-05-31 15:49:53 +02:00
Paul Chaignon
ec61a6974f .al extension for Perl 2015-05-30 15:07:56 +02:00
Lars Brinkhoff
21e249bd2c Add makefile sample.
Kbuild by Sam Ravnborg; GPL 2 license.
2015-05-29 09:22:26 +02:00
Lars Brinkhoff
8e550f7093 'Kbuild' is a common makefile name. 2015-05-29 07:18:31 +02:00
Arfon Smith
53e53880bd Merge pull request #2419 from evgenyneu/master
Treat Carthage path as vendored
2015-05-28 13:33:47 -05:00
Arfon Smith
671b5788ed Merge pull request #2413 from yegortimoschenko/jruby-executable
Add JRuby executable example, fixes #2412
2015-05-28 10:27:53 -05:00
Arfon Smith
76d10cd85c Merge pull request #2422 from CalebFenton/master
Add Smali language
2015-05-28 10:17:48 -05:00
Arfon Smith
42c155d667 Merge pull request #2425 from larsbrinkhoff/fix-rust
Fix Rust heuristic.
2015-05-28 10:16:24 -05:00
Tamir Duberstein
d17222ec91 Detect Go files generated by go-bindata 2015-05-28 11:03:36 -04:00
Tamir Duberstein
a1ea55d006 Trim whitespace 2015-05-28 11:03:36 -04:00
Tamir Duberstein
f32b7bb978 Fix duplicate key warning 2015-05-28 11:03:36 -04:00
Lars Brinkhoff
38aa7bae3f Fix Rust heuristic. 2015-05-28 07:10:25 +02:00
Caleb Fenton
0021b9532b Update Smali submodule 2015-05-27 11:19:29 -07:00
Caleb Fenton
788fac7c43 Add Smali language 2015-05-27 10:37:17 -07:00
Arfon Smith
71934152e4 Merge pull request #2378 from Mailaender/patch-1
Added support for .mdpolicy XML files
2015-05-27 08:41:22 -05:00
Matthias Mailänder
e20d6fc04a add .mdpolicy XML files 2015-05-23 21:32:17 +02:00
Evgenii Neumerzhitckii
a1e8fc4f97 Treat Carthage path as vendored 2015-05-23 21:54:25 +10:00
Yegor Timoschenko
9dc8a10e2a Use real-world samples for JRuby and Rubinius executables
https://github.com/shoes/shoes4/blob/master/shoes-swt/bin/shoes-swt
https://github.com/txus/rexpl/blob/master/bin/rexpl
2015-05-23 05:36:26 +00:00
Yegor Timoschenko
43a2da46f9 Add jruby and rbx interpreters for Ruby 2015-05-21 19:35:45 +00:00
Yegor Timoschenko
f95ca13073 Add JRuby executable example, fixes #2412 2015-05-21 18:56:38 +00:00
Arfon Smith
b92b3af602 Merge pull request #2390 from larsbrinkhoff/lex-yacc
Add Lex and Yacc languages
2015-05-21 12:47:08 -05:00
Arfon Smith
83b76cde34 Merge pull request #2203 from pchaigno/vhost-nginx
.vhost as a Nginx extension
2015-05-21 11:34:45 -05:00
Arfon Smith
5ff0d488d2 Merge pull request #2392 from vighnesh1987/apache-thrift
Add Apache thrift support to generated? check
2015-05-20 12:43:55 -05:00
Arfon Smith
f89adf6e53 Merge pull request #2410 from SimenB/iml
Display IntelliJ configurations files as XML
2015-05-20 12:34:14 -05:00
Simen Bekkhus
efd34d8cb0 Display IntelliJ configurations files as XML
Fixes #2409
2015-05-20 14:18:01 +02:00
Lars Brinkhoff
3defb60fd7 Add .l samples.
zend_ini_scanner.l by Zend Technologies; New BSD license.
common.l by Toshihiro MATSUI, Electrotechnical Laboratory; New BSD license.
create_view.l by PostgreSQL Global Development Group; MIT license.
2015-05-20 08:16:26 +02:00
Lars Brinkhoff
869c9d2fdd Add .l to Groff. 2015-05-20 08:16:26 +02:00
Lars Brinkhoff
912e465193 Add .l to Common Lisp. 2015-05-20 08:16:26 +02:00
Lars Brinkhoff
e7c1419390 Add Yacc language. 2015-05-20 08:16:26 +02:00
Lars Brinkhoff
b19cd037b7 Add Lex language. 2015-05-20 08:16:26 +02:00
Arfon Smith
42f7bc2160 Merge pull request #2407 from github/welcome-back-handlebars
Adding back Handlebars grammar
2015-05-19 15:44:38 -05:00
Arfon Smith
542a0d79fd Adding back Handlebars grammar 2015-05-19 13:27:37 -05:00
Arfon Smith
4b9b09f7bf Merge pull request #2405 from github/fix-handlebars-grammar
Fix Handlebars grammar
2015-05-19 10:46:21 -05:00
Adam Roben
57429f3194 Don't warn if a package contains multiple copies of a grammar
This is pretty common (e.g., if the package contains the grammar in both
XML and JSON).
2015-05-19 09:27:13 -04:00
Adam Roben
9bdf890fd8 Fix nil NoMethodError when converting a duplicated grammar
We were sticking a nil value into the grammars Array when we encountered
a duplicate scope. Now we strip out nils before returning the Array.
2015-05-19 09:27:13 -04:00
Arfon Smith
9240f30f28 Merge pull request #2401 from github/cut-release-v4.5.5
Cut release v4.5.5
2015-05-18 16:15:40 -05:00
Arfon Smith
6062d3b25c Temporarily removing Handlebars highlighting 2015-05-18 14:41:36 -05:00
Arfon Smith
3878afa2e0 Bumping to v4.5.5 2015-05-15 10:56:36 -05:00
Arfon Smith
fa8998c6b6 Fixing up grammars 2015-05-15 10:55:50 -05:00
Arfon Smith
99dcd501aa Grammars update 2015-05-15 10:50:05 -05:00
Vighnesh Rege
ed23c6ef75 Fixed broken file reference 2015-05-13 23:22:24 -07:00
Vighnesh Rege
90b59876d0 Added extension restrictions 2015-05-13 23:20:51 -07:00
Arfon Smith
da7d019df3 Merge pull request #2388 from mephaust/add-unity3d
Add Unity3D Asset and Metadata files
2015-05-13 16:02:30 -05:00
Paul Handly
4fc0c90cff Add Unity3D Asset samples 2015-05-13 15:59:11 -04:00
Arfon Smith
4ecb6425d2 Merge pull request #2373 from pchaigno/remove-unused-grammars
Remove unused grammars/submodules
2015-05-13 09:50:32 -05:00
Arfon Smith
6dfab80df7 Merge pull request #2394 from github/vim-modeline-fix
Improving Vim modeline regex
2015-05-13 09:03:43 -05:00
Arfon Smith
1ebf1e77e5 Merge pull request #2387 from aivus/patch-1
Change PHP group to HTML for TWIG
2015-05-13 09:03:35 -05:00
Arfon Smith
0c810cc016 Merge pull request #2393 from KrauseFx/patch-1
Added fastlane configuration files
2015-05-13 08:45:23 -05:00
Arfon Smith
7e32b45aa8 Removing whitespace matching 2015-05-13 08:31:45 -05:00
Felix Krause
4c1a84716a Merge branch 'master' into patch-1 2015-05-13 11:03:13 +01:00
Felix Krause
fd4111cdbe Added Example Ruby Files 2015-05-13 11:02:26 +01:00
Arfon Smith
2fac182a90 Improving Vim modeline regex 2015-05-12 16:49:14 -05:00
Vighnesh Rege
6d2aa601cd Added tests 2015-05-12 12:53:59 -07:00
Felix Krause
f87c3c4996 Added fastlane configuration files
[fastlane](https://fastlane.tools) is an established Continuous Delivery solution for iOS/Mac projects. The configuration files are similar to a `Podfile`, also Ruby based. 

Some examples:
- https://github.com/wikimedia/apps-ios-wikipedia/blob/master/fastlane/Fastfile
- https://github.com/wikimedia/apps-ios-wikipedia/blob/master/fastlane/Deliverfile
- https://github.com/artsy/eidolon/blob/master/fastlane/Fastfile
- https://github.com/fastlane/examples/blob/master/MindNode/Fastfile

The configuration files added with this pull request: `Fastfile`, `Deliverfile` and `Snapfile` 👍
2015-05-12 20:29:24 +01:00
Vighnesh Rege
1811465abb Add Apache thrift support to generated? check 2015-05-12 12:25:06 -07:00
Paul Handly
7631db2183 Treat Unity3D metadata as an asset 2015-05-10 18:19:34 -04:00
Paul Handly
da5bc18d64 Add Unity3D Metadata files as generated 2015-05-10 18:19:33 -04:00
Paul Chaignon
0c2aeae00d .inc extension for PHP, Pascal, Assembly, SQL, C++, HTML and SourcePawn 2015-05-10 20:36:41 +02:00
Paul Handly
f2af2156fa Add language for Unity3D Asset files 2015-05-09 14:15:59 -04:00
Arfon Smith
5bf8cf50ae Merge pull request #2386 from larsbrinkhoff/modeline
Vim and Emacs modelines are two alternatives
2015-05-06 15:55:36 -05:00
Ilya Antipenko
dc22b0f869 Change PHP group to HTML for TWIG 2015-05-06 20:41:37 +03:00
Lars Brinkhoff
5382c1b795 Make it more clear that Vim and Emacs modelines are two alternatives. 2015-05-06 07:46:42 +02:00
Arfon Smith
dbe851726e Merge pull request #2368 from m-click/geography-markup-language
Add languages.yml entry and sample files for OGC Geography Markup Language (#2366)
2015-05-05 08:18:37 -05:00
Arfon Smith
3720e49618 Merge pull request #2372 from pchaigno/use-original-ada-grammar
Use original Ada grammar
2015-05-05 08:17:38 -05:00
Paul Chaignon
a4f187efd2 Merge branch 'master' into vhost-nginx 2015-05-04 21:58:22 +02:00
Paul Chaignon
b6ee02f313 Merge branch 'master' into mod-extension 2015-05-04 21:44:23 +02:00
Paul Chaignon
380a51e4a4 Merge branch 'master' into use-original-ada-grammar 2015-05-04 21:35:40 +02:00
Arfon Smith
459b1034a7 Merge pull request #2363 from danielgtaylor/master
Add support for API Blueprint
2015-05-04 09:47:11 -05:00
Arfon Smith
c2f567770c Merge pull request #2375 from mbdoud/master
Add HyPhy as language to Linguist
2015-05-04 08:17:33 -05:00
Volker Grabsch
c94c908d5d Add languages.yml entry and sample files for OGC Geography Markup Language (#2366) 2015-05-03 19:15:54 +02:00
Mike Doud
585d74ecc9 add better HyPhy samples 2015-05-02 13:24:43 -07:00
Arfon Smith
d8422e63f6 Merge pull request #2374 from pchaigno/travis-submodules-ssh
Handle SSH links to submodules in Travis
2015-05-02 06:38:28 -05:00
Paul Chaignon
ca12a99970 Handle SSH links to submodules 2015-05-01 21:03:02 +02:00
Mike Doud
1fdcafb1ae Update languages.yml 2015-05-01 11:28:11 -07:00
Paul Chaignon
2eede37248 Remove unused grammars/submodules 2015-05-01 17:28:34 +02:00
Paul Chaignon
6489f7009d Use original repository for Ada grammar 2015-05-01 16:42:37 +02:00
Paul Chaignon
bdfe2aa6e4 Remove grammar for Ada 2015-05-01 16:39:48 +02:00
Mike Doud
007de4691b removing incorrect samples 2015-04-30 16:07:19 -07:00
Mike Doud
141e495447 Merge branch 'master' of https://github.com/mbdoud/linguist 2015-04-30 15:38:12 -07:00
Mike Doud
5e68714ae5 add HyPhy examples 2015-04-30 15:37:59 -07:00
Mike Doud
4ae6455e0e Update languages.yml 2015-04-30 15:25:04 -07:00
Mike Doud
f393ea307d Add 'HyPhy Batch Language' 2015-04-30 15:14:53 -07:00
Daniel G. Taylor
828fc7a19b Add support for API Blueprint
This adds a grammar and samples for [API Blueprint][] based on the
[Sublime Text plugin][] from Apiary. The [Atom language][] is also based
on the Sublime plugin.

API Blueprint is now used in over [3,600 repositories][] on GitHub and has
[several][Aglio] [open source][Dredd] [tools][Drakov] available.

Here's an [example using Lightshow][Lightshow] to highlight a small API.

[3,600 repositories]: https://github.com/search?utf8=%E2%9C%93&q=FORMAT+1A+extension%3Aapib+extension%3Amd&type=Code&ref=advsearch&l=
[Aglio]: https://github.com/danielgtaylor/aglio
[API Blueprint]: https://apiblueprint.org/
[Drakov]: https://www.npmjs.com/package/drakov
[Atom language]: https://github.com/danielgtaylor/atom-language-api-blueprint
[Dredd]: https://github.com/apiaryio/dredd
[Lightshow]: https://github-lightshow.herokuapp.com/?utf8=%E2%9C%93&scope=from-url&grammar_url=https%3A%2F%2Fgithub.com%2Fapiaryio%2Fapi-blueprint-sublime-plugin%2Fblob%2Fmaster%2FAPIBlueprint.tmLanguage&grammar_text=&code_source=from-url&code_url=https%3A%2F%2Fraw.githubusercontent.com%2Fapiaryio%2Fapi-blueprint%2Fmaster%2Fexamples%2F12.%2520Advanced%2520Action.md&code=
[Sublime Text plugin]: https://github.com/apiaryio/api-blueprint-sublime-plugin
2015-04-28 22:21:30 -07:00
Paul Chaignon
fc1f8083ad Heuristic rules for XML and Modula-2 2015-04-25 23:36:15 +02:00
Paul Chaignon
af5e799a45 Merge branch 'master' into mod-extension 2015-04-22 21:14:24 +02:00
Arfon Smith
accf734a74 Merge pull request #2346 from larsbrinkhoff/public-key
Add support for SSH2 and OpenSSH public keys
2015-04-21 08:22:05 -05:00
Arfon Smith
6bd86ad46b Merge pull request #2330 from larsbrinkhoff/link-script
Add 'Linker Script' language
2015-04-21 08:19:53 -05:00
Lars Brinkhoff
d7207f3399 Linker Script samples.
vmlinux.lds by Martin Mares; license GPL v2.
link.ld by Anthony Zbierajewski; license GPL v2.
ld.script by Wu Zhangjink; license GPL v2.
2015-04-21 10:11:40 +02:00
Lars Brinkhoff
e018b4322e Improve .asc heuristic for Public Key. 2015-04-21 10:10:27 +02:00
Lars Brinkhoff
415c7d32a2 More .asc samples for Public Key.
sshkey1.asc by Joseph Galbraith; Sleepycat license (GPL compatible).
2015-04-21 10:10:27 +02:00
Lars Brinkhoff
164caa2755 Add 'Linker Script' language. 2015-04-21 07:17:08 +02:00
Arfon Smith
ec2f0cb82a Merge pull request #2335 from DavidJFelix/patch-1
Change Salt to programming per #2307
2015-04-20 16:57:15 -05:00
David J. Felix
604918b6ad Add python-logo grey color to SaltStack config 2015-04-20 12:29:09 -04:00
David J. Felix
eb7e72a4a9 Change Salt to programming per #2307
- Remove group
2015-04-19 18:24:27 +00:00
Paul Chaignon
e073e91d62 Detect GFortran module files as generated 2015-04-19 16:56:38 +02:00
Paul Chaignon
da9bda0e27 Detect KiCAD module files as generated 2015-04-19 16:19:52 +02:00
Paul Chaignon
0e996e4bb7 Grammar for Modula-2 from Sublime Text package 2015-04-19 12:41:41 +02:00
Paul Chaignon
63fbbd6e0a .mod file extension for AMPL, Linux Kernel Module, Modula-2 and XML 2015-04-19 12:39:21 +02:00
Brandon Keepers
1ac694f149 Merge pull request #2340 from github/remove-script-ext
Remove .script! hack
2015-04-19 08:58:07 +12:00
Brandon Keepers
ef49fe417f fix samples after renaming script 2015-04-17 14:37:40 +12:00
Brandon Keepers
d28828b7d7 Merge pull request #2334 from thomasvandoren/update-chapel-grammar
Update submodule for Chapel grammar.
2015-04-17 14:20:16 +12:00
Brandon Keepers
8a42f76f03 Remove .script! hack 2015-04-17 14:09:05 +12:00
Brandon Keepers
745ce14d47 Merge pull request #2333 from 3flex/2318-add-puppet-samples
Add additional Puppet sample
2015-04-17 13:57:07 +12:00
Arfon Smith
dc41ca23c6 Merge pull request #2339 from ampl/nl
Improve NL/NewLisp disambiguation heuristic
2015-04-16 17:42:08 -05:00
vitaut
9da42fba5b Improve NL/NewLisp disambiguation heuristic
NL files start with either 'b' or 'g' followed by an unsigned integer.
2015-04-16 15:19:22 -07:00
Ted Nyman
fac4633337 Move .odd file to the right directory 2015-04-15 18:37:36 -07:00
Thomas Van Doren
3ab0de831f Update Chapel samples. 2015-04-15 07:43:25 -07:00
Thomas Van Doren
599d146118 Use chapel-lang/chapel-tmbundle for Chapel grammar. 2015-04-15 07:43:25 -07:00
Matthew Haughton
5cdbb2b113 Add additional Puppet samples 2015-04-14 23:18:45 -04:00
Arfon Smith
611584a414 Merge pull request #2322 from larsbrinkhoff/lisp
Make Common Lisp heuristic case insensitive.
2015-04-13 08:49:37 -05:00
Lars Brinkhoff
33478b2d23 Make Common Lisp heuristic case insensitive. 2015-04-11 19:58:02 +02:00
Lars Brinkhoff
46ca8e93c2 New upper-case sample for Common Lisp. 2015-04-11 19:24:01 +02:00
Arfon Smith
da58febc3e Merge pull request #2328 from github/specflow
Specflow
2015-04-10 20:16:05 -05:00
Arfon Smith
7ca2384e03 Test for Specflow feature 2015-04-10 20:11:11 -05:00
Arfon Smith
6b2bb52dcd Merge branch 'master' into specflow 2015-04-10 20:07:43 -05:00
Arfon Smith
000a42ef3d Merge pull request #2326 from github/dcl
Add DCL and MMS
2015-04-10 15:54:04 -05:00
Arfon Smith
03e40718ff Bringing languages.yml keys up to date 2015-04-10 15:47:37 -05:00
Arfon Smith
4386fb7f28 Merge branch 'master' into dcl 2015-04-10 15:41:04 -05:00
Arfon Smith
0db4d05671 Merge pull request #2325 from github/clarion
Adding support for Clarion
2015-04-10 15:32:46 -05:00
Arfon Smith
d113e98915 Grammar update 2015-04-10 15:27:02 -05:00
Arfon Smith
e9acecf71f Colour update 2015-04-10 15:15:03 -05:00
Arfon Smith
76b84decfe Removing .inc from Clarion 2015-04-10 15:09:00 -05:00
Arfon Smith
80148ae4e4 Merge branch 'master' into clarion 2015-04-10 15:06:33 -05:00
Arfon Smith
4af679c27f Merge pull request #2324 from pchaigno/batch-group
Remove Batch from Shell group
2015-04-10 14:29:10 -05:00
Arfon Smith
ba86d9fff0 Merge pull request #2266 from Dorian/patch-1
Add .ruby to the list of ruby file extensions
2015-04-10 14:15:42 -05:00
Paul Chaignon
3a07410569 Remove test for group of Batch 2015-04-10 20:59:10 +02:00
Brandon Keepers
b43828db9b Merge pull request #2323 from lsf37/jflex-lang
Add JFlex grammars (language & syntax highlighting)
2015-04-10 14:57:03 -04:00
Gerwin Klein
8251588088 choose more distinct color for JFlex 2015-04-10 21:16:32 +10:00
Gerwin Klein
22ff4898a5 add textmate grammar for JFlex 2015-04-10 19:25:24 +10:00
Gerwin Klein
9c4c6d908a add language recognition for JFlex grammars
JFlex is a lexical analyzer generator for Java, see also
http://jflex.de or https://github.com/jflex-de/jflex
2015-04-10 19:17:58 +10:00
Paul Chaignon
3f9d98974c Remove Batch from Shell group 2015-04-08 21:39:10 +02:00
Arfon Smith
98a23c6a53 Merge pull request #2314 from larsbrinkhoff/ocaml
Tighten up OCaml heuristic
2015-04-07 07:56:16 -05:00
Lars Brinkhoff
3086326d12 Tighten up OCaml heuristic: only match at start of line. 2015-04-07 08:54:39 +02:00
Arfon Smith
ac4594e3b1 Merge pull request #2298 from github/add-proximity-test
Add proximity test for colors
2015-04-06 13:15:32 -05:00
Arfon Smith
47dcca839e Merge pull request #2312 from larsbrinkhoff/for
New sample for Formatted.
2015-04-06 13:15:04 -05:00
Arfon Smith
572078a708 Merge pull request #2306 from powerman/limbo
add Limbo: language, samples
2015-04-06 13:14:32 -05:00
Lars Brinkhoff
0442f4bd06 One more sample for Formatted.
By Sean Carroll; license GPLv2.
2015-04-06 20:06:15 +02:00
Arfon Smith
2861a8f19c Fixing up colours to match languages.yml 2015-04-06 12:41:49 -05:00
Arfon Smith
1d0028fd53 Merge pull request #2311 from pchaigno/saltstack-samples
New samples for SaltStack
2015-04-06 12:36:19 -05:00
Alex Efros
c3288543af add heuristic for Limbo 2015-04-06 20:17:52 +03:00
Garen Torikian
3c96f9eb53 Bump threshold to 0.05 2015-04-06 09:44:10 -07:00
Garen Torikian
6bd8d3a3b7 Some slight test improvements 2015-04-06 09:43:36 -07:00
Garen Torikian
63e017fbaa Rename to TestColorProximity 2015-04-06 08:32:23 -07:00
Paul Chaignon
f993b7358b New samples for SaltStack 2015-04-06 14:58:20 +02:00
Arfon Smith
4239d5453c Merge pull request #2309 from pchaigno/sch-kicad
KiCad language with .sch extension
2015-04-05 19:37:08 -05:00
Arfon Smith
b0e6f17612 Merge pull request #2308 from pchaigno/contribution-guideline-update
Update guideline on syntax highlighting fixes
2015-04-05 10:56:19 -05:00
Alex Efros
c97c10623b add .b Brainfuck sample 2015-04-05 18:08:20 +03:00
Paul Chaignon
d566ccd0be Update guideline on syntax highlighting fixes 2015-04-05 16:55:27 +02:00
Paul Chaignon
8b4daefbde KiCad language with .sch extension 2015-04-05 16:45:35 +02:00
Alex Efros
bbea29be55 add Limbo to test_languages 2015-04-05 03:03:45 +03:00
Alex Efros
f016867e1a Limbo: fix tm_scope 2015-04-05 02:56:36 +03:00
Alex Efros
35f2699eb3 add Limbo: language, samples 2015-04-05 02:34:02 +03:00
Garen Torikian
3ad66da2bf Adjust existing colors to pass tests
A lot of these were taken from official websites. For obscurer
languages, I just changed a few digits of the hex value.
2015-04-03 18:46:45 -07:00
Garen Torikian
004f9b4710 Use new color-proximity gem for better visual matching 2015-04-03 18:25:13 -07:00
Arfon Smith
3e06b95f98 Merge pull request #2304 from github/clarify-docs
Explaining gitattributes behavior.
2015-04-03 15:02:23 -04:00
Arfon Smith
8591dffcae Explaining gitattributes behavior. 2015-04-03 14:53:38 -04:00
Garen Torikian
3d69c047f0 Merge branch 'master' into add-proximity-test 2015-04-02 17:32:00 -07:00
Arfon Smith
78a1183c26 Merge pull request #2301 from dpiddy/erlang-rebar
Add rebar-related files as erlang.
2015-04-02 19:09:38 -04:00
Arfon Smith
58ea517b32 Merge pull request #2296 from phase/master
Add colors to semi-popular languages
2015-04-02 19:06:30 -04:00
Dan Peterson
0722b6855b Add rebar-related files as erlang. 2015-04-02 15:41:24 -03:00
Arfon Smith
a6a745d99d Merge pull request #2299 from github/shebang-fixing
Fixing up shebang detection to match new tokenizer behaviour
2015-04-02 14:14:29 -04:00
Arfon Smith
7394e9400b Adding explicit test for new shebang parsing 2015-04-02 14:00:03 -04:00
Garen Torikian
15f0366e12 Adjust color schemes slightly
- Make Perl6 a distinct blue (using Camelia’s wing as an aide)
- VCL is part of the Perl group
- Brighten Slim a bit so it does not conflict with Ada
2015-04-02 08:25:19 -07:00
Garen Torikian
07e3d9d3b3 Improve error output 2015-04-02 08:24:04 -07:00
Arfon Smith
55eaf03afb Merge pull request #2300 from github/build-boot
Adding in a Makefile.boot filename for .boot detection
2015-04-01 20:41:27 -05:00
Arfon Smith
7a6849b3ac Adding in a Makefile.boot filename for .boot detection 2015-04-01 20:33:13 -05:00
Arfon Smith
fa5496eef4 Fixing up shebang detection to match new tokenizer behaviour 2015-04-01 20:23:16 -05:00
Arfon Smith
893bd7e204 Merge pull request #1604 from geoff-codes/#!--"
Comment styles; don't choke on `#!/usr/bin/env foo=bar`
2015-04-01 15:18:40 -05:00
Garen Torikian
8a54ce57a5 Drop threshold back down to a passing 10 2015-04-01 10:15:10 -07:00
Garen Torikian
3851b7c016 Add test for detecting color proximity 2015-04-01 10:14:52 -07:00
phase
3dbcfa8af8 Add color for ABAP 2015-03-31 20:05:42 -07:00
phase
9936a30879 Add color for Crystal 2015-03-31 20:02:52 -07:00
phase
59e935b05d Add color for Brainfuck 2015-03-31 20:00:53 -07:00
phase
53f93f68db Add color to Makefile 2015-03-31 19:55:25 -07:00
phase
66f9bd1ab4 Add color to Kotlin 2015-03-31 19:53:36 -07:00
Arfon Smith
78d4abe808 Merge pull request #2295 from github/cut-release-v4.5.4
Bumping version to v4.5.4
2015-03-31 20:16:53 -05:00
Arfon Smith
cb97417af8 Bumping version to v4.5.4 2015-03-31 19:48:34 -05:00
Arfon Smith
d1c94c75ea Merge pull request #2294 from github/grammars
Grammars update
2015-03-31 19:45:16 -05:00
Arfon Smith
0c8c6c9814 Merge pull request #2293 from github/sphinx-docs-tests
Some tests to go with #2290
2015-03-31 19:39:45 -05:00
Arfon Smith
3270a8896d Grammars update 2015-03-31 19:37:08 -05:00
Arfon Smith
20f19bf049 Some tests to go with #2290 2015-03-31 19:33:50 -05:00
Arfon Smith
0cc33fd560 Merge pull request #2290 from untitaker/patch-1
Ignore assets from Sphinx docs
2015-03-31 19:29:23 -05:00
Arfon Smith
fa54fc2735 Merge pull request #2233 from tesch1/tesch1-emacs-patch-1
fix emacs modeline parsing
2015-03-31 19:27:33 -05:00
Arfon Smith
216e0457ff Merge pull request #2291 from iFarbod/patch-1
Added Color for the Squirrel Language
2015-03-31 19:25:40 -05:00
iFarbod
678f90acf7 Added Color for the Squirrel Language
Picked the color from the Squirrel Language's website.
2015-04-01 01:23:59 +04:30
Arfon Smith
dd0d5c08bb Merge pull request #2289 from lepture/patch-fixtures
add tests/fixtures to vendor.yml
2015-03-31 11:43:39 -05:00
Markus Unterwaditzer
3837fed59e Ignore assets from Sphinx docs 2015-03-31 15:21:40 +02:00
Hsiaoming Yang
e4ce4edd5c add tests/fixtures to vendor.yml 2015-03-31 20:08:18 +08:00
Arfon Smith
a0fb54fe70 Merge pull request #2286 from github/puphpet
Adding puphpet to vendored list
2015-03-30 16:57:43 -05:00
Arfon Smith
e946ceaa6f Grammar 2015-03-30 16:24:55 -05:00
Arfon Smith
285af6512e Adding puphpet to vendored list 2015-03-30 16:24:11 -05:00
Arfon Smith
5ae5108a69 Merge pull request #2247 from larsbrinkhoff/renderscript
Add RenderScript and Filterscript
2015-03-30 16:08:42 -05:00
Lars Brinkhoff
02ae60f434 Samples for RenderScript and Filterscript.
All files are from The Android Open Source Project; license APL 2.0.
2015-03-28 12:34:20 +01:00
Lars Brinkhoff
03dc4e1ff4 Add RenderScript and Filterscript. 2015-03-28 12:34:20 +01:00
Arfon Smith
c39b42abba Merge pull request #2075 from philix/patch-1
Add cpplint.py to vendor.yml
2015-03-27 11:02:36 -07:00
Arfon Smith
661972f585 Merge pull request #2275 from github/bump-escape-utils
Bump escape-utils to 1.1.0
2015-03-27 09:25:29 -07:00
Arfon Smith
078aff6ee3 Merge pull request #2276 from MakeNowJust/patch-1
Fix ada aliases
2015-03-27 09:24:31 -07:00
Arfon Smith
4fed108b2c Merge pull request #2279 from joewiz/patch-1
Add .odd to XML extensions
2015-03-26 11:21:47 -07:00
Joe Wicentowski
fc9beb58aa Add sample TEI ODD file (.odd) 2015-03-26 14:00:17 -04:00
Joe Wicentowski
4623b4a83e Add .odd to XML extensions
See discussion at #2238. 

[ODD](http://en.wikipedia.org/wiki/Text_Encoding_Initiative#ODD) is an XML-based vocabulary for defining schemas for Text Encoding Initiative (TEI) projects, used widely in the humanities.  ODD should be rendered using XML syntax but is currently displayed as plain text (see [this example](https://github.com/wolfgangmm/tei-simple-pm/blob/master/odd/teisimple.odd)).  There are [nearly 500 ODD files](https://github.com/search?q=extension%3Aodd+NOT+djfhdirijdskqdhd&type=Code&utf8=%E2%9C%93) in GitHub, and this number is projected to grow.
2015-03-26 13:18:49 -04:00
TSUYUSATO Kitsune
2ba6ecefe5 Fix ada aliases 2015-03-26 12:08:46 +09:00
Garen Torikian
91c2a4682d Merge pull request #2274 from csimons/master
intro.wisp: Fixed typographical error ('rather then' -> 'rather than').
2015-03-25 13:24:10 -07:00
Patrick Toomey
738be195ef Bump escape-utils to 1.1.0 2015-03-25 14:18:46 -06:00
Christopher L. Simons
5dcc4d74ec intro.wisp: Fixed typographical error ('rather then' -> 'rather than'). 2015-03-25 14:35:16 -04:00
Arfon Smith
4213bec62a Merge pull request #2272 from lpil/master
Elixir: Add mix.lock filename
2015-03-25 09:04:07 -05:00
Louis Pilfold
babe733bf4 Elixir: Add mix.lock filename 2015-03-25 13:52:52 +00:00
Arfon Smith
ab5f60555e Merge pull request #2270 from larsbrinkhoff/ocaml
Add interpreters for OCaml.
2015-03-25 08:39:49 -05:00
Lars Brinkhoff
b61e33a49e Add interpreters for OCaml. 2015-03-25 08:11:40 +01:00
Arfon Smith
a0d5a8338b Merge pull request #2269 from stuartpb/patch-2
Use #000080 for Lua color
2015-03-24 19:24:34 -05:00
Arfon Smith
eec321f013 Merge pull request #2265 from github/cut-release-v4.5.3
Bumping to v4.5.3
2015-03-24 19:08:59 -05:00
Stuart P. Bentley
e538f72b63 Use #000080 for Lua color
This is the color of the official Lua logo, as seen at http://www.lua.org/images/
2015-03-24 14:34:13 -07:00
Dorian Marié
bde843b67f Add .ruby to the list of ruby file extensions
Can be found in Rails partial, eg `.html.ruby`
2015-03-24 18:59:53 +01:00
Arfon Smith
44c3d47b30 Bumping to v4.5.3 2015-03-24 12:33:35 -05:00
Arfon Smith
f1d3f396bb Merge pull request #2264 from github/grammar-update
Updating grammars
2015-03-24 12:28:29 -05:00
Arfon Smith
65ae444791 Updating grammars 2015-03-24 12:26:40 -05:00
Arfon Smith
e9916c644d Merge pull request #2263 from github/NetLinx
Net linx
2015-03-24 12:09:15 -05:00
Arfon Smith
1940a9ea92 Merge branch 'master' into NetLinx 2015-03-24 11:41:26 -05:00
Arfon Smith
c9f8a2677a Merge pull request #2261 from ntkme/storyboard-xib-xml
.storyboard and .xib as XML
2015-03-24 11:38:39 -05:00
Arfon Smith
5b6b3f74b5 Merge pull request #2262 from drautb/master
Fix categorization for Racket shell scripts.
2015-03-24 11:38:21 -05:00
Vicent Marti
f9ccac4240 Merge pull request #2259 from github/bump-rugged
Bump rugged to latest release
2015-03-24 08:36:52 -07:00
Ben Draut
aa7aae7808 Fix categorization for Racket shell scripts.
The current implementation categorizes shell scripts written in Racket
as Scheme, which is incorrect.

For example:

```racket
\#!/usr/bin/env racket

\#lang racket

"Hello World!"
```

This should be categorized as Racket, not Scheme. [This file][1]
demonstrates the problem in an existing repository.

[1]: https://github.com/drautb/sketchbook/blob/master/racket/sublime-project-generator/generate-sublime-project.rkt
2015-03-24 08:22:00 -06:00
なつき
7c66301583 .storyboard and .xib as XML 2015-03-24 01:58:55 -07:00
michael tesch
a5b0b333b0 Merge branch 'master' into tesch1-emacs-patch-1 2015-03-24 09:44:08 +01:00
Andy Delcambre
7df872eb7f Bump rugged to latest release 2015-03-23 14:33:03 -06:00
Arfon Smith
6a4f4c724c Merge pull request #2253 from larsbrinkhoff/dtrace-script-mode
Fix Emacs modeline in DTrace sample.
2015-03-23 15:30:03 -05:00
Lars Brinkhoff
76828c45c7 Fix Emacs modeline in DTrace sample.
Apparently, the DTrace mode for Emacs is called dtrace-script:
https://github.com/dotemacs/dtrace-script-mode
2015-03-23 19:43:32 +01:00
Arfon Smith
27215f148b Merge pull request #2257 from Oldes/rebol_grammar_scope
Adding tm_scope for REBOL language and removing REBOL from LICENSE_WHITE...
2015-03-23 11:30:48 -05:00
Arfon Smith
77d52463ad Merge pull request #2256 from Oldes/red_grammar
Added grammar submodule for Red language
2015-03-23 11:30:06 -05:00
Oldes
0f6c2afbf6 Sublime-REBOL submodule updated. 2015-03-23 15:58:01 +01:00
Oldes
cbaa3ca6f4 Adding tm_scope for REBOL language and removing REBOL from LICENSE_WHITELIST as now is license available in the Sublime-REBOL project. 2015-03-23 11:38:07 +01:00
Oldes
63f54bdf06 Added grammar submodule for Red language 2015-03-23 10:43:39 +01:00
Alex McLain
b302863a4d Added additional sample files. 2015-03-21 20:22:46 -07:00
Alex McLain
ec46b1a92e Added NetLinx language. 2015-03-21 18:58:09 -07:00
Arfon Smith
ed65040539 Merge pull request #2250 from shaneog/patch-2
Add Neovim config file names to VimL language
2015-03-21 16:56:00 -05:00
Arfon Smith
cc1a420bc5 Merge pull request #2254 from shaunlebron/master
add .boot to clojure extensions
2015-03-21 16:54:20 -05:00
Shaun Williams
8555b20380 add .boot Clojure sample 2015-03-21 12:02:20 -05:00
Shaun Williams
6462ba70f9 put .boot after primary .clj extension 2015-03-21 11:48:52 -05:00
Shaun Williams
1ac43e0d7d reorder .boot to be in order 2015-03-21 11:32:29 -05:00
Shaun Williams
6ac51968c6 add .boot to clojure extensions 2015-03-21 11:20:48 -05:00
Shane O'Grady
cbcadf8e45 Add Neovim config file names to VimL language
Neovim uses configuration files named `.nvimrc` rather than `.vimrc`

See this PR for details neovim/neovim#330
2015-03-21 09:53:21 -03:00
Arfon Smith
74b111501d Merge pull request #2213 from ntkme/source-map
Detect generated source maps
2015-03-20 09:26:40 -05:00
なつき
67e4212f64 Test detecting generated source maps 2015-03-19 19:50:40 -07:00
Arfon Smith
55559a1020 Merge pull request #2246 from ampl/nl
Add a heuristic to disambiguate between NL and NewLisp
2015-03-19 20:26:56 -05:00
なつき
b103232e0e Detect generated source maps 2015-03-19 17:38:59 -07:00
vitaut
b587379f4a Add a heuristic to disambiguate between NL and NewLisp 2015-03-19 17:33:52 -07:00
Arfon Smith
ba654b2a1d Merge pull request #2242 from larsbrinkhoff/types
Fix the type classification of some languages.
2015-03-19 08:46:55 -05:00
Lars Brinkhoff
ae39475133 Fix the type classification of some languages. 2015-03-19 07:09:42 +01:00
Arfon Smith
c641ea833f Merge pull request #2241 from github/cut-release-v4.5.2
v4.5.2
2015-03-18 10:45:42 -05:00
Arfon Smith
ebf10c2cd6 v4.5.2 2015-03-18 09:50:57 -05:00
Arfon Smith
29ef8beb3f Grammar submodule update 2015-03-18 09:47:43 -05:00
Arfon Smith
2b5f38264b Merge pull request #2222 from chriskuehl/master
languages.yml: don't assume .conf is Apache
2015-03-18 09:27:32 -05:00
Arfon Smith
5850716eb3 Merge pull request #2236 from Phasesaber/master
Give Diff a color
2015-03-18 09:24:46 -05:00
Arfon Smith
3db6c4a5b6 Merge pull request #2227 from samoht/OCaml
Disambiguate between OCaml and Standard ML
2015-03-18 09:05:12 -05:00
Thomas Gazagnaire
e79607372b Disambiguate between OCaml and Standard ML
Fix #2208
2015-03-18 09:58:14 +00:00
Arfon Smith
b5472ab753 Merge pull request #2123 from larsbrinkhoff/for
Some .for files are text.
2015-03-17 14:59:53 -05:00
Lars Brinkhoff
013188dcd9 Add new language Formatted for .for.
Sample file wksst8110.for is from the Climate Prediction Center at the
National Weather Service of the USA, and is in the public domain.
2015-03-17 20:44:06 +01:00
Jαdon Fowler
3cf7bfbee2 Give Diff a color 2015-03-16 23:44:08 -07:00
michael tesch
5f647f2236 more realistic emacs modeline for dtrace sample 2015-03-16 19:56:06 +01:00
Arfon Smith
3bb740fe9f Merge pull request #2198 from tarebyte/handlebars_color
Assign handlebars a color for the language bar.
2015-03-16 07:58:05 -05:00
michael tesch
50db5c012e disable modelines strategy for webidl sample 2015-03-15 20:18:57 +01:00
michael tesch
dcb14d0fc7 disable modelines strategy for webidl sample 2015-03-15 20:06:41 +01:00
michael tesch
419cfe54e0 disable modelines strategy match for dtrace sample 2015-03-15 13:05:43 +01:00
michael tesch
ce1f51a34f forgot a | 2015-03-15 12:51:14 +01:00
michael tesch
5fd7992f98 dont save useless matches, thanks to pchaigno 2015-03-15 12:40:31 +01:00
Arfon Smith
3f5a96a15b Merge pull request #2017 from github/revert-2014-revert-1976-path-for-fileblob
Cut 4.5.0 release
2015-03-14 20:42:20 -05:00
Arfon Smith
840bdf95e3 v4.5.1 2015-03-14 20:32:18 -05:00
Arfon Smith
01deb07ae9 Return false for empty file. 2015-03-14 20:19:11 -05:00
michael tesch
fda0f2a042 detect emacs modeline for fundamental as Text 2015-03-14 23:53:17 +01:00
michael tesch
6af4ab6db1 harder test 2015-03-14 23:26:08 +01:00
michael tesch
6aab682728 fixed case with multiple other file vars before and after mode: 2015-03-14 23:24:41 +01:00
Arfon Smith
6c37613bf0 Merge branch 'master' into revert-2014-revert-1976-path-for-fileblob 2015-03-14 17:18:36 -05:00
Arfon Smith
188c7364f8 Merge pull request #2209 from chezwicker/master
Add .plsql as extension for PL/SQL
2015-03-14 17:17:52 -05:00
Arfon Smith
09ead55502 Merge pull request #2232 from pchaigno/cython-generated-files
Detect Cython generated files
2015-03-14 17:16:45 -05:00
michael tesch
a364e4a2dc tests for emacs modeline regex 2015-03-14 23:13:59 +01:00
Arfon Smith
f7f9513fba Merge branch 'master' into revert-2014-revert-1976-path-for-fileblob 2015-03-14 17:13:31 -05:00
Arfon Smith
dd2d2389c8 Cobol grammars fix. 2015-03-14 17:11:44 -05:00
Michael Tesch
1bb639617c Create seeplusplusEmacs1
one type of emacs modeline
2015-03-14 22:44:02 +01:00
Chris Zwicker
03b43a85c8 Change sorting of extensions to fix failing test 2015-03-14 20:16:31 +00:00
Chris Zwicker
fb709e2e10 Add sample file for .plsql extension 2015-03-14 19:59:25 +00:00
Chris Zwicker
dad653492a Merge remote-tracking branch 'upstream/master' 2015-03-14 19:56:27 +00:00
Paul Chaignon
0db133ffb2 Detect Cython generated files 2015-03-14 19:43:17 +01:00
Arfon Smith
6d1682911b Merge branch 'master' into revert-2014-revert-1976-path-for-fileblob 2015-03-14 13:14:26 -05:00
Arfon Smith
d1de479c49 Merge branch 'master' of github.com:github/linguist 2015-03-14 13:13:07 -05:00
Arfon Smith
ad7e231f39 Updating grammars 2015-03-14 13:12:37 -05:00
Arfon Smith
f36d239b85 Merge pull request #2229 from pchaigno/perl6-grammar
Grammar for Perl6
2015-03-14 13:08:29 -05:00
Arfon Smith
540865d045 Merge pull request #2231 from pchaigno/description-group
Description of group attribute
2015-03-14 13:08:06 -05:00
Arfon Smith
5ed0da7b08 v4.5.0 2015-03-14 13:06:55 -05:00
Michael Tesch
068c8a341d better regex for matching emacs modeline
the emacs modeline is actually a per-file variable setting mechanism, which means it can have other flags in it.

this regex extracts the part that corresponds to the file's language ("mode:" - ie emacs major mode)

http://ergoemacs.org/emacs_manual/emacs/Specifying-File-Variables.html
2015-03-14 18:35:57 +01:00
Paul Chaignon
e61be66d4f Grammar for Perl and Perl6 from TextMate bundle 2015-03-14 11:47:44 +01:00
Paul Chaignon
d263f0c91a Remove submodule for Perl grammar 2015-03-14 11:42:30 +01:00
Arfon Smith
fee0cebcec Merge branch 'master' into revert-2014-revert-1976-path-for-fileblob 2015-03-13 11:42:24 -07:00
Arfon Smith
3745308642 Merge pull request #2224 from github/bin-linguist
Simplifying requires
2015-03-12 11:13:37 -07:00
Arfon Smith
8843fa3ed4 Merge pull request #2218 from xPaw/patch-1
Detect *.sma files as SourcePawn
2015-03-12 11:13:24 -07:00
Arfon Smith
464d6e9ec4 Simplifying requires 2015-03-12 10:41:34 -07:00
Chris Kuehl
02ced24751 languages.yml: don't assume .conf is Apache
The assumption that `.conf` files are Apache is causing many projects to
be detected incorrectly as being primarily "ApacheConf".

The `.conf` extension is widely used by software; Apache accounts for
only a very tiny proportion of its overall use. The addition of `.conf`
for ApacheConf has resulted in projects which contain none (or almost
no) Apache config being marked as primarily containing it.

The problem was introduced by 18a3ef9e5e
2015-03-10 22:19:22 -07:00
Pavel
8b9ad131d1 Create foo.sma 2015-03-10 16:20:59 +02:00
Pavel
5ef944e8b8 Detect *.sma files as SourcePawn 2015-03-10 11:16:17 +02:00
Mark Tareshawty
ea0145fda5 Merge branch 'master' into handlebars_color 2015-03-09 10:04:51 -04:00
Adam Roben
53c3cb382c Merge pull request #2207 from github/update-popular
Update popular languages
2015-03-09 09:15:30 -04:00
Brandon Keepers
179c557e5b Merge pull request #2215 from github/apt-get-update
apt-get update before downloading deps
2015-03-08 16:35:06 -07:00
Brandon Keepers
8da458e1a8 apt-get update before downloading deps 2015-03-08 16:24:05 -07:00
Mark Tareshawty
b009c85b64 inverted color 2015-03-08 15:31:52 -04:00
Brandon Keepers
3eb3dd7d4b Merge pull request #2178 from munrocape/patch-1
Standardized color hexcode length to 6
2015-03-07 19:57:24 -08:00
Chris Zwicker
c9a1159a2e Add .plsql as extension for PL/SQL 2015-03-07 08:51:16 +00:00
Paul Chaignon
17f75e64ba .vhost as an Apache extension 2015-03-06 21:19:28 +01:00
Adam Roben
8664668524 Update popular languages
I took all non-fork repositories on github.com, grouped them by their
primary language, and took the 25 most popular.
2015-03-06 14:26:09 -05:00
Arfon Smith
3ba4cf699a Merge pull request #2202 from pchaigno/jbuilder
.jbuilder as a Ruby extension
2015-03-06 07:33:51 -06:00
Arfon Smith
8bc39ce44f Merge pull request #2204 from aquileia/patch-1
Exclude gettext catalogues from statistics
2015-03-06 07:26:39 -06:00
aquileia
2d03eae413 Exclude gettext catalogues from statistics
Gettext catalogues are used for translations and are thus essentially prose, but were classified as "programming" in 507d191d7d.

In large projects like e.g. wesnoth/wesnoth, gettext can dominate the language statistics with about 95% although the actual code is C++.
2015-03-06 13:34:19 +01:00
Paul Chaignon
0157b9eb37 .vhost as a Nginx extension 2015-03-06 07:38:54 +01:00
Paul Chaignon
0d848b342f .jbuilder as a Ruby extension 2015-03-06 07:07:41 +01:00
Arfon Smith
ad6030b0e8 Merge pull request #2200 from github/cut-release-v4.4.3
Bumping version to 4.4.3
2015-03-05 16:37:40 -06:00
Arfon Smith
bdb2a221a5 Bumping version to 4.4.3 2015-03-05 15:13:54 -06:00
Arfon Smith
44f505e687 Grammars update 2015-03-05 15:08:05 -06:00
Arfon Smith
d931dacd47 Merge pull request #2196 from larsbrinkhoff/glsl-group
GLSL should not be in the C group.
2015-03-05 15:03:45 -06:00
Arfon Smith
1da425ae2f Merge pull request #2162 from github/instrumentation
Add instrumentation to detection and classification
2015-03-05 15:03:30 -06:00
Arfon Smith
9ceea4ac81 Merge pull request #2173 from github/moar-instrumentation
Instrument all calls and pass the blob, strategy and language candidates in the payload.
2015-03-05 15:02:42 -06:00
Arfon Smith
a1010b8cf8 Actually return the strategy 2015-03-05 13:21:07 -06:00
Paul Chaignon
19a300a4ba Description of group attribute 2015-03-05 20:14:15 +01:00
Arfon Smith
1bc1803628 Check for block here too 2015-03-05 12:50:12 -06:00
Brandon Keepers
7fdead0100 Only yield if block given 2015-03-05 10:11:08 -08:00
Brandon Keepers
3dcdc11c1b Avoid passing block to detected instrumenter 2015-03-05 10:03:51 -08:00
Brandon Keepers
e8326529b5 Pass blob to instrumentation 2015-03-05 10:03:01 -08:00
Brandon Keepers
2d5476f6c8 Yield the block in LocalInstrumenter 2015-03-05 10:01:28 -08:00
Mark Tareshawty
781133d0d3 assign handlebars a color 2015-03-04 19:42:32 -05:00
Lars Brinkhoff
c7b4cf636f GLSL should not be in the C group. 2015-03-04 21:26:55 +01:00
Arfon Smith
d81c796dc0 Merge pull request #2193 from pchaigno/nl
Support for NL file format
2015-03-03 21:43:55 -06:00
Arfon Smith
1a3680bba6 Merge pull request #2189 from pchaigno/qml-programming-type
QML as a programming language
2015-03-03 11:50:49 -06:00
Arfon Smith
600bca149a Merge pull request #2192 from graymalkin/master
Added XC syntax
2015-03-03 11:50:29 -06:00
Simon Cooksey
3a56d632e1 Fixed build by removing duplicate C syntax definition 2015-03-03 13:09:19 +00:00
Simon Cooksey
7f3f0327c2 Added XC syntax 2015-03-03 12:45:08 +00:00
Paul Chaignon
cc0c71b277 New sample for NL 2015-03-02 22:13:17 +01:00
Paul Chaignon
e5ce286c63 NL file format with .nl extension 2015-03-02 21:55:41 +01:00
Arfon Smith
86a0cf9424 Merge pull request #2188 from graymalkin/patch-1
Add colour for XMOS XC in linguist
2015-03-02 11:11:40 -06:00
Paul Chaignon
eaea6ac837 QML as a programming language 2015-03-02 18:09:09 +01:00
Simon Cooksey
4efc3ff822 Add colour for XMOS XC in linguist
Adds a colour matching the XMOS colour scheme for .xc files.
2015-03-02 17:04:18 +00:00
Arfon Smith
c22a6563d9 Writing some (failing) tests for instrumentation 2015-03-01 22:13:26 -06:00
Arfon Smith
f9683efb74 Merge pull request #2184 from redj/ec-lang-color
Add designated color of eC language for display in language bar.
2015-03-01 19:21:27 -06:00
Rejean Loyer
08945923e6 Add designated color of eC language in lib/linguist/languages.yml for display in repository page's language bar. 2015-03-01 18:54:47 -05:00
Arfon Smith
4745c62853 Merge pull request #2181 from pchaigno/prolog-heuristic
More specific heuristic for Prolog
2015-03-01 11:13:58 -06:00
Paul Chaignon
7c593899e7 Make heuristic for Prolog more specific 2015-03-01 12:43:35 +01:00
Arfon Smith
9151e7066a Merge pull request #2175 from github/sqlllll
Sqlllll
2015-02-28 20:45:08 -06:00
Paul Chaignon
730be65514 Ignore symlinks in repository statistics 2015-02-28 16:08:16 +01:00
Zach Munro-Cape
b358a22d32 Standardized color hexcode length to 6
C was the only language to have a hex code length of 3. 
#555555 == #555 == rgb(85, 85, 85)
2015-02-27 23:02:13 -04:00
Arfon Smith
8a0ff14d22 Merge pull request #2112 from nwellnhof/patch-1
Mark XS files as "type: programming"
2015-02-27 14:19:42 -06:00
Arfon Smith
7604a2d80b Merge pull request #2176 from github/2073-local
2073 local
2015-02-27 14:16:03 -06:00
Arfon Smith
78b1c8a430 Merge branch 'master' into 2073-local 2015-02-27 14:12:23 -06:00
Arfon Smith
4ef925d8be Merge pull request #2087 from pchaigno/case-sensitivity
Detection by extension made case-insensitive
2015-02-27 14:06:50 -06:00
Arfon Smith
7ba4f0c571 Oracle grammar now has a license 2015-02-27 13:51:23 -06:00
Arfon Smith
63fc9dd6a5 Updating grammars 2015-02-27 13:50:29 -06:00
Arfon Smith
b350f1572b Reformatting 2015-02-27 13:36:20 -06:00
Arfon Smith
e24a9ba602 Ordering 2015-02-27 13:36:12 -06:00
Arfon Smith
a338228b57 Merge branch 'master' into sqlllll 2015-02-27 13:32:09 -06:00
Arfon Smith
d6d232ec37 Merge pull request #2154 from pchaigno/kicad-files
Support for .pro INI files (KiCad project files)
2015-02-27 10:14:20 -06:00
Brandon Keepers
b723405e9f Merge pull request #2174 from github/2171-local
2171 local
2015-02-27 01:00:54 -10:00
Arfon Smith
cecb125b0b Merge branch 'master' into 2171-local 2015-02-26 21:13:18 -06:00
Arfon Smith
2177ff1806 Merge pull request #2024 from halirutan/feature-Mathematica10Extensions
New Mathematica (aka Wolfram Language) extensions added
2015-02-26 21:10:00 -06:00
Arfon Smith
674eb31cfe Merge pull request #2145 from larsbrinkhoff/muf
Add MUF - Multi-user Forth
2015-02-26 21:04:13 -06:00
Arfon Smith
9783710adf Merge pull request #2160 from brandonwamboldt/use-vcl
Use correct VCL syntax highlighting
2015-02-26 21:02:35 -06:00
Arfon Smith
8888555f71 Merge pull request #2102 from phillipberndt/master
Added a sample of a C header file that is currently recognized as C++
2015-02-26 21:00:52 -06:00
Arfon Smith
13a6180507 Merge pull request #2128 from larsbrinkhoff/d
Add to .d: DTrace and Makefile dependencies
2015-02-26 20:52:41 -06:00
Arfon Smith
9a86b9ad75 Instrument all calls and pass the blob, strategy and language candidates in the payload. 2015-02-26 15:27:33 -06:00
Paul Chaignon
65260e3aaa Grammar for OpenScad from TextMate bundle 2015-02-26 21:59:03 +01:00
Victor Zverovich
51af1bd162 Use AMPL grammar 2015-02-26 10:40:56 -08:00
Victor Zverovich
e093ac843f Remove AMPL samples using .mod, .dat and .run extensions 2015-02-25 14:22:45 -08:00
Victor Zverovich
13eb7c796e Remove .dat, .mod and .run AMPL extensions as they are ambiguous
As discussed in #2073 adding these extensions will require more work
to avoid incorrect language detection.
2015-02-25 12:59:23 -08:00
Victor Zverovich
1cdd3c55ab Add AMPL grammar 2015-02-25 12:56:02 -08:00
Victor Zverovich
407dbbb7fb Mark AMPL with tm_scope: none because it doesn't have grammar info 2015-02-25 12:54:31 -08:00
Victor Zverovich
0bccf97d16 Add support for the AMPL modeling and script language 2015-02-25 12:54:31 -08:00
Lars Brinkhoff
c6e16ee6bd MUF sample files.
39.m by Revar; license GPL v2.
cmd-say.muf by Natasha Snunkemeox; license MIT.
2015-02-25 19:29:57 +01:00
Lars Brinkhoff
2b25bb6d1c Add MUF language - Multi-user Forth. 2015-02-25 19:29:57 +01:00
Lars Brinkhoff
e791a71566 Add DTrace and Makefile dependency includes.
Sample file mpq.d by Georg Lukas; license GPL 2.
Sample file counts.d by Kate Turner; public domain.
Sample file javascript-race.d by unknown; license MPL 1.1/GPL 2.0/LGPL 2.1.
Sample file probes.d by momjian; license TBD.
2015-02-25 19:29:56 +01:00
Arfon Smith
739b512cee Prefer 'statistics' 2015-02-25 08:18:45 -06:00
Arfon Smith
effcab4297 Merge pull request #2165 from deviantintegral/attr-highlight-note
Issue #2140: Note that only modelines control syntax highlighting.
2015-02-25 08:17:55 -06:00
Nick Wellnhofer
2e1161e061 Add sample XS file 2015-02-25 15:14:34 +01:00
Andrew Berry
649a5987e7 Issue #2140: Note that only modelines control syntax highlighting. 2015-02-25 08:54:41 -05:00
Brandon Wamboldt
71e0e2bc8e Use actual VCL syntax highlighting 2015-02-24 17:54:23 -08:00
Charlie Somerville
fd7633518f add instrumentation to detection and classification 2015-02-25 12:34:07 +11:00
Garen Torikian
04252c28f2 Merge pull request #2153 from github/enforce-type
Test that languages have a type
2015-02-24 13:34:22 -08:00
Arfon Smith
94be1ab277 documentation? should use path too 2015-02-24 15:20:58 -06:00
Arfon Smith
8561f2a6b0 Merge branch 'master' into revert-2014-revert-1976-path-for-fileblob
Conflicts:
	lib/linguist/version.rb
2015-02-24 14:54:14 -06:00
Arfon Smith
2bd050657d Merge pull request #2151 from soonhokong/master
add support for Lean Theorem Prover
2015-02-24 14:34:59 -06:00
Arfon Smith
c7d8f39ad8 Merge pull request #2158 from github/overrides-should-support-aliases-too
Finding by alias too.
2015-02-24 14:32:21 -06:00
Arfon Smith
ad4b5bdc16 Merge pull request #2157 from hoosierEE/master
Add a color code for J language to languages.yml.
2015-02-24 14:31:53 -06:00
Arfon Smith
ef5eff45aa Merge pull request #2152 from pchaigno/generated-go
Detect Go files generated by Protocol Buffers
2015-02-24 14:30:37 -06:00
Arfon Smith
d18c8614ba Merge pull request #2147 from pchaigno/tcc-interpreter
tcc interpreter for C
2015-02-24 14:25:38 -06:00
Arfon Smith
29192e8d5f Finding by alias too. 2015-02-24 14:10:41 -06:00
Soonho Kong
c2e894c48c add ace-mode support for Lean 2015-02-24 14:45:15 -05:00
Alex Shroyer
2cc6e5bfe6 Update languages.yml
Add a color for J language.  This color is the average of the colors of the [J wiki icon](http://www.jsoftware.com/jwiki/moin_static194/common/jwlogo.png).
2015-02-24 10:58:33 -05:00
Soonho Kong
2d15ea54cb add support for Lean Theorem Prover 2015-02-23 11:32:22 -05:00
Garen Torikian
6b26386a81 Improve "no type found" error message 2015-02-22 20:21:02 -08:00
CodingAnarchy
525e886d79 Comments added to one sample 2015-02-22 11:00:14 -08:00
CodingAnarchy
05f73df064 Brainfuck samples 2015-02-22 11:00:14 -08:00
Paul Chaignon
e592381a54 Support for .pro INI files (KiCad project files)
Update the heuristic for .pro to include both INI and QMake files
Fixes #2116
2015-02-22 19:33:06 +01:00
Garen Torikian
fecf0cc137 There is no "other" 2015-02-22 10:32:01 -08:00
Garen Torikian
507d191d7d Add missing types 2015-02-22 10:27:24 -08:00
Garen Torikian
8420e4b044 Test that languages have a type 2015-02-22 10:23:48 -08:00
Paul Chaignon
2ca5868610 Detect Go files generated by Protocol Buffers 2015-02-22 10:50:47 +01:00
Paul Chaignon
6d8559eccb Add test file for C interpreter tcc 2015-02-21 17:16:33 +01:00
Paul Chaignon
53d020f7b0 tcc interpreter for C 2015-02-21 17:10:43 +01:00
Adam Roben
ad9a2d231e Merge pull request #2141 from github/release-4.4.2
Release v4.4.2
2015-02-20 15:51:24 -05:00
Brahn Partridge
ef22eee4d9 updating submodule to latest with license 2015-02-17 13:18:19 +01:00
Brahn Partridge
b609f24bbc added ace_mode 2015-02-17 13:09:00 +01:00
Brahn Partridge
83b03df98b Merge branch 'master' of https://github.com/github/linguist
Conflicts:
	grammars.yml
2015-02-17 12:56:19 +01:00
Nick Wellnhofer
7cdb5ccba8 Mark XS files as "type: programming"
I'd actually prefer to treat Perl XS files as C code, but this fix shouldn't be controversial.
2015-02-13 15:37:39 +01:00
Phillip Berndt
dc852b6398 Added a sample of a C header file that is currently recognized as C++
See https://github.com/github/linguist/issues/1626#issuecomment-73870081
Taken from 469fe63df4/pqiv.h
2015-02-11 13:00:11 +01:00
David Pyke Le Brun
5e9bb67d10 temporary add grammer to whitelist until license gets added 2015-02-09 14:27:14 +00:00
David Pyke Le Brun
e969172543 recode heuristic to use existing style. add additional sample 2015-02-09 14:16:25 +00:00
David Pyke Le Brun
f570260dfe Merge remote-tracking branch 'upstream/master' into plsql
Conflicts:
	.gitmodules
2015-02-09 12:04:21 +00:00
David Pyke Le Brun
7ecf65551e re-add oracle grammer module using https 2015-02-09 11:58:50 +00:00
David Pyke Le Brun
fb6ec8aaa7 remove oracle grammer. (to be readded) 2015-02-09 11:46:14 +00:00
Paul Chaignon
41e1b7bd4e Detection by extension made case-insensitive 2015-02-06 22:14:22 +01:00
David Pyke Le Brun
3e54d6651c update of old PL/SQL PLpgSQL and SQLPL patch based on current version
see [linguist] add support for oracle PLSQL (#1003)
2015-02-06 13:36:40 +00:00
Felipe Oliveira Carvalho
96c2f86613 Add cpplint.py to vendor.yml
`cpplint.py` is Google's Python script used for linting C++ files.
I have a small C++ project with `cpplint.py` included mistakenly making
Python the main language of my project.
2015-02-04 02:22:08 -03:00
halirutan
aa8eb955e9 Removed .mt file extension and example since there are more languages that use this. 2015-01-26 01:44:45 +01:00
halirutan
8e52c18200 Merge branch 'master' into feature-Mathematica10Extensions 2015-01-26 01:43:13 +01:00
halirutan
e468723abc Reordered the extensions entries for Mathematica
Added examples for newly introduces file extensions
2015-01-24 01:00:41 +01:00
halirutan
99bfde32a8 Merge branch 'master' into feature-Mathematica10Extensions 2015-01-24 00:54:03 +01:00
halirutan
c6e8915627 Added Wolfram Language extensions to the Mathematica section. I checked whether other languages have the same extensions I indroduced which is not the case.
Added a sample .wlt file for a Wolfram Unit Test
2015-01-23 04:40:47 +01:00
Arfon Smith
496b3e5a78 Bumping to 4.3.0 beta 2015-01-20 14:48:25 -06:00
Arfon Smith
01be9e68ee Revert "Revert "Use path for Generated?"" 2015-01-20 14:34:36 -06:00
Maximo Dominguez
56c3b8c3fe Added generated rule for SpecFlow's *.feature.cs
More info about specFlow here http://www.specflow.org/
2015-01-18 19:31:47 -04:00
Gerwin Klein
f18ae4f99f add support for Isabelle ROOT file syntax 2014-12-27 10:13:02 +11:00
Brahn Partridge
43ee45d9b6 Merge branch 'master' of https://github.com/github/linguist
Conflicts:
	grammars.yml
2014-11-27 13:47:56 +01:00
Brahn Partridge
02db72515f removed less common extensions and better examples 2014-11-27 13:41:21 +01:00
Brahn Partridge
af9b5f0e98 remove sample that is no longer used 2014-11-26 15:11:23 +01:00
Brahn Partridge
a145bd92f7 remove tpl extension to avoid conflict with smarty language 2014-11-26 15:07:28 +01:00
Brahn Partridge
20204cd9fc fix test_pedantic failure 2014-11-26 15:01:25 +01:00
Brahn Partridge
3445e55744 additional samples and fixed extensions list 2014-11-26 14:51:47 +01:00
Brahn Partridge
036b9c4094 Hello world sample 2014-11-24 11:32:53 +01:00
Brahn Partridge
ce928d8b64 Add support for the Clarion language 2014-11-24 11:30:25 +01:00
Geoff Nixon
edadca9085 Add comment styles, don't choke on #!/usr/bin/env foo=bar... 2014-11-02 03:07:21 -08:00
Tomas Morstein
08290ac49e remove very rarely used .dcl extension for now
...to avoid collision with Clean language as well
as the .dcl extension can be seen only in some special
cases -- especially in context of DCL emulation tools
for non-OpenVMS systems (probably to avoid potential
confusion with MS-DOS .com files).
2014-10-04 22:46:32 +02:00
Tomas Morstein
42944660bd no need to group DCL and MMS/MMK 2014-10-04 22:02:27 +02:00
Tomas Morstein
ae5e1c5a85 DCL & MMS lexers are not supported, use Text only 2014-10-04 21:43:20 +02:00
Tomas Morstein
f4f5ccb3f5 add MMS/MMK samples 2014-10-04 20:43:39 +02:00
Tomas Morstein
ab3f44cb6e add DECset Module Management System support 2014-10-04 20:38:46 +02:00
Tomas Morstein
d7757033ab DCL examples 2014-10-04 20:33:28 +02:00
Tomas Morstein
8bb9241e6e add DIGITAL Command Language (DCL) 2014-10-04 19:08:57 +02:00
386 changed files with 76232 additions and 56094 deletions

90
.gitmodules vendored
View File

@@ -96,7 +96,7 @@
url = https://github.com/bfad/Sublime-Lasso url = https://github.com/bfad/Sublime-Lasso
[submodule "vendor/grammars/chapel-tmbundle"] [submodule "vendor/grammars/chapel-tmbundle"]
path = vendor/grammars/chapel-tmbundle path = vendor/grammars/chapel-tmbundle
url = https://github.com/bholt/chapel-tmbundle url = https://github.com/chapel-lang/chapel-tmbundle
[submodule "vendor/grammars/sublime-nginx"] [submodule "vendor/grammars/sublime-nginx"]
path = vendor/grammars/sublime-nginx path = vendor/grammars/sublime-nginx
url = https://github.com/brandonwamboldt/sublime-nginx url = https://github.com/brandonwamboldt/sublime-nginx
@@ -118,9 +118,6 @@
[submodule "vendor/grammars/cucumber-tmbundle"] [submodule "vendor/grammars/cucumber-tmbundle"]
path = vendor/grammars/cucumber-tmbundle path = vendor/grammars/cucumber-tmbundle
url = https://github.com/cucumber/cucumber-tmbundle url = https://github.com/cucumber/cucumber-tmbundle
[submodule "vendor/grammars/Handlebars"]
path = vendor/grammars/Handlebars
url = https://github.com/daaain/Handlebars
[submodule "vendor/grammars/powershell"] [submodule "vendor/grammars/powershell"]
path = vendor/grammars/powershell path = vendor/grammars/powershell
url = https://github.com/SublimeText/PowerShell url = https://github.com/SublimeText/PowerShell
@@ -136,9 +133,6 @@
[submodule "vendor/grammars/fancy-tmbundle"] [submodule "vendor/grammars/fancy-tmbundle"]
path = vendor/grammars/fancy-tmbundle path = vendor/grammars/fancy-tmbundle
url = https://github.com/fancy-lang/fancy-tmbundle url = https://github.com/fancy-lang/fancy-tmbundle
[submodule "vendor/grammars/fsharpbinding"]
path = vendor/grammars/fsharpbinding
url = https://github.com/fsharp/fsharpbinding
[submodule "vendor/grammars/monkey.tmbundle"] [submodule "vendor/grammars/monkey.tmbundle"]
path = vendor/grammars/monkey.tmbundle path = vendor/grammars/monkey.tmbundle
url = https://github.com/gingerbeardman/monkey.tmbundle url = https://github.com/gingerbeardman/monkey.tmbundle
@@ -169,9 +163,6 @@
[submodule "vendor/grammars/Textmate-Gosu-Bundle"] [submodule "vendor/grammars/Textmate-Gosu-Bundle"]
path = vendor/grammars/Textmate-Gosu-Bundle path = vendor/grammars/Textmate-Gosu-Bundle
url = https://github.com/jpcamara/Textmate-Gosu-Bundle url = https://github.com/jpcamara/Textmate-Gosu-Bundle
[submodule "vendor/grammars/jquery-tmbundle"]
path = vendor/grammars/jquery-tmbundle
url = https://github.com/kswedberg/jquery-tmbundle
[submodule "vendor/grammars/fish-tmbundle"] [submodule "vendor/grammars/fish-tmbundle"]
path = vendor/grammars/fish-tmbundle path = vendor/grammars/fish-tmbundle
url = https://github.com/l15n/fish-tmbundle url = https://github.com/l15n/fish-tmbundle
@@ -346,9 +337,6 @@
[submodule "vendor/grammars/java.tmbundle"] [submodule "vendor/grammars/java.tmbundle"]
path = vendor/grammars/java.tmbundle path = vendor/grammars/java.tmbundle
url = https://github.com/textmate/java.tmbundle url = https://github.com/textmate/java.tmbundle
[submodule "vendor/grammars/javadoc.tmbundle"]
path = vendor/grammars/javadoc.tmbundle
url = https://github.com/textmate/javadoc.tmbundle
[submodule "vendor/grammars/javascript-objective-j.tmbundle"] [submodule "vendor/grammars/javascript-objective-j.tmbundle"]
path = vendor/grammars/javascript-objective-j.tmbundle path = vendor/grammars/javascript-objective-j.tmbundle
url = https://github.com/textmate/javascript-objective-j.tmbundle url = https://github.com/textmate/javascript-objective-j.tmbundle
@@ -397,9 +385,6 @@
[submodule "vendor/grammars/pascal.tmbundle"] [submodule "vendor/grammars/pascal.tmbundle"]
path = vendor/grammars/pascal.tmbundle path = vendor/grammars/pascal.tmbundle
url = https://github.com/textmate/pascal.tmbundle url = https://github.com/textmate/pascal.tmbundle
[submodule "vendor/grammars/perl.tmbundle"]
path = vendor/grammars/perl.tmbundle
url = https://github.com/textmate/perl.tmbundle
[submodule "vendor/grammars/php-smarty.tmbundle"] [submodule "vendor/grammars/php-smarty.tmbundle"]
path = vendor/grammars/php-smarty.tmbundle path = vendor/grammars/php-smarty.tmbundle
url = https://github.com/textmate/php-smarty.tmbundle url = https://github.com/textmate/php-smarty.tmbundle
@@ -427,9 +412,6 @@
[submodule "vendor/grammars/ruby-haml.tmbundle"] [submodule "vendor/grammars/ruby-haml.tmbundle"]
path = vendor/grammars/ruby-haml.tmbundle path = vendor/grammars/ruby-haml.tmbundle
url = https://github.com/textmate/ruby-haml.tmbundle url = https://github.com/textmate/ruby-haml.tmbundle
[submodule "vendor/grammars/ruby-on-rails-tmbundle"]
path = vendor/grammars/ruby-on-rails-tmbundle
url = https://github.com/textmate/ruby-on-rails-tmbundle
[submodule "vendor/grammars/scheme.tmbundle"] [submodule "vendor/grammars/scheme.tmbundle"]
path = vendor/grammars/scheme.tmbundle path = vendor/grammars/scheme.tmbundle
url = https://github.com/textmate/scheme.tmbundle url = https://github.com/textmate/scheme.tmbundle
@@ -448,15 +430,6 @@
[submodule "vendor/grammars/tcl.tmbundle"] [submodule "vendor/grammars/tcl.tmbundle"]
path = vendor/grammars/tcl.tmbundle path = vendor/grammars/tcl.tmbundle
url = https://github.com/textmate/tcl.tmbundle url = https://github.com/textmate/tcl.tmbundle
[submodule "vendor/grammars/text.tmbundle"]
path = vendor/grammars/text.tmbundle
url = https://github.com/textmate/text.tmbundle
[submodule "vendor/grammars/textile.tmbundle"]
path = vendor/grammars/textile.tmbundle
url = https://github.com/textmate/textile.tmbundle
[submodule "vendor/grammars/textmate.tmbundle"]
path = vendor/grammars/textmate.tmbundle
url = https://github.com/textmate/textmate.tmbundle
[submodule "vendor/grammars/thrift.tmbundle"] [submodule "vendor/grammars/thrift.tmbundle"]
path = vendor/grammars/thrift.tmbundle path = vendor/grammars/thrift.tmbundle
url = https://github.com/textmate/thrift.tmbundle url = https://github.com/textmate/thrift.tmbundle
@@ -490,10 +463,6 @@
[submodule "vendor/grammars/sublime-nix"] [submodule "vendor/grammars/sublime-nix"]
path = vendor/grammars/sublime-nix path = vendor/grammars/sublime-nix
url = https://github.com/wmertens/sublime-nix url = https://github.com/wmertens/sublime-nix
[submodule "vendor/grammars/ada.tmbundle"]
path = vendor/grammars/ada.tmbundle
url = https://github.com/aroben/ada.tmbundle
branch = better-with-highlighting
[submodule "vendor/grammars/oz-tmbundle"] [submodule "vendor/grammars/oz-tmbundle"]
path = vendor/grammars/oz-tmbundle path = vendor/grammars/oz-tmbundle
url = https://github.com/eregon/oz-tmbundle url = https://github.com/eregon/oz-tmbundle
@@ -615,6 +584,12 @@
[submodule "vendor/grammars/mediawiki.tmbundle"] [submodule "vendor/grammars/mediawiki.tmbundle"]
path = vendor/grammars/mediawiki.tmbundle path = vendor/grammars/mediawiki.tmbundle
url = https://github.com/textmate/mediawiki.tmbundle url = https://github.com/textmate/mediawiki.tmbundle
[submodule "vendor/grammars/SublimeClarion"]
path = vendor/grammars/SublimeClarion
url = https://github.com/fushnisoft/SublimeClarion
[submodule "vendor/grammars/oracle.tmbundle"]
path = vendor/grammars/oracle.tmbundle
url = https://github.com/mulander/oracle.tmbundle.git
[submodule "vendor/grammars/BrightScript.tmbundle"] [submodule "vendor/grammars/BrightScript.tmbundle"]
path = vendor/grammars/BrightScript.tmbundle path = vendor/grammars/BrightScript.tmbundle
url = https://github.com/cmink/BrightScript.tmbundle url = https://github.com/cmink/BrightScript.tmbundle
@@ -627,3 +602,54 @@
[submodule "vendor/grammars/sublime-text-pig-latin"] [submodule "vendor/grammars/sublime-text-pig-latin"]
path = vendor/grammars/sublime-text-pig-latin path = vendor/grammars/sublime-text-pig-latin
url = https://github.com/goblindegook/sublime-text-pig-latin url = https://github.com/goblindegook/sublime-text-pig-latin
[submodule "vendor/grammars/Lean.tmbundle"]
path = vendor/grammars/Lean.tmbundle
url = https://github.com/leanprover/Lean.tmbundle
[submodule "vendor/grammars/ampl"]
path = vendor/grammars/ampl
url = https://github.com/ampl/sublime-ampl
[submodule "vendor/grammars/openscad.tmbundle"]
path = vendor/grammars/openscad.tmbundle
url = https://github.com/tbuser/openscad.tmbundle
[submodule "vendor/grammars/sublime-varnish"]
path = vendor/grammars/sublime-varnish
url = https://github.com/brandonwamboldt/sublime-varnish
[submodule "vendor/grammars/xc.tmbundle"]
path = vendor/grammars/xc.tmbundle
url = https://github.com/graymalkin/xc.tmbundle
[submodule "vendor/grammars/perl.tmbundle"]
path = vendor/grammars/perl.tmbundle
url = https://github.com/textmate/perl.tmbundle
[submodule "vendor/grammars/sublime-netlinx"]
path = vendor/grammars/sublime-netlinx
url = https://github.com/amclain/sublime-netlinx
[submodule "vendor/grammars/Sublime-Red"]
path = vendor/grammars/Sublime-Red
url = https://github.com/Oldes/Sublime-Red
[submodule "vendor/grammars/jflex.tmbundle"]
path = vendor/grammars/jflex.tmbundle
url = https://github.com/jflex-de/jflex.tmbundle.git
[submodule "vendor/grammars/Sublime-Modula-2"]
path = vendor/grammars/Sublime-Modula-2
url = https://github.com/harogaston/Sublime-Modula-2
[submodule "vendor/grammars/ada.tmbundle"]
path = vendor/grammars/ada.tmbundle
url = https://github.com/textmate/ada.tmbundle
[submodule "vendor/grammars/api-blueprint-sublime-plugin"]
path = vendor/grammars/api-blueprint-sublime-plugin
url = https://github.com/apiaryio/api-blueprint-sublime-plugin
[submodule "vendor/grammars/Handlebars"]
path = vendor/grammars/Handlebars
url = https://github.com/daaain/Handlebars
[submodule "vendor/grammars/smali-sublime"]
path = vendor/grammars/smali-sublime
url = https://github.com/ShaneWilton/sublime-smali
[submodule "vendor/grammars/language-jsoniq"]
path = vendor/grammars/language-jsoniq
url = http://github.com/wcandillon/language-jsoniq
[submodule "vendor/grammars/atom-fsharp"]
path = vendor/grammars/atom-fsharp
url = https://github.com/fsprojects/atom-fsharp
[submodule "vendor/grammars/SMT.tmbundle"]
path = vendor/grammars/SMT.tmbundle
url = https://github.com/SRI-CSL/SMT.tmbundle.git

View File

@@ -1,4 +1,3 @@
sudo: false
before_install: script/travis/before_install before_install: script/travis/before_install
rvm: rvm:
- 1.9.3 - 1.9.3

View File

@@ -2,9 +2,27 @@
Hi there! We're thrilled that you'd like to contribute to this project. Your help is essential for keeping it great. The majority of contributions won't need to touch any Ruby code at all. Hi there! We're thrilled that you'd like to contribute to this project. Your help is essential for keeping it great. The majority of contributions won't need to touch any Ruby code at all.
## Adding an extension to a language
We try only to add new extensions once they have some usage on GitHub. In most cases we prefer that extensions be in use in hundreds of repositories before supporting them in Linguist.
To add support for a new extension:
0. Add your extension to the language entry in [`languages.yml`][languages].
0. Add at least one sample for your extension to the [samples directory][samples] in the correct subdirectory.
0. Open a pull request, linking to a [GitHub search result](https://github.com/search?utf8=%E2%9C%93&q=extension%3Aboot+NOT+nothack&type=Code&ref=searchresults) showing in-the-wild usage.
In addition, if this extension is already listed in [`languages.yml`][languages] then sometimes a few more steps will need to be taken:
0. Make sure that example `.yourextension` files are present in the [samples directory][samples] for each language that uses `.yourextension`.
0. Test the performance of the Bayesian classifier with a relatively large number (1000s) of sample `.yourextension` files. (ping @arfon or @bkeepers to help with this) to ensure we're not misclassifying files.
0. If the Bayesian classifier does a bad job with the sample `.yourextension` files then a [heuristic](https://github.com/github/linguist/blob/master/lib/linguist/heuristics.rb) may need to be written to help.
## Adding a language ## Adding a language
We try only to add languages once they have some usage on GitHub. In most cases we prefer that languages be in use in hundreds of repositories before supporting them in Linguist. We try only to add languages once they have some usage on GitHub. In most cases we prefer that each new file extension be in use in hundreds of repositories before supporting them in Linguist.
To add support for a new language: To add support for a new language:
@@ -23,12 +41,14 @@ In addition, if your new language defines an extension that's already listed in
Remember, the goal here is to try and avoid false positives! Remember, the goal here is to try and avoid false positives!
## Fixing a misclassified language ## Fixing a misclassified language
Most languages are detected by their file extension defined in [languages.yml][languages]. For disambiguating between files with common extensions, linguist applies some [heuristics](/lib/linguist/heuristics.rb) and a [statistical classifier](lib/linguist/classifier.rb). This process can help differentiate between, for example, `.h` files which could be either C, C++, or Obj-C. Most languages are detected by their file extension defined in [languages.yml][languages]. For disambiguating between files with common extensions, linguist applies some [heuristics](/lib/linguist/heuristics.rb) and a [statistical classifier](lib/linguist/classifier.rb). This process can help differentiate between, for example, `.h` files which could be either C, C++, or Obj-C.
Misclassifications can often be solved by either adding a new filename or extension for the language or adding more [samples][samples] to make the classifier smarter. Misclassifications can often be solved by either adding a new filename or extension for the language or adding more [samples][samples] to make the classifier smarter.
## Fixing syntax highlighting ## Fixing syntax highlighting
Syntax highlighting in GitHub is performed using TextMate-compatible grammars. These are the same grammars that TextMate, Sublime Text and Atom use. Every language in [languages.yml][languages] is mapped to its corresponding TM `scope`. This scope will be used when picking up a grammar for highlighting. Syntax highlighting in GitHub is performed using TextMate-compatible grammars. These are the same grammars that TextMate, Sublime Text and Atom use. Every language in [languages.yml][languages] is mapped to its corresponding TM `scope`. This scope will be used when picking up a grammar for highlighting.
@@ -37,7 +57,7 @@ Assuming your code is being detected as the right language, in most cases this i
You can also try to fix the bug yourself and submit a Pull Request. [TextMate's documentation](http://manual.macromates.com/en/language_grammars) offers a good introduction on how to work with TextMate-compatible grammars. You can test grammars using [Lightshow](https://github-lightshow.herokuapp.com). You can also try to fix the bug yourself and submit a Pull Request. [TextMate's documentation](http://manual.macromates.com/en/language_grammars) offers a good introduction on how to work with TextMate-compatible grammars. You can test grammars using [Lightshow](https://github-lightshow.herokuapp.com).
Once the bug has been fixed upstream, please let us know and we'll pick it up for GitHub. Once the bug has been fixed upstream, we'll pick it up for GitHub in the next release of Linguist.
## Testing ## Testing
@@ -55,6 +75,7 @@ Sometimes getting the tests running can be too much work, especially if you don'
Here's our current build status: [![Build Status](https://secure.travis-ci.org/github/linguist.png?branch=master)](http://travis-ci.org/github/linguist) Here's our current build status: [![Build Status](https://secure.travis-ci.org/github/linguist.png?branch=master)](http://travis-ci.org/github/linguist)
## Releasing ## Releasing
If you are the current maintainer of this gem: If you are the current maintainer of this gem:

View File

@@ -26,7 +26,7 @@ Linguist supports a number of different custom overrides strategies for language
### Using gitattributes ### Using gitattributes
Add a `.gitattributes` file to your project and use standard git-style path matchers for the files you want to override to set `linguist-documentation`, `linguist-language`, and `linguist-vendored`. Add a `.gitattributes` file to your project and use standard git-style path matchers for the files you want to override to set `linguist-documentation`, `linguist-language`, and `linguist-vendored`. `.gitattributes` will be used to determine language statistics, but will not be used to syntax highlight files. To manually set syntax highlighting, use [Vim or Emacs modelines](#using-emacs-or-vim-modelines).
``` ```
$ cat .gitattributes $ cat .gitattributes
@@ -35,7 +35,7 @@ $ cat .gitattributes
Checking code you didn't write, such as JavaScript libraries, into your git repo is a common practice, but this often inflates your project's language stats and may even cause your project to be labeled as another language. By default, Linguist treats all of the paths defined in [lib/linguist/vendor.yml](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml) as vendored and therefore doesn't include them in the language statistics for a repository. Vendored files are also hidden by default in diffs on github.com. Checking code you didn't write, such as JavaScript libraries, into your git repo is a common practice, but this often inflates your project's language stats and may even cause your project to be labeled as another language. By default, Linguist treats all of the paths defined in [lib/linguist/vendor.yml](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml) as vendored and therefore doesn't include them in the language statistics for a repository. Vendored files are also hidden by default in diffs on github.com.
Use the `linguist-vendored` attribute to vendor or un-vendor paths. Use the `linguist-vendored` attribute to vendor or un-vendor paths. Please note, overriding the vendored (or un-vendored) status of a file only affects the language statistics for the repository and not the behavior in diffs on github.com.
``` ```
$ cat .gitattributes $ cat .gitattributes
@@ -53,16 +53,18 @@ project-docs/* linguist-documentation
docs/formatter.rb linguist-documentation=false docs/formatter.rb linguist-documentation=false
``` ```
### Using Emacs and Vim modelines ### Using Emacs or Vim modelines
Alternatively, you can use Vim and Emacs style modelines to set the language for a single file. Modelines can be placed anywhere within a file and are respected when determining how to syntax-highlight a file on GitHub.com Alternatively, you can use Vim or Emacs style modelines to set the language for a single file. Modelines can be placed anywhere within a file and are respected when determining how to syntax-highlight a file on GitHub.com
##### Vim
``` ```
Vim
vim: set filetype=prolog: vim: set filetype=prolog:
vim: set ft=cpp: vim: set ft=cpp:
```
Emacs ##### Emacs
```
-*- mode: php;-*- -*- mode: php;-*-
``` ```

View File

@@ -2,10 +2,8 @@
# linguist — detect language type for a file, or, given a directory, determine language breakdown # linguist — detect language type for a file, or, given a directory, determine language breakdown
# usage: linguist <path> [<--breakdown>] # usage: linguist <path> [<--breakdown>]
#
require 'linguist/file_blob' require 'linguist'
require 'linguist/language'
require 'linguist/repository'
require 'rugged' require 'rugged'
path = ARGV[0] || Dir.pwd path = ARGV[0] || Dir.pwd

View File

@@ -14,13 +14,14 @@ Gem::Specification.new do |s|
s.executables << 'linguist' s.executables << 'linguist'
s.add_dependency 'charlock_holmes', '~> 0.7.3' s.add_dependency 'charlock_holmes', '~> 0.7.3'
s.add_dependency 'escape_utils', '~> 1.0.1' s.add_dependency 'escape_utils', '~> 1.1.0'
s.add_dependency 'mime-types', '>= 1.19' s.add_dependency 'mime-types', '>= 1.19'
s.add_dependency 'rugged', '~> 0.22.0b4' s.add_dependency 'rugged', '>= 0.23.0b'
s.add_development_dependency 'minitest', '>= 5.0' s.add_development_dependency 'minitest', '>= 5.0'
s.add_development_dependency 'mocha' s.add_development_dependency 'mocha'
s.add_development_dependency 'pry' s.add_development_dependency 'pry'
s.add_development_dependency 'rake' s.add_development_dependency 'rake'
s.add_development_dependency 'yajl-ruby' s.add_development_dependency 'yajl-ruby'
s.add_development_dependency 'color-proximity', '~> 0.2.1'
end end

View File

@@ -63,6 +63,8 @@ vendor/grammars/JSyntax/:
- source.j - source.j
vendor/grammars/Julia.tmbundle: vendor/grammars/Julia.tmbundle:
- source.julia - source.julia
vendor/grammars/Lean.tmbundle:
- source.lean
vendor/grammars/LiveScript.tmbundle: vendor/grammars/LiveScript.tmbundle:
- source.livescript - source.livescript
vendor/grammars/Modelica/: vendor/grammars/Modelica/:
@@ -83,6 +85,8 @@ vendor/grammars/Racket:
- source.racket - source.racket
vendor/grammars/SCSS.tmbundle: vendor/grammars/SCSS.tmbundle:
- source.scss - source.scss
vendor/grammars/SMT.tmbundle:
- source.smt
vendor/grammars/Scalate.tmbundle: vendor/grammars/Scalate.tmbundle:
- source.scaml - source.scaml
- text.html.ssp - text.html.ssp
@@ -105,12 +109,16 @@ vendor/grammars/Sublime-Logos:
- source.logos - source.logos
vendor/grammars/Sublime-Loom: vendor/grammars/Sublime-Loom:
- source.loomscript - source.loomscript
vendor/grammars/Sublime-Modula-2/:
- source.modula2
vendor/grammars/Sublime-Nit: vendor/grammars/Sublime-Nit:
- source.nit - source.nit
vendor/grammars/Sublime-QML: vendor/grammars/Sublime-QML:
- source.qml - source.qml
vendor/grammars/Sublime-REBOL: vendor/grammars/Sublime-REBOL:
- source.rebol - source.rebol
vendor/grammars/Sublime-Red:
- source.red
vendor/grammars/Sublime-SQF-Language: vendor/grammars/Sublime-SQF-Language:
- source.sqf - source.sqf
vendor/grammars/Sublime-Text-2-OpenEdge-ABL: vendor/grammars/Sublime-Text-2-OpenEdge-ABL:
@@ -119,6 +127,8 @@ vendor/grammars/Sublime-VimL:
- source.viml - source.viml
vendor/grammars/SublimeBrainfuck: vendor/grammars/SublimeBrainfuck:
- source.bf - source.bf
vendor/grammars/SublimeClarion/:
- source.clarion
vendor/grammars/SublimePapyrus/: vendor/grammars/SublimePapyrus/:
- source.compiled-papyrus - source.compiled-papyrus
- source.papyrus - source.papyrus
@@ -141,6 +151,8 @@ vendor/grammars/actionscript3-tmbundle:
- text.xml.flex-config - text.xml.flex-config
vendor/grammars/ada.tmbundle: vendor/grammars/ada.tmbundle:
- source.ada - source.ada
vendor/grammars/ampl:
- source.ampl
vendor/grammars/ant.tmbundle: vendor/grammars/ant.tmbundle:
- text.xml.ant - text.xml.ant
vendor/grammars/antlr.tmbundle: vendor/grammars/antlr.tmbundle:
@@ -148,6 +160,9 @@ vendor/grammars/antlr.tmbundle:
vendor/grammars/apache.tmbundle: vendor/grammars/apache.tmbundle:
- source.apache-config - source.apache-config
- source.apache-config.mod_perl - source.apache-config.mod_perl
vendor/grammars/api-blueprint-sublime-plugin/:
- text.html.markdown.source.gfm.apib
- text.html.markdown.source.gfm.mson
vendor/grammars/applescript.tmbundle: vendor/grammars/applescript.tmbundle:
- source.applescript - source.applescript
vendor/grammars/asciidoc.tmbundle/: vendor/grammars/asciidoc.tmbundle/:
@@ -158,6 +173,8 @@ vendor/grammars/asp.tmbundle:
vendor/grammars/assembly.tmbundle: vendor/grammars/assembly.tmbundle:
- objdump.x86asm - objdump.x86asm
- source.x86asm - source.x86asm
vendor/grammars/atom-fsharp/:
- source.fsharp
vendor/grammars/atom-salt: vendor/grammars/atom-salt:
- source.python.salt - source.python.salt
- source.yaml.salt - source.yaml.salt
@@ -204,6 +221,7 @@ vendor/grammars/d.tmbundle:
vendor/grammars/dart-sublime-bundle: vendor/grammars/dart-sublime-bundle:
- source.dart - source.dart
- source.pubspec - source.pubspec
- text.dart-analysis-output
- text.dart-doccomments - text.dart-doccomments
vendor/grammars/desktop.tmbundle: vendor/grammars/desktop.tmbundle:
- source.desktop - source.desktop
@@ -236,8 +254,6 @@ vendor/grammars/fish-tmbundle:
vendor/grammars/fortran.tmbundle: vendor/grammars/fortran.tmbundle:
- source.fortran - source.fortran
- source.fortran.modern - source.fortran.modern
vendor/grammars/fsharpbinding:
- source.fsharp
vendor/grammars/gap-tmbundle/: vendor/grammars/gap-tmbundle/:
- source.gap - source.gap
vendor/grammars/gettext.tmbundle: vendor/grammars/gettext.tmbundle:
@@ -285,12 +301,10 @@ vendor/grammars/java.tmbundle:
- source.java-properties - source.java-properties
- text.html.jsp - text.html.jsp
- text.junit-test-report - text.junit-test-report
vendor/grammars/javadoc.tmbundle:
- text.html.javadoc
vendor/grammars/javascript-objective-j.tmbundle: vendor/grammars/javascript-objective-j.tmbundle:
- source.js.objj - source.js.objj
vendor/grammars/jquery-tmbundle: vendor/grammars/jflex.tmbundle:
- source.js.jquery - source.jflex
vendor/grammars/json.tmbundle: vendor/grammars/json.tmbundle:
- source.json - source.json
vendor/grammars/kotlin-sublime-package: vendor/grammars/kotlin-sublime-package:
@@ -311,6 +325,9 @@ vendor/grammars/language-hy:
vendor/grammars/language-javascript: vendor/grammars/language-javascript:
- source.js - source.js
- source.js.regexp - source.js.regexp
vendor/grammars/language-jsoniq/:
- source.jq
- source.xq
vendor/grammars/language-python: vendor/grammars/language-python:
- source.python - source.python
- source.regexp.python - source.regexp.python
@@ -381,14 +398,19 @@ vendor/grammars/ooc.tmbundle:
- source.ooc - source.ooc
vendor/grammars/opa.tmbundle: vendor/grammars/opa.tmbundle:
- source.opa - source.opa
vendor/grammars/openscad.tmbundle/:
- source.scad
vendor/grammars/oracle.tmbundle:
- source.plsql.oracle
vendor/grammars/oz-tmbundle/Syntaxes/Oz.tmLanguage: vendor/grammars/oz-tmbundle/Syntaxes/Oz.tmLanguage:
- source.oz - source.oz
vendor/grammars/pascal.tmbundle: vendor/grammars/pascal.tmbundle:
- source.pascal - source.pascal
vendor/grammars/perl.tmbundle: vendor/grammars/perl.tmbundle/:
- source.perl - source.perl
- source.perl.6
vendor/grammars/php-smarty.tmbundle: vendor/grammars/php-smarty.tmbundle:
- source.smarty - text.html.smarty
vendor/grammars/php.tmbundle: vendor/grammars/php.tmbundle:
- text.html.php - text.html.php
vendor/grammars/pike-textmate: vendor/grammars/pike-textmate:
@@ -415,20 +437,14 @@ vendor/grammars/restructuredtext.tmbundle:
- text.restructuredtext - text.restructuredtext
vendor/grammars/ruby-haml.tmbundle: vendor/grammars/ruby-haml.tmbundle:
- text.haml - text.haml
vendor/grammars/ruby-on-rails-tmbundle:
- source.js.erb.rails
- source.ruby.rails
- source.ruby.rails.rjs
- source.sql.ruby
- text.html.erb.rails
vendor/grammars/ruby-slim.tmbundle: vendor/grammars/ruby-slim.tmbundle:
- text.slim - text.slim
vendor/grammars/ruby.tmbundle: vendor/grammars/ruby.tmbundle:
- source.ruby - source.ruby
- text.html.erb - text.html.erb
vendor/grammars/sas.tmbundle: vendor/grammars/sas.tmbundle:
- source.SASLog
- source.sas - source.sas
- source.sas_log
vendor/grammars/sass-textmate-bundle: vendor/grammars/sass-textmate-bundle:
- source.sass - source.sass
vendor/grammars/scala.tmbundle: vendor/grammars/scala.tmbundle:
@@ -438,6 +454,8 @@ vendor/grammars/scheme.tmbundle:
- source.scheme - source.scheme
vendor/grammars/scilab.tmbundle: vendor/grammars/scilab.tmbundle:
- source.scilab - source.scilab
vendor/grammars/smali-sublime/smali.tmLanguage:
- source.smali
vendor/grammars/smalltalk-tmbundle: vendor/grammars/smalltalk-tmbundle:
- source.smalltalk - source.smalltalk
vendor/grammars/sql.tmbundle: vendor/grammars/sql.tmbundle:
@@ -466,6 +484,9 @@ vendor/grammars/sublime-idris:
- source.idris - source.idris
vendor/grammars/sublime-mask: vendor/grammars/sublime-mask:
- source.mask - source.mask
vendor/grammars/sublime-netlinx:
- source.netlinx
- source.netlinx.erb
vendor/grammars/sublime-nginx: vendor/grammars/sublime-nginx:
- source.nginx - source.nginx
vendor/grammars/sublime-nix: vendor/grammars/sublime-nix:
@@ -488,9 +509,12 @@ vendor/grammars/sublime-text-ox/:
- source.ox - source.ox
vendor/grammars/sublime-text-pig-latin/: vendor/grammars/sublime-text-pig-latin/:
- source.pig_latin - source.pig_latin
vendor/grammars/sublime-varnish:
- source.varnish.vcl
vendor/grammars/sublime_cobol: vendor/grammars/sublime_cobol:
- source.acucobol - source.acucobol
- source.cobol - source.cobol
- source.jcl
- source.opencobol - source.opencobol
vendor/grammars/sublime_man_page_support: vendor/grammars/sublime_man_page_support:
- source.man - source.man
@@ -502,13 +526,6 @@ vendor/grammars/swift.tmbundle:
vendor/grammars/tcl.tmbundle: vendor/grammars/tcl.tmbundle:
- source.tcl - source.tcl
- text.html.tcl - text.html.tcl
vendor/grammars/text.tmbundle:
- text.plain
vendor/grammars/textile.tmbundle:
- text.html.textile
vendor/grammars/textmate.tmbundle:
- source.regexp.oniguruma
- source.tm-properties
vendor/grammars/thrift.tmbundle: vendor/grammars/thrift.tmbundle:
- source.thrift - source.thrift
vendor/grammars/toml.tmbundle: vendor/grammars/toml.tmbundle:
@@ -520,6 +537,8 @@ vendor/grammars/verilog.tmbundle:
- source.verilog - source.verilog
vendor/grammars/x86-assembly-textmate-bundle: vendor/grammars/x86-assembly-textmate-bundle:
- source.asm.x86 - source.asm.x86
vendor/grammars/xc.tmbundle/:
- source.xc
vendor/grammars/xml.tmbundle: vendor/grammars/xml.tmbundle:
- text.xml - text.xml
- text.xml.xsl - text.xml.xsl

View File

@@ -6,3 +6,15 @@ require 'linguist/repository'
require 'linguist/samples' require 'linguist/samples'
require 'linguist/shebang' require 'linguist/shebang'
require 'linguist/version' require 'linguist/version'
class << Linguist
attr_accessor :instrumenter
def instrument(*args, &bk)
if instrumenter
instrumenter.instrument(*args, &bk)
else
yield if block_given?
end
end
end

View File

@@ -99,7 +99,7 @@ module Linguist
elsif name.nil? elsif name.nil?
"attachment" "attachment"
else else
"attachment; filename=#{EscapeUtils.escape_url(File.basename(name))}" "attachment; filename=#{EscapeUtils.escape_url(name)}"
end end
end end
@@ -233,7 +233,7 @@ module Linguist
# #
# Return true or false # Return true or false
def vendored? def vendored?
name =~ VendoredRegexp ? true : false path =~ VendoredRegexp ? true : false
end end
documentation_paths = YAML.load_file(File.expand_path("../documentation.yml", __FILE__)) documentation_paths = YAML.load_file(File.expand_path("../documentation.yml", __FILE__))
@@ -248,7 +248,7 @@ module Linguist
# #
# Return true or false # Return true or false
def documentation? def documentation?
name =~ DocumentationRegexp ? true : false path =~ DocumentationRegexp ? true : false
end end
# Public: Get each line of data # Public: Get each line of data
@@ -316,7 +316,7 @@ module Linguist
# #
# Return true or false # Return true or false
def generated? def generated?
@_generated ||= Generated.generated?(name, lambda { data }) @_generated ||= Generated.generated?(path, lambda { data })
end end
# Public: Detects the Language of the blob. # Public: Detects the Language of the blob.

View File

@@ -3,7 +3,7 @@ require 'linguist/blob_helper'
module Linguist module Linguist
# A FileBlob is a wrapper around a File object to make it quack # A FileBlob is a wrapper around a File object to make it quack
# like a Grit::Blob. It provides the basic interface: `name`, # like a Grit::Blob. It provides the basic interface: `name`,
# `data`, and `size`. # `data`, `path` and `size`.
class FileBlob class FileBlob
include BlobHelper include BlobHelper
@@ -14,43 +14,50 @@ module Linguist
# #
# Returns a FileBlob. # Returns a FileBlob.
def initialize(path, base_path = nil) def initialize(path, base_path = nil)
@path = path @fullpath = path
@name = base_path ? path.sub("#{base_path}/", '') : path @path = base_path ? path.sub("#{base_path}/", '') : path
end end
# Public: Filename # Public: Filename
# #
# Examples # Examples
# #
# FileBlob.new("/path/to/linguist/lib/linguist.rb").name # FileBlob.new("/path/to/linguist/lib/linguist.rb").path
# # => "/path/to/linguist/lib/linguist.rb" # # => "/path/to/linguist/lib/linguist.rb"
# #
# FileBlob.new("/path/to/linguist/lib/linguist.rb", # FileBlob.new("/path/to/linguist/lib/linguist.rb",
# "/path/to/linguist").name # "/path/to/linguist").path
# # => "lib/linguist.rb" # # => "lib/linguist.rb"
# #
# Returns a String # Returns a String
attr_reader :name attr_reader :path
# Public: Read file permissions # Public: Read file permissions
# #
# Returns a String like '100644' # Returns a String like '100644'
def mode def mode
File.stat(@path).mode.to_s(8) File.stat(@fullpath).mode.to_s(8)
end
# Public: File name
#
# Returns a String
def name
File.basename(@fullpath)
end end
# Public: Read file contents. # Public: Read file contents.
# #
# Returns a String. # Returns a String.
def data def data
File.read(@path) File.read(@fullpath)
end end
# Public: Get byte size # Public: Get byte size
# #
# Returns an Integer. # Returns an Integer.
def size def size
File.size(@path) File.size(@fullpath)
end end
# Public: Get file extension. # Public: Get file extension.
@@ -67,7 +74,7 @@ module Linguist
# #
# Returns an Array # Returns an Array
def extensions def extensions
basename, *segments = File.basename(name).split(".") basename, *segments = name.downcase.split(".")
segments.map.with_index do |segment, index| segments.map.with_index do |segment, index|
"." + segments[index..-1].join(".") "." + segments[index..-1].join(".")

View File

@@ -53,18 +53,25 @@ module Linguist
def generated? def generated?
xcode_file? || xcode_file? ||
generated_net_designer_file? || generated_net_designer_file? ||
generated_net_specflow_feature_file? ||
composer_lock? || composer_lock? ||
node_modules? || node_modules? ||
godeps? || godeps? ||
generated_by_zephir? || generated_by_zephir? ||
minified_files? || minified_files? ||
source_map? ||
compiled_coffeescript? || compiled_coffeescript? ||
generated_parser? || generated_parser? ||
generated_net_docfile? || generated_net_docfile? ||
generated_postscript? || generated_postscript? ||
compiled_cython_file? ||
generated_go? ||
generated_protocol_buffer? || generated_protocol_buffer? ||
generated_apache_thrift? ||
generated_jni_header? || generated_jni_header? ||
vcr_cassette? vcr_cassette? ||
generated_module? ||
generated_unity3d_meta?
end end
# Internal: Is the blob an Xcode file? # Internal: Is the blob an Xcode file?
@@ -94,6 +101,20 @@ module Linguist
end end
end end
# Internal: Is the blob a generated source map?
#
# Source Maps usually have .css.map or .js.map extensions. In case they
# are not following the name convention, detect them based on the content.
#
# Returns true or false.
def source_map?
return false unless extname.downcase == '.map'
name =~ /(\.css|\.js)\.map$/i || # Name convention
lines[0] =~ /^{"version":\d+,/ || # Revision 2 and later begin with the version number
lines[0] =~ /^\/\*\* Begin line maps\. \*\*\/{/ # Revision 1 begins with a magic comment
end
# Internal: Is the blob of JS generated by CoffeeScript? # Internal: Is the blob of JS generated by CoffeeScript?
# #
# CoffeeScript is meant to output JS that would be difficult to # CoffeeScript is meant to output JS that would be difficult to
@@ -162,6 +183,17 @@ module Linguist
name.downcase =~ /\.designer\.cs$/ name.downcase =~ /\.designer\.cs$/
end end
# Internal: Is this a codegen file for Specflow feature file?
#
# Visual Studio's SpecFlow extension generates *.feature.cs files
# from *.feature files, they are not meant to be consumed by humans.
# Let's hide them.
#
# Returns true or false
def generated_net_specflow_feature_file?
name.downcase =~ /\.feature\.cs$/
end
# Internal: Is the blob of JS a parser generated by PEG.js? # Internal: Is the blob of JS a parser generated by PEG.js?
# #
# PEG.js-generated parsers are not meant to be consumed by humans. # PEG.js-generated parsers are not meant to be consumed by humans.
@@ -202,6 +234,13 @@ module Linguist
creator.include?("ImageMagick") creator.include?("ImageMagick")
end end
def generated_go?
return false unless extname == '.go'
return false unless lines.count > 1
return lines[0].include?("Code generated by")
end
# Internal: Is the blob a C++, Java or Python source file generated by the # Internal: Is the blob a C++, Java or Python source file generated by the
# Protocol Buffer compiler? # Protocol Buffer compiler?
# #
@@ -213,6 +252,16 @@ module Linguist
return lines[0].include?("Generated by the protocol buffer compiler. DO NOT EDIT!") return lines[0].include?("Generated by the protocol buffer compiler. DO NOT EDIT!")
end end
# Internal: Is the blob generated by Apache Thrift compiler?
#
# Returns true or false
def generated_apache_thrift?
return false unless ['.rb', '.py', '.go', '.js', '.m', '.java', '.h', '.cc', '.cpp'].include?(extname)
return false unless lines.count > 1
return lines[0].include?("Autogenerated by Thrift Compiler") || lines[1].include?("Autogenerated by Thrift Compiler")
end
# Internal: Is the blob a C/C++ header generated by the Java JNI tool javah? # Internal: Is the blob a C/C++ header generated by the Java JNI tool javah?
# #
# Returns true of false. # Returns true of false.
@@ -262,5 +311,49 @@ module Linguist
# VCR Cassettes have "recorded_with: VCR" in the second last line. # VCR Cassettes have "recorded_with: VCR" in the second last line.
return lines[-2].include?("recorded_with: VCR") return lines[-2].include?("recorded_with: VCR")
end end
# Internal: Is this a compiled C/C++ file from Cython?
#
# Cython-compiled C/C++ files typically contain:
# /* Generated by Cython x.x.x on ... */
# on the first line.
#
# Return true or false
def compiled_cython_file?
return false unless ['.c', '.cpp'].include? extname
return false unless lines.count > 1
return lines[0].include?("Generated by Cython")
end
# Internal: Is it a KiCAD or GFortran module file?
#
# KiCAD module files contain:
# PCBNEW-LibModule-V1 yyyy-mm-dd h:mm:ss XM
# on the first line.
#
# GFortran module files contain:
# GFORTRAN module version 'x' created from
# on the first line.
#
# Return true of false
def generated_module?
return false unless extname == '.mod'
return false unless lines.count > 1
return lines[0].include?("PCBNEW-LibModule-V") ||
lines[0].include?("GFORTRAN module version '")
end
# Internal: Is this a metadata file from Unity3D?
#
# Unity3D Meta files start with:
# fileFormatVersion: X
# guid: XXXXXXXXXXXXXXX
#
# Return true or false
def generated_unity3d_meta?
return false unless extname == '.meta'
return false unless lines.count > 1
return lines[0].include?("fileFormatVersion: ")
end
end end
end end

View File

@@ -33,7 +33,7 @@ module Linguist
# disambiguate "Perl", "Prolog" do |data| # disambiguate "Perl", "Prolog" do |data|
# if data.include?("use strict") # if data.include?("use strict")
# Language["Perl"] # Language["Perl"]
# elsif data.include?(":-") # elsif /^[^#]+:-/.match(data)
# Language["Prolog"] # Language["Prolog"]
# end # end
# end # end
@@ -94,23 +94,27 @@ module Linguist
Language["Perl6"] Language["Perl6"]
elsif data.match(/use strict|use\s+v?5\./) elsif data.match(/use strict|use\s+v?5\./)
Language["Perl"] Language["Perl"]
elsif data.include?(":-") elsif /^[^#]+:-/.match(data)
Language["Prolog"] Language["Prolog"]
end end
end end
disambiguate "ECL", "Prolog" do |data| disambiguate "ECL", "Prolog" do |data|
if data.include?(":-") if /^[^#]+:-/.match(data)
Language["Prolog"] Language["Prolog"]
elsif data.include?(":=") elsif data.include?(":=")
Language["ECL"] Language["ECL"]
end end
end end
disambiguate "IDL", "Prolog" do |data| disambiguate "IDL", "Prolog", "INI", "QMake" do |data|
if data.include?(":-") if /^[^#]+:-/.match(data)
Language["Prolog"] Language["Prolog"]
else elsif data.include?("last_client=")
Language["INI"]
elsif data.include?("HEADERS") && data.include?("SOURCES")
Language["QMake"]
elsif /^\s*function[ \w,]+$/.match(data)
Language["IDL"] Language["IDL"]
end end
end end
@@ -125,7 +129,7 @@ module Linguist
end end
disambiguate "Common Lisp", "OpenCL", "Cool" do |data| disambiguate "Common Lisp", "OpenCL", "Cool" do |data|
if data.include?("(defun ") if /^\s*\((defun|in-package|defpackage) /i.match(data)
Language["Common Lisp"] Language["Common Lisp"]
elsif /^class/x.match(data) elsif /^class/x.match(data)
Language["Cool"] Language["Cool"]
@@ -151,16 +155,16 @@ module Linguist
end end
disambiguate "AsciiDoc", "AGS Script", "Public Key" do |data| disambiguate "AsciiDoc", "AGS Script", "Public Key" do |data|
if /^[=-]+(\s|\n)|{{[A-Za-z]/.match(data) if /^(----[- ]BEGIN|ssh-(rsa|dss)) /.match(data)
Language["Public Key"]
elsif /^[=-]+(\s|\n)|{{[A-Za-z]/.match(data)
Language["AsciiDoc"] Language["AsciiDoc"]
elsif /^(\/\/.+|((import|export)\s+)?(function|int|float|char)\s+((room|repeatedly|on|game)_)?([A-Za-z]+[A-Za-z_0-9]+)\s*[;\(])/.match(data) elsif /^(\/\/.+|((import|export)\s+)?(function|int|float|char)\s+((room|repeatedly|on|game)_)?([A-Za-z]+[A-Za-z_0-9]+)\s*[;\(])/.match(data)
Language["AGS Script"] Language["AGS Script"]
elsif /^-----BEGIN/.match(data)
Language["Public Key"]
end end
end end
disambiguate "FORTRAN", "Forth" do |data| disambiguate "FORTRAN", "Forth", "Formatted" do |data|
if /^: /.match(data) if /^: /.match(data)
Language["Forth"] Language["Forth"]
elsif /^([c*][^a-z]| (subroutine|program)\s|\s*!)/i.match(data) elsif /^([c*][^a-z]| (subroutine|program)\s|\s*!)/i.match(data)
@@ -168,27 +172,33 @@ module Linguist
end end
end end
disambiguate "F#", "Forth", "GLSL" do |data| disambiguate "F#", "Forth", "GLSL", "Filterscript" do |data|
if /^(: |new-device)/.match(data) if /^(: |new-device)/.match(data)
Language["Forth"] Language["Forth"]
elsif /^\s*(#light|import|let|module|namespace|open|type)/.match(data) elsif /^\s*(#light|import|let|module|namespace|open|type)/.match(data)
Language["F#"] Language["F#"]
elsif /^\s*(#include|#pragma|precision|uniform|varying|void)/.match(data) elsif /^\s*(#version|precision|uniform|varying|vec[234])/.match(data)
Language["GLSL"] Language["GLSL"]
elsif /#include|#pragma\s+(rs|version)|__attribute__/.match(data)
Language["Filterscript"]
end end
end end
disambiguate "M", "Mathematica", "Matlab", "Mercury", "Objective-C" do |data| disambiguate "Limbo", "M", "MUF", "Mathematica", "Matlab", "Mercury", "Objective-C" do |data|
if ObjectiveCRegex.match(data) if ObjectiveCRegex.match(data)
Language["Objective-C"] Language["Objective-C"]
elsif data.include?(":- module") elsif data.include?(":- module")
Language["Mercury"] Language["Mercury"]
elsif /^: /.match(data)
Language["MUF"]
elsif /^\s*;/.match(data) elsif /^\s*;/.match(data)
Language["M"] Language["M"]
elsif /^\s*\(\*/.match(data) elsif /^\s*\(\*/.match(data)
Language["Mathematica"] Language["Mathematica"]
elsif /^\s*%/.match(data) elsif /^\s*%/.match(data)
Language["Matlab"] Language["Matlab"]
elsif /^\w+\s*:\s*module\s*{/.match(data)
Language["Limbo"]
end end
end end
@@ -205,7 +215,7 @@ module Linguist
end end
disambiguate "Common Lisp", "NewLisp" do |data| disambiguate "Common Lisp", "NewLisp" do |data|
if /^\s*\((defun|in-package|defpackage) /.match(data) if /^\s*\((defun|in-package|defpackage) /i.match(data)
Language["Common Lisp"] Language["Common Lisp"]
elsif /^\s*\(define /.match(data) elsif /^\s*\(define /.match(data)
Language["NewLisp"] Language["NewLisp"]
@@ -229,5 +239,93 @@ module Linguist
Language["Text"] Language["Text"]
end end
end end
disambiguate "PLSQL", "SQLPL", "PLpgSQL", "SQL" do |data|
if /^\\i\b|AS \$\$|LANGUAGE '+plpgsql'+/i.match(data) || /SECURITY (DEFINER|INVOKER)/i.match(data) || /BEGIN( WORK| TRANSACTION)?;/i.match(data)
#Postgres
Language["PLpgSQL"]
elsif /(alter module)|(language sql)|(begin( NOT)+ atomic)/i.match(data) || /signal SQLSTATE '[0-9]+'/i.match(data)
#IBM db2
Language["SQLPL"]
elsif /pragma|\$\$PLSQL_|XMLTYPE|sysdate|systimestamp|\.nextval|connect by|AUTHID (DEFINER|CURRENT_USER)/i.match(data) || /constructor\W+function/i.match(data)
#Oracle
Language["PLSQL"]
elsif ! /begin|boolean|package|exception/i.match(data)
#Generic SQL
Language["SQL"]
end
end
disambiguate "D", "DTrace", "Makefile" do |data|
if /^module /.match(data)
Language["D"]
elsif /^((dtrace:::)?BEGIN|provider |#pragma (D (option|attributes)|ident)\s)/.match(data)
Language["DTrace"]
elsif /(\/.*:( .* \\)$| : \\$|^ : |: \\$)/.match(data)
Language["Makefile"]
end
end
disambiguate "OCaml", "Standard ML" do |data|
if /(^\s*module)|let rec |match\s+(\S+\s)+with/.match(data)
Language["OCaml"]
elsif /=> |case\s+(\S+\s)+of/.match(data)
Language["Standard ML"]
end
end
disambiguate "XML", "Modula-2", "Linux Kernel Module", "AMPL" do |data|
if data.include?('<!ENTITY ')
Language["XML"]
elsif /MODULE\s\w+\s*;/i.match(data) || /^\s*END \w+;$/i.match(data)
Language["Modula-2"]
else
[Language["Linux Kernel Module"], Language["AMPL"]]
end
end
disambiguate "NL", "NewLisp" do |data|
if /^(b|g)[0-9]+ /.match(data)
Language["NL"]
else
Language["NewLisp"]
end
end
disambiguate "Rust", "RenderScript" do |data|
if /^(use |fn |mod |pub |macro_rules|impl|#!?\[)/.match(data)
Language["Rust"]
elsif /#include|#pragma\s+(rs|version)|__attribute__/.match(data)
Language["RenderScript"]
end
end
disambiguate "Common Lisp", "Lex", "Groff", "PicoLisp" do |data|
if /\(def(un|macro)\s/.match(data)
Language["Common Lisp"]
elsif /^(%[%{}]xs|<.*>)/.match(data)
Language["Lex"]
elsif /^\.[a-z][a-z](\s|$)/i.match(data)
Language["Groff"]
elsif /^\((de|class|rel|code|data|must)\s/.match(data)
Language["PicoLisp"]
end
end
disambiguate "Groff", "Nemerle" do |data|
if /^[.']/.match(data)
Language["Groff"]
elsif /^(module|namespace|using)\s/.match(data)
Language["Nemerle"]
end
end
disambiguate "GAS", "Groff" do |data|
if /^[.'][a-z][a-z](\s|$)/i.match(data)
Language["Groff"]
elsif /((^|\s)move?[. ])|\.(include|globa?l)\s/.match(data)
Language["GAS"]
end
end
end end
end end

View File

@@ -73,7 +73,7 @@ module Linguist
raise ArgumentError, "Extension is missing a '.': #{extension.inspect}" raise ArgumentError, "Extension is missing a '.': #{extension.inspect}"
end end
@extension_index[extension] << language @extension_index[extension.downcase] << language
end end
language.interpreters.each do |interpreter| language.interpreters.each do |interpreter|
@@ -105,19 +105,31 @@ module Linguist
# Bail early if the blob is binary or empty. # Bail early if the blob is binary or empty.
return nil if blob.likely_binary? || blob.binary? || blob.empty? return nil if blob.likely_binary? || blob.binary? || blob.empty?
# Call each strategy until one candidate is returned. Linguist.instrument("linguist.detection", :blob => blob) do
STRATEGIES.reduce([]) do |languages, strategy| # Call each strategy until one candidate is returned.
candidates = strategy.call(blob, languages) languages = []
if candidates.size == 1 returning_strategy = nil
return candidates.first
elsif candidates.size > 1 STRATEGIES.each do |strategy|
# More than one candidate was found, pass them to the next strategy. returning_strategy = strategy
candidates candidates = Linguist.instrument("linguist.strategy", :blob => blob, :strategy => strategy, :candidates => languages) do
else strategy.call(blob, languages)
# No candiates were found, pass on languages from the previous strategy. end
languages if candidates.size == 1
languages = candidates
break
elsif candidates.size > 1
# More than one candidate was found, pass them to the next strategy.
languages = candidates
else
# No candidates, try the next strategy
end
end end
end.first
Linguist.instrument("linguist.detected", :blob => blob, :strategy => returning_strategy, :language => languages.first)
languages.first
end
end end
# Public: Get all Languages # Public: Get all Languages
@@ -191,7 +203,7 @@ module Linguist
# Returns all matching Languages or [] if none were found. # Returns all matching Languages or [] if none were found.
def self.find_by_extension(extname) def self.find_by_extension(extname)
extname = ".#{extname}" unless extname.start_with?(".") extname = ".#{extname}" unless extname.start_with?(".")
@extension_index[extname] @extension_index[extname.downcase]
end end
# DEPRECATED # DEPRECATED
@@ -528,8 +540,8 @@ module Linguist
if extnames = extensions[name] if extnames = extensions[name]
extnames.each do |extname| extnames.each do |extname|
if !options['extensions'].index { |x| x.end_with? extname } if !options['extensions'].index { |x| x.downcase.end_with? extname.downcase }
warn "#{name} has a sample with extension (#{extname}) that isn't explicitly defined in languages.yml" unless extname == '.script!' warn "#{name} has a sample with extension (#{extname.downcase}) that isn't explicitly defined in languages.yml"
options['extensions'] << extname options['extensions'] << extname
end end
end end

File diff suppressed because it is too large Load Diff

View File

@@ -14,13 +14,15 @@ module Linguist
attr_reader :repository attr_reader :repository
attr_reader :oid attr_reader :oid
attr_reader :name attr_reader :path
attr_reader :mode attr_reader :mode
def initialize(repo, oid, name, mode = nil) alias :name :path
def initialize(repo, oid, path, mode = nil)
@repository = repo @repository = repo
@oid = oid @oid = oid
@name = name @path = path
@mode = mode @mode = mode
end end
@@ -49,7 +51,7 @@ module Linguist
return @language if defined?(@language) return @language if defined?(@language)
@language = if lang = git_attributes['linguist-language'] @language = if lang = git_attributes['linguist-language']
Language.find_by_name(lang) Language.find_by_alias(lang)
else else
super super
end end

View File

@@ -9,21 +9,21 @@
- CSS - CSS
- Clojure - Clojure
- CoffeeScript - CoffeeScript
- Common Lisp - Go
- Diff
- Emacs Lisp
- Erlang
- HTML - HTML
- Haskell - Haskell
- Java - Java
- JavaScript - JavaScript
- Lua - Lua
- Matlab
- Objective-C - Objective-C
- PHP - PHP
- Perl - Perl
- Python - Python
- R
- Ruby - Ruby
- SQL
- Scala - Scala
- Scheme
- Shell - Shell
- Swift
- TeX
- VimL

View File

@@ -150,9 +150,10 @@ module Linguist
next if delta.binary next if delta.binary
if [:added, :modified].include? delta.status if [:added, :modified].include? delta.status
# Skip submodules # Skip submodules and symlinks
mode = delta.new_file[:mode] mode = delta.new_file[:mode]
next if (mode & 040000) != 0 mode_format = (mode & 0170000)
next if mode_format == 0120000 || mode_format == 040000 || mode_format == 0160000
blob = Linguist::LazyBlob.new(repository, delta.new_file[:oid], new, mode.to_s(8)) blob = Linguist::LazyBlob.new(repository, delta.new_file[:oid], new, mode.to_s(8))

View File

@@ -50,16 +50,13 @@ module Linguist
end end
else else
path = File.join(dirname, filename) path = File.join(dirname, filename)
extname = File.extname(filename)
if File.extname(filename) == ""
raise "#{path} is missing an extension, maybe it belongs in filenames/ subdir"
end
yield({ yield({
:path => path, :path => path,
:language => category, :language => category,
:interpreter => Shebang.interpreter(File.read(path)), :interpreter => Shebang.interpreter(File.read(path)),
:extname => File.extname(filename) :extname => extname.empty? ? nil : extname
}) })
end end
end end

View File

@@ -23,17 +23,20 @@ module Linguist
# First line must start with #! # First line must start with #!
return unless shebang && shebang.start_with?("#!") return unless shebang && shebang.start_with?("#!")
# Get the parts of the shebang without the #! s = StringScanner.new(shebang)
tokens = shebang.sub(/^#!\s*/, '').strip.split(' ')
# There was nothing after the #! # There was nothing after the #!
return if tokens.empty? return unless path = s.scan(/^#!\s*\S+/)
# Get the name of the interpreter # Keep going
script = File.basename(tokens.first) script = path.split('/').last
# Get next argument if interpreter was /usr/bin/env # if /usr/bin/env type shebang then walk the string
script = tokens[1] if script == 'env' if script == 'env'
s.scan(/\s+/)
s.scan(/.*=[^\s]+\s+/) # skip over variable arguments e.g. foo=bar
script = s.scan(/\S+/)
end
# Interpreter was /usr/bin/env with no arguments # Interpreter was /usr/bin/env with no arguments
return unless script return unless script
@@ -41,6 +44,9 @@ module Linguist
# "python2.6" -> "python2" # "python2.6" -> "python2"
script.sub! /(\.\d+)$/, '' script.sub! /(\.\d+)$/, ''
# #! perl -> perl
script.sub! /^#!\s*/, ''
# Check for multiline shebang hacks that call `exec` # Check for multiline shebang hacks that call `exec`
if script == 'sh' && if script == 'sh' &&
data.lines.first(5).any? { |l| l.match(/exec (\w+).+\$0.+\$@/) } data.lines.first(5).any? { |l| l.match(/exec (\w+).+\$0.+\$@/) }

View File

@@ -3,17 +3,7 @@ module Linguist
# Detects language based on filename and/or extension # Detects language based on filename and/or extension
class Filename class Filename
def self.call(blob, _) def self.call(blob, _)
name = blob.name.to_s Language.find_by_filename(blob.name.to_s)
# A bit of an elegant hack. If the file is executable but extensionless,
# append a "magic" extension so it can be classified with other
# languages that have shebang scripts.
extensions = FileBlob.new(name).extensions
if extensions.empty? && blob.mode && (blob.mode.to_i(8) & 05) == 05
name += ".script!"
end
Language.find_by_filename(name)
end end
end end
end end

View File

@@ -1,8 +1,8 @@
module Linguist module Linguist
module Strategy module Strategy
class Modeline class Modeline
EmacsModeline = /-\*-\s*mode:\s*(\w+);?\s*-\*-/i EmacsModeline = /-\*-\s*(?:(?!mode)[\w-]+\s*:\s*(?:[\w+-]+)\s*;?\s*)*(?:mode\s*:)?\s*([\w+-]+)\s*(?:;\s*(?!mode)[\w-]+\s*:\s*[\w+-]+\s*)*;?\s*-\*-/i
VimModeline = /\/\*\s*vim:\s*set\s*(?:ft|filetype)=(\w+):\s*\*\//i VimModeline = /vim:\s*set\s*(?:ft|filetype)=(\w+):/i
# Public: Detects language based on Vim and Emacs modelines # Public: Detects language based on Vim and Emacs modelines
# #

View File

@@ -22,8 +22,10 @@ module Linguist
# Start state on token, ignore anything till the next newline # Start state on token, ignore anything till the next newline
SINGLE_LINE_COMMENTS = [ SINGLE_LINE_COMMENTS = [
'//', # C '//', # C
'--', # Ada, Haskell, AppleScript
'#', # Ruby '#', # Ruby
'%', # Tex '%', # Tex
'"', # Vim
] ]
# Start state on opening token, ignore anything until the closing # Start state on opening token, ignore anything until the closing
@@ -130,6 +132,9 @@ module Linguist
# extract_shebang("#!/usr/bin/env node") # extract_shebang("#!/usr/bin/env node")
# # => "node" # # => "node"
# #
# extract_shebang("#!/usr/bin/env A=B foo=bar awk -f")
# # => "awk"
#
# Returns String token or nil it couldn't be parsed. # Returns String token or nil it couldn't be parsed.
def extract_shebang(data) def extract_shebang(data)
s = StringScanner.new(data) s = StringScanner.new(data)
@@ -138,6 +143,7 @@ module Linguist
script = path.split('/').last script = path.split('/').last
if script == 'env' if script == 'env'
s.scan(/\s+/) s.scan(/\s+/)
s.scan(/.*=[^\s]+\s+/)
script = s.scan(/\S+/) script = s.scan(/\S+/)
end end
script = script[/[^\d]+/, 0] if script script = script[/[^\d]+/, 0] if script

View File

@@ -24,6 +24,9 @@
- (^|/)config.guess$ - (^|/)config.guess$
- (^|/)config.sub$ - (^|/)config.sub$
# Linters
- cpplint.py
# Node dependencies # Node dependencies
- node_modules/ - node_modules/
@@ -67,6 +70,7 @@
- 3rd[-_]?party/ - 3rd[-_]?party/
- vendors?/ - vendors?/
- extern(al)?/ - extern(al)?/
- (^|/)[Vv]+endor/
# Debian packaging # Debian packaging
- ^debian/ - ^debian/
@@ -143,6 +147,9 @@
## Python ## ## Python ##
# Sphinx
- (^|/)docs?/_?(build|themes?|templates?|static)/
# django # django
- (^|/)admin_media/ - (^|/)admin_media/
@@ -157,12 +164,22 @@
## Obj-C ## ## Obj-C ##
# Carthage
- ^Carthage/
# Cocoapods # Cocoapods
- ^Pods/ - ^Pods/
# Sparkle # Sparkle
- (^|/)Sparkle/ - (^|/)Sparkle/
# Crashlytics
- Crashlytics.framework/
# Fabric
- Fabric.framework/
## Groovy ## ## Groovy ##
# Gradle # Gradle
@@ -221,7 +238,7 @@
- ^readme$ - ^readme$
# Test fixtures # Test fixtures
- ^[Tt]est/fixtures/ - ^[Tt]ests?/fixtures/
# PhoneGap/Cordova # PhoneGap/Cordova
- (^|/)cordova([^.]*)\.js$ - (^|/)cordova([^.]*)\.js$
@@ -233,7 +250,7 @@
# Vagrant # Vagrant
- ^Vagrantfile$ - ^Vagrantfile$
# .DS_Store's # .DS_Stores
- .[Dd][Ss]_[Ss]tore$ - .[Dd][Ss]_[Ss]tore$
# R packages # R packages
@@ -252,5 +269,8 @@
- proguard.pro - proguard.pro
- proguard-rules.pro - proguard-rules.pro
# PuPHPet
- ^puphpet/
# Android Google APIs # Android Google APIs
- (^|/)\.google_apis/ - (^|/)\.google_apis/

View File

@@ -1,3 +1,3 @@
module Linguist module Linguist
VERSION = "4.4.2" VERSION = "4.5.8"
end end

58
samples/AMPL/CT2.mod Normal file
View File

@@ -0,0 +1,58 @@
param num_beams; # number of beams
param num_rows >= 1, integer; # number of rows
param num_cols >= 1, integer; # number of columns
set BEAMS := 1 .. num_beams; # set of beams
set ROWS := 1 .. num_rows; # set of rows
set COLUMNS := 1 .. num_cols; # set of columns
# values for entries of each beam
param beam_values {BEAMS, ROWS, COLUMNS} >= 0;
# values of tumor
param tumor_values {ROWS, COLUMNS} >= 0;
# values of critical area
param critical_values {ROWS, COLUMNS} >= 0;
# critical maximum dosage requirement
param critical_max;
# tumor minimum dosage requirement
param tumor_min;
# dosage scalar of each beam
var X {i in BEAMS} >= 0;
# define the tumor area which includes the locations where tumor exists
set tumor_area := {k in ROWS, h in COLUMNS: tumor_values[k,h] > 0};
# define critical area
set critical_area := {k in ROWS, h in COLUMNS: critical_values[k,h] > 0};
var S {(k,h) in tumor_area} >= 0;
var T {(k,h) in critical_area} >= 0;
# maximize total dosage in tumor area
maximize total_tumor_dosage: sum {i in BEAMS} sum {(k,h) in tumor_area} X[i] * beam_values[i,k,h];
# minimize total dosage in critical area
minimize total_critical_dosage: sum {i in BEAMS} sum {(k,h) in critical_area} X[i] * beam_values[i,k,h];
# minimize total tumor slack
minimize total_tumor_slack: sum {(k,h) in tumor_area} S[k,h];
# minimize total critical area slack
minimize total_critical_slack: sum {(k,h) in critical_area} T[k,h];
# total dosage at each tumor location [k,h] should be >= min tumor dosage with slack variable
subject to tumor_limit {(k,h) in tumor_area} : sum {i in BEAMS} X[i] * beam_values[i,k,h] == tumor_min - S[k,h];
# total dosage at each critical location [k,h] should be = max critical dosage with slack variable
subject to critical_limit {(k,h) in critical_area} : sum {i in BEAMS} X[i] * beam_values[i,k,h] == critical_max + T[k,h];

25
samples/AMPL/toy.ampl Normal file
View File

@@ -0,0 +1,25 @@
# A toy knapsack problem from the LocalSolver docs written in AMPL.
set I;
param Value{I};
param Weight{I};
param KnapsackBound;
var Take{I} binary;
maximize TotalValue: sum{i in I} Take[i] * Value[i];
s.t. WeightLimit: sum{i in I} Take[i] * Weight[i] <= KnapsackBound;
data;
param:
I: Weight Value :=
0 10 1
1 60 10
2 30 15
3 40 40
4 30 60
5 20 90
6 20 100
7 2 15;
param KnapsackBound := 102;

View File

@@ -0,0 +1,55 @@
FORMAT: 1A
# Advanced Action API
A resource action is in fact a state transition. This API example demonstrates an action - state transition - to another resource.
## API Blueprint
+ [Previous: Resource Model](11.%20Resource%20Model.md)
+ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/11.%20Advanced%20Action.md)
# Tasks [/tasks/tasks{?status,priority}]
+ Parameters
+ status (string)
+ priority (number)
## List All Tasks [GET]
+ Response 200 (application/json)
[
{
"id": 123,
"name": "Exercise in gym",
"done": false,
"type": "task"
},
{
"id": 124,
"name": "Shop for groceries",
"done": true,
"type": "task"
}
]
## Retrieve Task [GET /task/{id}]
This is a state transition to another resource
+ Parameters
+ id (string)
+ Response 200 (application/json)
{
"id": 123,
"name": "Go to gym",
"done": false,
"type": "task"
}
## Delete Task [DELETE /task/{id}]
+ Parameters
+ id (string)
+ Response 204

View File

@@ -0,0 +1,39 @@
FORMAT: 1A
# Attributes API
This API example demonstrates how to describe body attributes of a request or response message.
In this case, the description is complementary (and duplicate!) to the provided JSON example in the body section. The [Advanced Attributes](09.%20Advanced%20Attributes.md) API example will demonstrate how to avoid duplicates and how to reuse attributes descriptions.
## API Blueprint
+ [Previous: Parameters](07.%20Parameters.md)
+ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/08.%20Attributes.md)
+ [Next: Advanced Attributes](09.%20Advanced%20Attributes.md)
# Group Coupons
## Coupon [/coupons/{id}]
A coupon contains information about a percent-off or amount-off discount you might want to apply to a customer.
### Retrieve a Coupon [GET]
Retrieves the coupon with the given ID.
+ Response 200 (application/json)
+ Attributes (object)
+ id: 250FF (string)
+ created: 1415203908 (number) - Time stamp
+ percent_off: 25 (number)
A positive integer between 1 and 100 that represents the discount the coupon will apply.
+ redeem_by (number) - Date after which the coupon can no longer be redeemed
+ Body
{
"id": "250FF",
"created": 1415203908,
"percent_off": 25,
"redeem_by:" null
}

View File

@@ -0,0 +1,18 @@
FORMAT: 1A
# The Simplest API
This is one of the simplest APIs written in the **API Blueprint**.
One plain resource combined with a method and that's it! We will explain what is going on in the next installment - [Resource and Actions](02.%20Resource%20and%20Actions.md).
**Note:** As we progress through the examples, do not also forget to view the [Raw](https://raw.github.com/apiaryio/api-blueprint/master/examples/01.%20Simplest%20API.md) code to see what is really going on in the API Blueprint, as opposed to just seeing the output of the Github Markdown parser.
Also please keep in mind that every single example in this course is a **real API Blueprint** and as such you can **parse** it with the [API Blueprint parser](https://github.com/apiaryio/drafter) or one of its [bindings](https://github.com/apiaryio/drafter#bindings).
## API Blueprint
+ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/01.%20Simplest%20API.md)
+ [Next: Resource and Actions](02.%20Resource%20and%20Actions.md)
# GET /message
+ Response 200 (text/plain)
Hello World!

View File

@@ -0,0 +1,17 @@
#######################
# HOSTNAME
######################
<VirtualHost 127.0.0.1:PORT>
ServerAdmin patrick@heysparkbox.com
DocumentRoot "/var/www/HOSTNAME"
ServerName HOSTNAME
<Directory "/var/www/HOSTNAME">
Options Indexes MultiViews FollowSymLinks
AllowOverride All
Order allow,deny
Allow from all
DirectoryIndex index.php
</Directory>
</VirtualHost>

View File

@@ -1,6 +1,9 @@
AsciiDoc Home Page AsciiDoc Home Page
================== ==================
Title
-----
Example Articles Example Articles
~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~
- Item 1 - Item 1

View File

@@ -0,0 +1,245 @@
push r2
dint
nop
bis #MPYDLYWRTEN,&MPY32CTL0
bic #MPYDLY32,&MPY32CTL0
mov #SUMEXT,r13
clr r12
mov @r15+,r4
mov @r15+,r5
mov @r15+,r6
mov @r15+,r7
mov @r15+,r8
mov @r15+,r9
mov @r15+,r10
mov @r15+,r11
sub #2*8,r15
/* SELF_STEP_FIRST */
mov r4,&MPY32L
mov r5,&MPY32H
mov r4,&OP2L
mov r5,&OP2H
/* COLUMN_END */
mov &RES0,2*0(r14)
mov &RES1,2*(0+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
/* STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov r6,&OP2L
mov r7,&OP2H
add &SUMEXT,r12
mov r6,&OP2L
mov r7,&OP2H
/* COLUMN_END */
mov &RES0,2*2(r14)
add @r13,r12
mov &RES1,2*(2+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov r8,&OP2L
mov r9,&OP2H
add &SUMEXT,r12
mov r8,&OP2L
mov r9,&OP2H
/* SELF_STEP */
mov r6,&MAC32L
mov r7,&MAC32H
add @r13,r12
mov r6,&OP2L
mov r7,&OP2H
/* COLUMN_END */
mov &RES0,2*4(r14)
add @r13,r12
mov &RES1,2*(4+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov r10,&OP2L
mov r11,&OP2H
add &SUMEXT,r12
mov r10,&OP2L
mov r11,&OP2H
/* STEP_2MORE */
mov r6,&MAC32L
mov r7,&MAC32H
add @r13,r12
mov r8,&OP2L
mov r9,&OP2H
add &SUMEXT,r12
mov r8,&OP2L
mov r9,&OP2H
/* COLUMN_END */
mov &RES0,2*6(r14)
add @r13,r12
mov &RES1,2*(6+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov 2*8(r15),&OP2L
mov 2*9(r15),&OP2H
add &SUMEXT,r12
mov 2*8(r15),&OP2L
mov 2*9(r15),&OP2H
/* STEP_2MORE */
mov r6,&MAC32L
mov r7,&MAC32H
add @r13,r12
mov r10,&OP2L
mov r11,&OP2H
add &SUMEXT,r12
mov r10,&OP2L
mov r11,&OP2H
/* SELF_STEP */
mov r8,&MAC32L
mov r9,&MAC32H
add @r13,r12
mov r8,&OP2L
mov r9,&OP2H
/* COLUMN_END */
mov &RES0,2*8(r14)
add @r13,r12
mov &RES1,2*(8+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
mov 2*8(r15),r4
mov 2*(8+1)(r15),r5
/* STEP_1 */
mov r6,&MAC32L
mov r7,&MAC32H
mov r4,&OP2L
mov r5,&OP2H
add &SUMEXT,r12
mov r4,&OP2L
mov r5,&OP2H
/* STEP_2MORE */
mov r8,&MAC32L
mov r9,&MAC32H
add @r13,r12
mov r10,&OP2L
mov r11,&OP2H
add &SUMEXT,r12
mov r10,&OP2L
mov r11,&OP2H
/* COLUMN_END */
mov &RES0,2*10(r14)
add @r13,r12
mov &RES1,2*(10+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r8,&MAC32L
mov r9,&MAC32H
mov r4,&OP2L
mov r5,&OP2H
add &SUMEXT,r12
mov r4,&OP2L
mov r5,&OP2H
/* SELF_STEP */
mov r10,&MAC32L
mov r11,&MAC32H
add @r13,r12
mov r10,&OP2L
mov r11,&OP2H
/* COLUMN_END */
mov &RES0,2*12(r14)
add @r13,r12
mov &RES1,2*(12+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r10,&MAC32L
mov r11,&MAC32H
mov r4,&OP2L
mov r5,&OP2H
add &SUMEXT,r12
mov r4,&OP2L
mov r5,&OP2H
/* COLUMN_END */
mov &RES0,2*14(r14)
add @r13,r12
mov &RES1,2*(14+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* SELF_STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov r4,&OP2L
mov r5,&OP2H
/* COLUMN_END */
mov &RES0,2*16(r14)
add @r13,r12
mov &RES1,2*(16+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* END */
mov &RES0,2*18(r14)
mov &RES1,2*(18+1)(r14)
pop r2
eint

170
samples/Assembly/lib.inc Normal file
View File

@@ -0,0 +1,170 @@
; ------------------------------------------------------------------------
; 显示 AL 中的数字
; ------------------------------------------------------------------------
DispAL:
push ecx
push edx
push edi
mov edi, [dwDispPos]
mov ah, 0Fh ; 0000b: 黑底 1111b: 白字
mov dl, al
shr al, 4
mov ecx, 2
.begin:
and al, 01111b
cmp al, 9
ja .1
add al, '0'
jmp .2
.1:
sub al, 0Ah
add al, 'A'
.2:
mov [gs:edi], ax
add edi, 2
mov al, dl
loop .begin
;add edi, 2
mov [dwDispPos], edi
pop edi
pop edx
pop ecx
ret
; DispAL 结束-------------------------------------------------------------
; ------------------------------------------------------------------------
; 显示一个整形数
; ------------------------------------------------------------------------
DispInt:
mov eax, [esp + 4]
shr eax, 24
call DispAL
mov eax, [esp + 4]
shr eax, 16
call DispAL
mov eax, [esp + 4]
shr eax, 8
call DispAL
mov eax, [esp + 4]
call DispAL
mov ah, 07h ; 0000b: 黑底 0111b: 灰字
mov al, 'h'
push edi
mov edi, [dwDispPos]
mov [gs:edi], ax
add edi, 4
mov [dwDispPos], edi
pop edi
ret
; DispInt 结束------------------------------------------------------------
; ------------------------------------------------------------------------
; 显示一个字符串
; ------------------------------------------------------------------------
DispStr:
push ebp
mov ebp, esp
push ebx
push esi
push edi
mov esi, [ebp + 8] ; pszInfo
mov edi, [dwDispPos]
mov ah, 0Fh
.1:
lodsb
test al, al
jz .2
cmp al, 0Ah ; 是回车吗?
jnz .3
push eax
mov eax, edi
mov bl, 160
div bl
and eax, 0FFh
inc eax
mov bl, 160
mul bl
mov edi, eax
pop eax
jmp .1
.3:
mov [gs:edi], ax
add edi, 2
jmp .1
.2:
mov [dwDispPos], edi
pop edi
pop esi
pop ebx
pop ebp
ret
; DispStr 结束------------------------------------------------------------
; ------------------------------------------------------------------------
; 换行
; ------------------------------------------------------------------------
DispReturn:
push szReturn
call DispStr ;printf("\n");
add esp, 4
ret
; DispReturn 结束---------------------------------------------------------
; ------------------------------------------------------------------------
; 内存拷贝,仿 memcpy
; ------------------------------------------------------------------------
; void* MemCpy(void* es:pDest, void* ds:pSrc, int iSize);
; ------------------------------------------------------------------------
MemCpy:
push ebp
mov ebp, esp
push esi
push edi
push ecx
mov edi, [ebp + 8] ; Destination
mov esi, [ebp + 12] ; Source
mov ecx, [ebp + 16] ; Counter
.1:
cmp ecx, 0 ; 判断计数器
jz .2 ; 计数器为零时跳出
mov al, [ds:esi] ;
inc esi ;
; 逐字节移动
mov byte [es:edi], al ;
inc edi ;
dec ecx ; 计数器减一
jmp .1 ; 循环
.2:
mov eax, [ebp + 8] ; 返回值
pop ecx
pop edi
pop esi
mov esp, ebp
pop ebp
ret ; 函数结束,返回
; MemCpy 结束-------------------------------------------------------------

321
samples/Assembly/macros.inc Normal file
View File

@@ -0,0 +1,321 @@
BLARGG_MACROS_INCLUDED = 1
; Allows extra error checking with modified version
; of ca65. Otherwise acts like a constant of 0.
ADDR = 0
; Switches to Segment and places Line there.
; Line can be an .align directive, .res, .byte, etc.
; Examples:
; seg_data BSS, .align 256
; seg_data RODATA, {message: .byte "Test",0}
.macro seg_data Segment, Line
.pushseg
.segment .string(Segment)
Line
.popseg
.endmacro
; Reserves Size bytes in Segment for Name.
; If Size is omitted, reserves one byte.
.macro seg_res Segment, Name, Size
.ifblank Size
seg_data Segment, Name: .res 1
.else
seg_data Segment, Name: .res Size
.endif
.endmacro
; Shortcuts for zeropage, bss, and stack
.define zp_res seg_res ZEROPAGE,
.define nv_res seg_res NVRAM,
.define bss_res seg_res BSS,
.define sp_res seg_res STACK,
.define zp_byte zp_res
; Copies byte from Src to Addr. If Src begins with #,
; it sets Addr to the immediate value.
; Out: A = byte copied
; Preserved: X, Y
.macro mov Addr, Src
lda Src
sta Addr
.endmacro
; Copies word from Src to Addr. If Src begins with #,
; it sets Addr the immediate value.
; Out: A = high byte of word
; Preserved: X, Y
.macro movw Addr, Src
.if .match( .left( 1, {Src} ), # )
lda #<(.right( .tcount( {Src} )-1, {Src} ))
sta Addr
lda #>(.right( .tcount( {Src} )-1, {Src} ))
sta 1+(Addr)
.else
lda Src
sta Addr
lda 1+(Src)
sta 1+(Addr)
.endif
.endmacro
; Increments 16-bit value at Addr.
; Out: EQ/NE based on resulting 16-bit value
; Preserved: A, X, Y
.macro incw Addr
.local @Skip
inc Addr
bne @Skip
inc 1+(Addr)
@Skip:
.endmacro
; Adds Src to word at Addr.
; Out: A = high byte of result, carry set appropriately
; Preserved: X, Y
.macro addw Addr, Src
.if .match( .left( 1, {Src} ), # )
addw_ Addr,(.right( .tcount( {Src} )-1, {Src} ))
.else
lda Addr
clc
adc Src
sta Addr
lda 1+(Addr)
adc 1+(Src)
sta 1+(Addr)
.endif
.endmacro
.macro addw_ Addr, Imm
lda Addr
clc
adc #<Imm
sta Addr
;.if (Imm >> 8) <> 0
lda 1+(Addr)
adc #>Imm
sta 1+(Addr)
;.else
; .local @Skip
; bcc @Skip
; inc 1+(Addr)
;@Skip:
;.endif
.endmacro
; Splits list of words into tables of low and high bytes
; Example: split_words foo, {$1234, $5678}
; expands to:
; foo_l: $34, $78
; foo_h: $12, $56
; foo_count = 2
.macro split_words Label, Words
.ident (.concat (.string(Label), "_l")): .lobytes Words
.ident (.concat (.string(Label), "_h")): .hibytes Words
.ident (.concat (.string(Label), "_count")) = * - .ident (.concat (.string(Label), "_h"))
.endmacro
.macro SELECT Bool, True, False, Extra
.ifndef Bool
False Extra
.elseif Bool <> 0
True Extra
.else
False Extra
.endif
.endmacro
.macro DEFAULT Name, Value
.ifndef Name
Name = Value
.endif
.endmacro
.ifp02
; 6502 doesn't define these alternate names
.define blt bcc
.define bge bcs
.endif
.define jlt jcc
.define jge jcs
; Jxx Target = Bxx Target, except it can go farther than
; 128 bytes. Implemented via branch around a JMP.
; Don't use ca65's longbranch, because they fail for @labels
;.macpack longbranch
.macro jeq Target
bne *+5
jmp Target
.endmacro
.macro jne Target
beq *+5
jmp Target
.endmacro
.macro jmi Target
bpl *+5
jmp Target
.endmacro
.macro jpl Target
bmi *+5
jmp Target
.endmacro
.macro jcs Target
bcc *+5
jmp Target
.endmacro
.macro jcc Target
bcs *+5
jmp Target
.endmacro
.macro jvs Target
bvc *+5
jmp Target
.endmacro
.macro jvc Target
bvs *+5
jmp Target
.endmacro
; Passes constant data to routine in addr
; Preserved: A, X, Y
.macro jsr_with_addr routine,data
.local Addr
pha
lda #<Addr
sta addr
lda #>Addr
sta addr+1
pla
jsr routine
seg_data RODATA,{Addr: data}
.endmacro
; Calls routine multiple times, with A having the
; value 'start' the first time, 'start+step' the
; second time, up to 'end' for the last time.
.macro for_loop routine,start,end,step
.local @for_loop
lda #start
@for_loop:
pha
jsr routine
pla
clc
adc #step
cmp #<((end)+(step))
bne @for_loop
.endmacro
; Calls routine n times. The value of A in the routine
; counts from 0 to n-1.
.macro loop_n_times routine,n
for_loop routine,0,n-1,+1
.endmacro
; Same as for_loop, except uses 16-bit value in YX.
; -256 <= step <= 255
.macro for_loop16 routine,start,end,step
.if (step) < -256 || (step) > 255
.error "Step must be within -256 to 255"
.endif
.local @for_loop_skip
.local @for_loop
ldy #>(start)
lda #<(start)
@for_loop:
tax
pha
tya
pha
jsr routine
pla
tay
pla
clc
adc #step
.if (step) > 0
bcc @for_loop_skip
iny
.else
bcs @for_loop_skip
dey
.endif
@for_loop_skip:
cmp #<((end)+(step))
bne @for_loop
cpy #>((end)+(step))
bne @for_loop
.endmacro
; Stores byte at addr
; Preserved: X, Y
.macro setb addr, byte
lda #byte
sta addr
.endmacro
; Stores word at addr
; Preserved: X, Y
.macro setw addr, word
lda #<(word)
sta addr
lda #>(word)
sta addr+1
.endmacro
; Loads XY with 16-bit immediate or value at address
.macro ldxy Arg
.if .match( .left( 1, {Arg} ), # )
ldy #<(.right( .tcount( {Arg} )-1, {Arg} ))
ldx #>(.right( .tcount( {Arg} )-1, {Arg} ))
.else
ldy (Arg)
ldx (Arg)+1
.endif
.endmacro
; Increments XY as 16-bit register, in CONSTANT time.
; Z flag set based on entire result.
; Preserved: A
; Time: 7 clocks
.macro inxy
iny ; 2
beq *+4 ; 3
; -1
bne *+3 ; 3
; -1
inx ; 2
.endmacro
; Negates A and adds it to operand
.macro subaf Operand
eor #$FF
sec
adc Operand
.endmacro
; Initializes CPU registers to reasonable values
; Preserved: A, Y
.macro init_cpu_regs
sei
cld ; unnecessary on NES, but might help on clone
ldx #$FF
txs
.ifndef BUILD_NSF
inx
stx PPUCTRL
.endif
.endmacro

195
samples/Brainfuck/factor.b Normal file
View File

@@ -0,0 +1,195 @@
* factor an arbitrarily large positive integer
*
* Copyright (C) 1999 by Brian Raiter
* under the GNU General Public License
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-
*
* read in the number
*
<<<<<<<<<+
[-[>>>>>>>>>>][-]<<<<<<<<<<[[->>>>>>>>>>+<<<<<<<<<<]<<<<<<<<<<]
>>>>>>>>>>,----------]
>>>>>>>>>>[------------------------------------->>>>>>>>>->]
<[+>[>>>>>>>>>+>]<-<<<<<<<<<<]-
*
* display the number and initialize the loop variable to two
*
[>++++++++++++++++++++++++++++++++++++++++++++++++.
------------------------------------------------<<<<<<<<<<<]
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.
--------------------------.[-]
>>>>>>>>>>>>++<<<<+
*
* the main loop
*
[ [-]>>
*
* make copies of the number and the loop variable
*
[>>>>[-]>[-]>[-]>[-]
>[-]>[-]
<<<<<<<[->>>+>+<<<<]>>>>>>>>]
<<<<<<<<<<[>>>>>>[-<<<<+>>>>]<<<<<<<<<<<<<<<<]>>>>>>>>>>
[>[->>>+>>+<<<<<]>>>>>>>>>]
<<<<<<<<<<[>>>>>>[-<<<<<+>>>>>]<<<<<<<<<<<<<<<<]>>>>>>>>>>
*
* divide the number by the loop variable
*
[>>>[-]>>>[-]>[-]>>>] initialize
<<<<<<<<<<[<<<<<<<<<<]
>>>>>>>>>[-]>>>>>>>+<<<<<<<<[+]+
[ ->> double divisor until above dividend
[>>>>>>[->++<]>>>>]<<<<<<<<<<
[>>>>>>>>[-]>[-]
<<<<[->>>++<<<]<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<
[->--------->>>>>>>>>+<<<<<<<<<<[->+<]]]]]]]]]]]>>]
<<<<<<<<<<[>>>>>>>>>[-<+<<<+>>>>]<<<<<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>
[-<--------->>>>>>>>>>>+<<<<<<<<<<[-<+>]]]]]]]]]]]>>>]
<<<<<<<<<<
[>>>>[->>>+>>+<<<<<]<<<<<<<<<<<<<<]
>>>>>>>>>>[>>>>>>>[-<<<+>>>]>>>]<<<<<<<<<<
[>>>>>>>>[->-<]>
[<<<<<<<<<[<[-]>>>>>>>>>>[-<<<<<<<<<<+>>>>>>>>>>]<<<<<<<<<<<<<<<<<<<]
>>>>>>>>>>>>>>>>>>>]
<<<<<<<<<<<<<<<<<<<]
>>>>>>>>>[+[+[+[+[+[+[+[+[+[+[[-]<+>]]]]]]]]]]]<
]
>>>>>>>>
[ subtract divisor from dividend
<<<<<<
[>>>>>>>>[-]>[-]<<<<<[->>>+>+<<<<]>>>>>>]<<<<<<<<<<
[>>>>>>>>[-<<<<+>>>>]<<<[->>>+>+<<<<]<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>>[-<<<<+>>>>]>]<<<<<<<<<<
[>>>>>>>>[-<->]<<<<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<
[++++++++++[+>-<]>>>>>>>>>>-<<<<<<<<<<]]]]]]]]]]]>>>]
>>>>>>>+
[ if difference is nonnegative then
[-]<<<<<<<<<<<<<<<<< replace dividend and increment quotient
[>>>>[-]>>>>[-<<<<+>>>>]<<[->>+<<]<<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>[->+<<<+>>]>>]<<<<<<<<<<
[>>>[->>>>>>+<<<<<<]<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>>[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
[-<<<<<<+>>>>>>[-<<<<<<--------->>>>>>>>>>>>>>>>+<<<<<<<<<<
[-<<<<<<+>>>>>>]]]]]]]]]]]>]
>>>>>>>
] halve divisor and loop until zero
<<<<<<<<<<<<<<<<<[<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>[-]<<[->+<]<[->>>+<<<]>>>>>]<<<<<<<<<<
[+>>>>>>>[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
[-<<<<<<<+>>>>>>>]]]]]]]]]<<<<<<<
[->>>>>>>+<<<<<<<]-<<<<<<<<<<]
>>>>>>>
[-<<<<<<<<<<<+>>>>>>>>>>>]
>>>[>>>>>>>[-<<<<<<<<<<<+++++>>>>>>>>>>>]>>>]<<<<<<<<<<
[+>>>>>>>>[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
[-<<<<<<<<+>>>>>>>>]]]]]]]]]<<<<<<<<
[->>>>>>>>+<<<<<<<<]-<<<<<<<<<<]
>>>>>>>>[-<<<<<<<<<<<<<+>>>>>>>>>>>>>]>>
[>>>>>>>>[-<<<<<<<<<<<<<+++++>>>>>>>>>>>>>]>>]<<<<<<<<<<
[<<<<<<<<<<]>>>>>>>>>>
>>>>>>
]
<<<<<<
*
* make copies of the loop variable and the quotient
*
[>>>[->>>>+>+<<<<<]>>>>>>>]
<<<<<<<<<<
[>>>>>>>[-<<<<+>>>>]<<<<<[->>>>>+>>+<<<<<<<]<<<<<<<<<<<<]
>>>>>>>>>>[>>>>>>>[-<<<<<+>>>>>]>>>]<<<<<<<<<<
*
* break out of the loop if the quotient is larger than the loop variable
*
[>>>>>>>>>[-<->]<
[<<<<<<<<
[<<[-]>>>>>>>>>>[-<<<<<<<<<<+>>>>>>>>>>]<<<<<<<<<<<<<<<<<<]
>>>>>>>>>>>>>>>>>>]<<<<<<<<<<<<<<<<<<]
>>>>>>>>[>-<[+[+[+[+[+[+[+[+[+[[-]>+<]]]]]]]]]]]>+
[ [-]
*
* partially increment the loop variable
*
<[-]+>>>>+>>>>>>>>[>>>>>>>>>>]<<<<<<<<<<
*
* examine the remainder for nonzero digits
*
[<<<<<<[<<<<[<<<<<<<<<<]>>>>+<<<<<<<<<<]<<<<]
>>>>>>>>>>>>>>>>>>>>[>>>>>>>>>>]<<<<<<<<<<[<<<<<<<<<<]
>>>>-
[ [+]
*
* decrement the loop variable and replace the number with the quotient
*
>>>>>>>>-<<[>[-]>>[-<<+>>]>>>>>>>]<<<<<<<<<<
*
* display the loop variable
*
[+>>[>>>>>>>>+>>]<<-<<<<<<<<<<]-
[>>++++++++++++++++++++++++++++++++++++++++++++++++.
------------------------------------------------<<<<<<<<<<<<]
++++++++++++++++++++++++++++++++.[-]>>>>
]
*
* normalize the loop variable
*
>>>>>>
[>>[->>>>>+<<<<<[->>>>>+<<<<<
[->>>>>+<<<<<[->>>>>+<<<<<
[->>>>>+<<<<<[->>>>>+<<<<<
[->>>>>+<<<<<[->>>>>+<<<<<
[->>>>>+<<<<<[->>>>>--------->>>>>+<<<<<<<<<<
[->>>>>+<<<<<]]]]]]]]]]]>>>>>>>>]
<<<<<<<<<<[>>>>>>>[-<<<<<+>>>>>]<<<<<<<<<<<<<<<<<]
>>>>>>>>>
]<
]>>
*
* display the number and end
*
[>>>>>>>>>>]<<<<<<<<<<[+>[>>>>>>>>>+>]<-<<<<<<<<<<]-
[>++++++++++++++++++++++++++++++++++++++++++++++++.<<<<<<<<<<<]
++++++++++.

View File

@@ -0,0 +1,13 @@
# Calculate and output all fibonacci numbers under 100
+++++++++++
>+>>>>++++++++++++++++++++++++++++++++++++++++++++
>++++++++++++++++++++++++++++++++<<<<<<[>[>>>>>>+>
+<<<<<<<-]>>>>>>>[<<<<<<<+>>>>>>>-]<[>++++++++++[-
<-[>>+>+<<<-]>>>[<<<+>>>-]+<[>[-]<[-]]>[<<[>>>+<<<
-]>>[-]]<<]>>>[>>+>+<<<-]>>>[<<<+>>>-]+<[>[-]<[-]]
>[<<+>>[-]]<<<<<<<]>>>>>[+++++++++++++++++++++++++
+++++++++++++++++++++++.[-]]++++++++++<[->-<]>++++
++++++++++++++++++++++++++++++++++++++++++++.[-]<<
<<<<<<<<<<[>>>+>+<<<<-]>>>>[<<<<+>>>>-]<-[>>.>.<<<
[-]]<<[>>+>+<<<-]>>>[<<<+>>>-]<<[<+>-]>[<+>-]<<<-]

View File

@@ -0,0 +1,4 @@
// More complex version of hello world
>++++++++[<+++++++++>-]<.>>+>+>++>[-]+<[>[->+<<++++>]<<]>.+++++++..+++.>
>+++++++.<<<[[-]<[-]>]<+++++++++++++++.>>.+++.------.--------.>>+.>++++.

View File

@@ -0,0 +1,3 @@
// Hello World
++++++++[>++++[>++>+++>+++>+<<<<-]>+>+>->>+[<]<-]>>.>---.+++++++..+++.>>.<-.<.+++.------.--------.>>+.>++.

View File

@@ -0,0 +1,30 @@
# ROT13 cipher
-,+[ Read first character and start outer character reading loop
-[ Skip forward if character is 0
>>++++[>++++++++<-] Set up divisor (32) for division loop
(MEMORY LAYOUT: dividend copy remainder divisor quotient zero zero)
<+<-[ Set up dividend (x minus 1) and enter division loop
>+>+>-[>>>] Increase copy and remainder / reduce divisor / Normal case: skip forward
<[[>+<-]>>+>] Special case: move remainder back to divisor and increase quotient
<<<<<- Decrement dividend
] End division loop
]>>>[-]+ End skip loop; zero former divisor and reuse space for a flag
>--[-[<->+++[-]]]<[ Zero that flag unless quotient was 2 or 3; zero quotient; check flag
++++++++++++<[ If flag then set up divisor (13) for second division loop
(MEMORY LAYOUT: zero copy dividend divisor remainder quotient zero zero)
>-[>+>>] Reduce divisor; Normal case: increase remainder
>[+[<+>-]>+>>] Special case: increase remainder / move it back to divisor / increase quotient
<<<<<- Decrease dividend
] End division loop
>>[<+>-] Add remainder back to divisor to get a useful 13
>[ Skip forward if quotient was 0
-[ Decrement quotient and skip forward if quotient was 1
-<<[-]>> Zero quotient and divisor if quotient was 2
]<<[<<->>-]>> Zero divisor and subtract 13 from copy if quotient was 1
]<<[<<+>>-] Zero divisor and add 13 to copy if quotient was 0
] End outer skip loop (jump to here if ((character minus 1)/32) was not 2 or 3)
<[-] Clear remainder from first division if second division was skipped
<.[-] Output ROT13ed character from copy and clear it
<-,+ Read next character
] End character reading loop

View File

@@ -0,0 +1,57 @@
//===- ClasspathVMSystem/Properties.cpp -----------------------------------===//
//===--------------------- GNU classpath gnu/classpath/VMSystemProperties -===//
//
// The VMKit project
//
// This file is distributed under the University of Illinois Open Source
// License. See LICENSE.TXT for details.
//
//===----------------------------------------------------------------------===//
#include <sys/utsname.h>
#include "types.h"
#include "Classpath.h"
#include "JavaArray.h"
#include "JavaClass.h"
#include "JavaObject.h"
#include "JavaThread.h"
#include "JavaUpcalls.h"
#include "Jnjvm.h"
#include "SetProperties.inc"
using namespace j3;
extern "C" {
JNIEXPORT void JNICALL Java_gnu_classpath_VMSystemProperties_preInit(
#ifdef NATIVE_JNI
JNIEnv *env,
jclass clazz,
#endif
JavaObject* prop) {
llvm_gcroot(prop, 0);
BEGIN_NATIVE_EXCEPTION(0)
setProperties(prop);
END_NATIVE_EXCEPTION
}
extern "C" void Java_gnu_classpath_VMSystemProperties_postInit__Ljava_util_Properties_2(JavaObject* prop) {
llvm_gcroot(prop, 0);
BEGIN_NATIVE_EXCEPTION(0)
setCommandLineProperties(prop);
END_NATIVE_EXCEPTION
}
}

2764
samples/C++/initClasses.inc Normal file

File diff suppressed because it is too large Load Diff

34
samples/C++/instances.inc Normal file
View File

@@ -0,0 +1,34 @@
#include "QPBO.h"
#ifdef _MSC_VER
#pragma warning(disable: 4661)
#endif
// Instantiations
template class QPBO<int>;
template class QPBO<float>;
template class QPBO<double>;
template <>
inline void QPBO<int>::get_type_information(char*& type_name, char*& type_format)
{
type_name = "int";
type_format = "d";
}
template <>
inline void QPBO<float>::get_type_information(char*& type_name, char*& type_format)
{
type_name = "float";
type_format = "f";
}
template <>
inline void QPBO<double>::get_type_information(char*& type_name, char*& type_format)
{
type_name = "double";
type_format = "Lf";
}

2310
samples/C/filenames/script Executable file

File diff suppressed because it is too large Load Diff

166
samples/C/pqiv.h Normal file
View File

@@ -0,0 +1,166 @@
/**
* pqiv
*
* Copyright (c) 2013-2014, Phillip Berndt
*
* This program is free software: you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation, either version 3 of the License, or
* (at your option) any later version.
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
* You should have received a copy of the GNU General Public License
* along with this program. If not, see <http://www.gnu.org/licenses/>.
*
*/
// This file contains the definition of files, image types and
// the plugin infrastructure. It should be included in file type
// handlers.
#ifndef _PQIV_H_INCLUDED
#define _PQIV_H_INCLUDED
#include <glib.h>
#include <gtk/gtk.h>
#include <gio/gio.h>
#include "lib/bostree.h"
#ifndef PQIV_VERSION
#define PQIV_VERSION "2.3"
#endif
#define FILE_FLAGS_ANIMATION (guint)(1)
#define FILE_FLAGS_MEMORY_IMAGE (guint)(1<<1)
// The structure for images {{{
typedef struct file_type_handler_struct_t file_type_handler_t;
typedef struct {
// File type
const file_type_handler_t *file_type;
// Special flags
// FILE_FLAGS_ANIMATION -> Animation functions are invoked
// Set by file type handlers
// FILE_FLAGS_MEMORY_IMAGE -> File lives in memory
guint file_flags;
// The file name to display and to sort by
gchar *display_name;
// The URI or file name of the file
gchar *file_name;
// If the file is a memory image, the actual image data
GBytes *file_data;
// The file monitor structure is used for inotify-watching of
// the files
GFileMonitor *file_monitor;
// This flag stores whether this image is currently loaded
// and valid. i.e. if it is set, you can assume that
// private_data contains a representation of the image;
// if not, you can NOT assume that it does not.
gboolean is_loaded;
// Cached image size
guint width;
guint height;
// File-type specific data, allocated and freed by the file type handlers
void *private;
} file_t;
// }}}
// Definition of the built-in file types {{{
// If you want to implement your own file type, you'll have to implement the
// following functions and a non-static initialization function named
// file_type_NAME_initializer that fills a file_type_handler_t with pointers to
// the functions. Store the file in backends/NAME.c and adjust the Makefile to
// add the required libraries if your backend is listed in the $(BACKENDS)
// variable.
typedef enum { PARAMETER, RECURSION, INOTIFY, BROWSE_ORIGINAL_PARAMETER, FILTER_OUTPUT } load_images_state_t;
// Allocation function: Allocate the ->private structure within a file and add the
// image(s) to the list of available images via load_images_handle_parameter_add_file()
// If an image is not to be loaded for any reason, the file structure should be
// deallocated using file_free()
// Returns a pointer to the first added image
// Optional, you can also set the pointer to this function to NULL.
typedef BOSNode *(*file_type_alloc_fn_t)(load_images_state_t state, file_t *file);
// Deallocation, if a file is removed from the images list. Free the ->private structure.
// Only called if ->private is non-NULL.
typedef void (*file_type_free_fn_t)(file_t *file);
// Actually load a file into memory
typedef void (*file_type_load_fn_t)(file_t *file, GInputStream *data, GError **error_pointer);
// Unload a file
typedef void (*file_type_unload_fn_t)(file_t *file);
// Animation support: Initialize memory for animations, return ms until first frame
// Optional, you can also set the pointer to this function to NULL.
typedef double (*file_type_animation_initialize_fn_t)(file_t *file);
// Animation support: Advance to the next frame, return ms until next frame
// Optional, you can also set the pointer to this function to NULL.
typedef double (*file_type_animation_next_frame_fn_t)(file_t *file);
// Draw the current view to a cairo context
typedef void (*file_type_draw_fn_t)(file_t *file, cairo_t *cr);
struct file_type_handler_struct_t {
// All files will be filtered with this filter. If it lets it pass,
// a handler is assigned to a file. If none do, the file is
// discarded if it was found during directory traversal or
// loaded using the first image backend if it was an explicit
// parameter.
GtkFileFilter *file_types_handled;
// Pointers to the functions defined above
file_type_alloc_fn_t alloc_fn;
file_type_free_fn_t free_fn;
file_type_load_fn_t load_fn;
file_type_unload_fn_t unload_fn;
file_type_animation_initialize_fn_t animation_initialize_fn;
file_type_animation_next_frame_fn_t animation_next_frame_fn;
file_type_draw_fn_t draw_fn;
};
// Initialization function: Tell pqiv about a backend
typedef void (*file_type_initializer_fn_t)(file_type_handler_t *info);
// pqiv symbols available to plugins {{{
// Global cancellable that should be used for every i/o operation
extern GCancellable *image_loader_cancellable;
// Current scale level. For backends that don't support cairo natively.
extern gdouble current_scale_level;
// Load a file from disc/memory/network
GInputStream *image_loader_stream_file(file_t *file, GError **error_pointer);
// Add a file to the list of loaded files
// Should be called at least once in a file_type_alloc_fn_t, with the state being
// forwarded unaltered.
BOSNode *load_images_handle_parameter_add_file(load_images_state_t state, file_t *file);
// Load all data from an input stream into memory, conveinience function
GBytes *g_input_stream_read_completely(GInputStream *input_stream, GCancellable *cancellable, GError **error_pointer);
// Free a file
void file_free(file_t *file);
// }}}
// File type handlers, used in the initializer and file type guessing
extern file_type_handler_t file_type_handlers[];
/* }}} */
#endif

View File

@@ -58,6 +58,34 @@ var BA: [BlockSpace] int;
forall ba in BA do forall ba in BA do
ba = here.id; ba = here.id;
//
// The 'hasSingleLocalSubdomain' method on arrays will return true if the
// index set for a locale can be represented by a single domain.
//
if !BA.hasSingleLocalSubdomain() then
halt("For a Block distribution, the index set per locale should be \
represented by a single domain");
//
// If the distribution's subdomains can be represented as single subdomain,
// we can use the 'localSubdomain' method to get the index set for the
// current locale.
//
// Below, we'll use the index set to confirm that the array elements have the
// correct locale id.
//
for L in Locales {
on L {
const indices = BA.localSubdomain();
for i in indices {
if BA[i] != L.id then
halt("Error: incorrect locale id");
}
}
}
// //
// Output the Block-distributed array to visually see how the elements // Output the Block-distributed array to visually see how the elements
// are partitioned across the locales. // are partitioned across the locales.
@@ -104,6 +132,14 @@ writeln("Block Array Index Map");
writeln(BA2); writeln(BA2);
writeln(); writeln();
//
// We can use the 'targetLocales' method available on an array to get the
// locales array used as targets.
//
for (L, ML) in zip(BA2.targetLocales(), MyLocales) do
if L != ML then
halt("Error: BA2.targetLocales() should equal MyLocales");
// //
@@ -126,6 +162,18 @@ writeln("Cyclic Array Index Map");
writeln(CA); writeln(CA);
writeln(); writeln();
//
// The domain returned by 'localSubdomain' need not be a dense block, as is
// the case for the Cyclic Distribution.
//
on Locales[0] {
const indices = CA.localSubdomain();
for i in indices {
if CA[i] != 0 then
halt("Error: Cyclic array values on Locale 0 should be zero");
}
}
// //
// Next, we'll declare a Block-Cyclic distribution. These // Next, we'll declare a Block-Cyclic distribution. These
@@ -146,6 +194,46 @@ writeln("Block-Cyclic Array Index Map");
writeln(BCA); writeln(BCA);
writeln(); writeln();
//
// A locale's index set for a Block-Cyclic distribution cannot be represented
// by a single subdomain.
//
if BCA.hasSingleLocalSubdomain() then
halt("A Block-Cyclic index set cannot be represented by a single subdomain");
//
// If the local index set cannot be represented by a single subdomain,
// we can use the 'localSubdomains' iterator to yield a number of domains
// that represent the whole index set.
//
// Let's write a function that will use 'localSubdomains' to verify the
// correctness of the array values.
//
proc verifyID(Data: []) {
for L in Locales {
on L {
for indices in Data.localSubdomains() {
for i in indices {
if Data[i] != L.id then
halt("Error: incorrect locale id");
}
}
}
}
}
verifyID(BCA);
//
// The 'localSubdomains' iterator is also available on distributions that
// can represent a locale's index set with a single domain. This allows us to
// write more general code that will work for all distributions.
//
// This means that we can call the 'verifyID' function on any array, like the
// 'BA' array from earlier.
//
verifyID(BA);
// //
// The ReplicatedDist distribution is different: each of the // The ReplicatedDist distribution is different: each of the

View File

@@ -292,14 +292,14 @@ proc main() {
LagrangeLeapFrog(); LagrangeLeapFrog();
if debug { if debug {
// deprint("[[ Forces ]]", fx, fy, fz); deprintatomic("[[ Forces ]]", fx, fy, fz);
deprint("[[ Positions ]]", x, y, z); deprint("[[ Positions ]]", x, y, z);
deprint("[[ p, e, q ]]", p, e, q); deprint("[[ p, e, q ]]", p, e, q);
} }
if showProgress then if showProgress then
writeln("time = ", format("%e", time), ", dt=", format("%e", deltatime), writef("time = %er, dt=%er, %s", time, deltatime,
if doTiming then ", elapsed = " + (getCurrentTime()-iterTime) if doTiming then ", elapsed = " + (getCurrentTime()-iterTime) +"\n"
else ""); else "\n");
} }
if (cycle == maxcycles) { if (cycle == maxcycles) {
writeln("Stopped early due to reaching maxnumsteps"); writeln("Stopped early due to reaching maxnumsteps");
@@ -314,12 +314,10 @@ proc main() {
if printCoords { if printCoords {
var outfile = open("coords.out", iomode.cw); var outfile = open("coords.out", iomode.cw);
var writer = outfile.writer(); var writer = outfile.writer();
var fmtstr = if debug then "%1.9e" else "%1.4e"; var fmtstr = if debug then "%1.9re %1.9er %1.9er\n"
for i in Nodes { else "%1.4er %1.4er %1.4er\n";
writer.writeln(format(fmtstr, x[i]), " ", for i in Nodes do
format(fmtstr, y[i]), " ", writer.writef(fmtstr, x[i], y[i], z[i]);
format(fmtstr, z[i]));
}
writer.close(); writer.close();
outfile.close(); outfile.close();
} }
@@ -479,7 +477,7 @@ inline proc localizeNeighborNodes(eli: index(Elems),
y: [] real, ref y_local: 8*real, y: [] real, ref y_local: 8*real,
z: [] real, ref z_local: 8*real) { z: [] real, ref z_local: 8*real) {
for param i in 1..nodesPerElem { for i in 1..nodesPerElem {
const noi = elemToNode[eli][i]; const noi = elemToNode[eli][i];
x_local[i] = x[noi]; x_local[i] = x[noi];
@@ -670,7 +668,7 @@ proc SumElemStressesToNodeForces(b_x: 8*real, b_y: 8*real, b_z: 8*real,
ref fx: 8*real, ref fx: 8*real,
ref fy: 8*real, ref fy: 8*real,
ref fz: 8*real) { ref fz: 8*real) {
for param i in 1..8 { for i in 1..8 {
fx[i] = -(stress_xx * b_x[i]); fx[i] = -(stress_xx * b_x[i]);
fy[i] = -(stress_yy * b_y[i]); fy[i] = -(stress_yy * b_y[i]);
fz[i] = -(stress_zz * b_z[i]); fz[i] = -(stress_zz * b_z[i]);
@@ -725,17 +723,17 @@ inline proc CalcElemFBHourglassForce(xd: 8*real, yd: 8*real, zd: 8*real,
var hx, hy, hz: 4*real; var hx, hy, hz: 4*real;
// reduction // reduction
for param i in 1..4 { for i in 1..4 {
for param j in 1..8 { for j in 1..8 {
hx[i] += hourgam[j][i] * xd[j]; hx[i] += hourgam[j][i] * xd[j];
hy[i] += hourgam[j][i] * yd[j]; hy[i] += hourgam[j][i] * yd[j];
hz[i] += hourgam[j][i] * zd[j]; hz[i] += hourgam[j][i] * zd[j];
} }
} }
for param i in 1..8 { for i in 1..8 {
var shx, shy, shz: real; var shx, shy, shz: real;
for param j in 1..4 { for j in 1..4 {
shx += hourgam[i][j] * hx[j]; shx += hourgam[i][j] * hx[j];
shy += hourgam[i][j] * hy[j]; shy += hourgam[i][j] * hy[j];
shz += hourgam[i][j] * hz[j]; shz += hourgam[i][j] * hz[j];
@@ -1088,16 +1086,16 @@ proc CalcFBHourglassForceForElems(determ, x8n, y8n, z8n, dvdx, dvdy, dvdz) {
/* TODO: Can we enable this local block? */ /* TODO: Can we enable this local block? */
// local { // local {
for param i in 1..4 { for i in 1..4 {
var hourmodx, hourmody, hourmodz: real; var hourmodx, hourmody, hourmodz: real;
// reduction // reduction
for param j in 1..8 { for j in 1..8 {
hourmodx += x8n[eli][j] * gammaCoef[i][j]; hourmodx += x8n[eli][j] * gammaCoef[i][j];
hourmody += y8n[eli][j] * gammaCoef[i][j]; hourmody += y8n[eli][j] * gammaCoef[i][j];
hourmodz += z8n[eli][j] * gammaCoef[i][j]; hourmodz += z8n[eli][j] * gammaCoef[i][j];
} }
for param j in 1..8 { for j in 1..8 {
hourgam[j][i] = gammaCoef[i][j] - volinv * hourgam[j][i] = gammaCoef[i][j] - volinv *
(dvdx[eli][j] * hourmodx + (dvdx[eli][j] * hourmodx +
dvdy[eli][j] * hourmody + dvdy[eli][j] * hourmody +
@@ -1221,7 +1219,7 @@ proc CalcKinematicsForElems(dxx, dyy, dzz, const dt: real) {
arealg[k] = CalcElemCharacteristicLength(x_local, y_local, z_local, arealg[k] = CalcElemCharacteristicLength(x_local, y_local, z_local,
volume); volume);
for param i in 1..8 { for i in 1..8 {
x_local[i] -= dt2 * xd_local[i]; x_local[i] -= dt2 * xd_local[i];
y_local[i] -= dt2 * yd_local[i]; y_local[i] -= dt2 * yd_local[i];
z_local[i] -= dt2 * zd_local[i]; z_local[i] -= dt2 * zd_local[i];
@@ -1669,7 +1667,7 @@ proc CalcSoundSpeedForElems(vnewc, rho0:real, enewc, pnewc, pbvc, bvc) {
iter elemToNodes(elem) { iter elemToNodes(elem) {
for param i in 1..nodesPerElem do for i in 1..nodesPerElem do
yield elemToNode[elem][i]; yield elemToNode[elem][i];
} }
@@ -1679,14 +1677,19 @@ iter elemToNodesTuple(e) {
} }
proc deprint(title:string, x:[?D] real, y:[D]real, z:[D]real) { proc deprint(title:string, x:[?D] real, y:[D] real, z:[D] real) {
writeln(title); writeln(title);
for i in D { for i in D do
writeln(format("%3d", i), ": ", writef("%3i: %3.4er %3.4er %3.4er\n",
format("%3.4e", x[i]), " ", if use3DRepresentation then idx3DTo1D(i, D.dim(1).size) else i,
format("%3.4e", y[i]), " ", x[i], y[i], z[i]);
format("%3.4e", z[i]));
}
} }
proc deprintatomic(title:string, x:[?D] atomic real, y:[] atomic real, z:[] atomic real) {
writeln(title);
for i in D do
writef("%3i: %3.4er %3.4er %3.4er\n",
if use3DRepresentation then idx3DTo1D(i, D.dim(1).size) else i,
x[i].peek(), y[i].peek(), z[i].peek());
}

View File

@@ -0,0 +1,172 @@
Member()
omit('***$***',_VER_C55)
_ABCDllMode_ EQUATE(0)
_ABCLinkMode_ EQUATE(1)
***$***
Include('Equates.CLW'),ONCE
Include('Keycodes.CLW'),ONCE
Include('Errors.CLW'),ONCE
Map
End ! map
Include('CStringClass.inc'),ONCE
CStringClass.Construct PROCEDURE ! Declare Procedure
CODE
SELF.bufferSize = DEFAULT_CS_BUFFER_SIZE
SELF.CS &= New(CSTRING(SELF.bufferSize))
CStringClass.Destruct PROCEDURE ! Declare Procedure
CODE
Dispose(SELF.cs)
CStringClass.Cat PROCEDURE (STRING pStr) !,*CSTRING,PROC ! Declare Procedure
newLen LONG,AUTO
oldCS &CSTRING
CODE
newLen = Len(pStr)
IF (newLen+SELF.strLength+2) > SELF.newStrSize
! Only grow the internal string if the result of the cat will be larger than the string currently is.
! The reason for the "+2" is because this is used in the string slicing outside this IF. Without this matching +2 there is potential for an out of bounds slice which would be bad!
! Save a temporary copy of the old string so we can us it in the concatination after we have grown it!
oldCS &= New(CSTRING(SELF.strLength+1))
oldCS = SELF.CS
Dispose(SELF.CS)
SELF.newStrSize = newLen + SELF.strLength + 1 + SELF.bufferSize
SELF.CS &= New(CSTRING(SELF.newStrSize))
SELF.CS = oldCS
Dispose(oldCS)
END
! Append the new string directly to the end of the old one.
SELF.CS[SELF.strLength+1 : SELF.strLength+newLen] = pStr
! And terminate the CSTRING manually
SELF.CS[SELF.strLength+newLen+1] = '<0>'
! This is the same as doing "SELF.strLength = Len(SELF.CS)" but the Len() is _really_ slow on large strings. This is much faster!
SELF.strLength += newLen
! This is what it used to be:
! SELF.Str(SELF.Str() & s)
! It is a nice and neat solution but performance, especially on large strings was terrible!
RETURN SELF.Str()
CStringClass.Str PROCEDURE (STRING pStr) !,*CSTRING, PROC ! Declare Procedure
CODE
IF Len(pStr) > SELF.newStrSize
! Only Dispose/New the internal string if the new one requires it.
! This might be slightly innefficient in terms of memory usage when the string gets smaller
! But it is _vasty_ better for performance when the string gets added to a lot.
Dispose(SELF.CS)
SELF.newStrSize = Len(pStr) + 1 + SELF.bufferSize
SELF.CS &= New(CSTRING(SELF.newStrSize))
END
SELF.CS = pStr
SELF.strLength = Len(SELF.CS)
RETURN SELF.CS
CStringClass.Len PROCEDURE !,LONG ! Declare Procedure
CODE
RETURN SELF.strLength
CStringClass.Replace PROCEDURE (STRING pFind, STRING pReplace) !,*CSTRING,PROC ! Declare Procedure
! FindString , ReplaceWith
locate LONG,AUTO
lastLocate LONG
CODE
LOOP
locate = InString(Upper(pFind), Upper(SELF.Str()), 1, lastLocate+1)
IF ~locate
BREAK
END
! So we dont end up having recursive replacement.
lastLocate = locate + Len(pReplace)-1
SELF.Str(Sub(SELF.Str(), 1, locate-1) & |
pReplace & |
Sub(SELF.Str(), locate+Len(pFind), SELF.Len()) |
)
END
RETURN SELF.Str()
CStringClass.Str PROCEDURE () !,*CSTRING ! Declare Procedure 3
CODE
RETURN SELF.CS
!------------------------------------------------------------------------------
CStringClass.Contains PROCEDURE (STRING pFind, BYTE pCaseSensitive=TRUE) !,BYTE ! Declare Procedure
! Returns a value (TRUE) indicating whether the specified String occurs within this string.
! Second parameter defaults to a case sensitive search.
CODE
IF pCaseSensitive = TRUE
IF InString(pFind, SELF.Str(), 1 , 1) > 0
RETURN TRUE
END
ELSE
IF InString(Lower(pFind), SELF.Lower(), 1 , 1) > 0
RETURN TRUE
END
END
RETURN FALSE
CStringClass.Lower PROCEDURE () !,STRING ! Declare Procedure
! Returns a "Lowered" version of the self.cs doesnt change the self.cs
CODE
RETURN Lower(SELF.CS)
CStringClass.SubString PROCEDURE (LONG pPosition, LONG pLength) !,STRING,PROC ! Declare Procedure
CODE
RETURN Sub(SELF.Str(), pPosition, pLength)
CStringClass.ToLower PROCEDURE () !,*CSTRING,PROC ! Declare Procedure
! Converts this string to lowercase and returns the converted string
CODE
RETURN SELF.Str(SELF.Lower())
CStringClass.ToUpper PROCEDURE () !,*CSTRING,PROC ! Declare Procedure
! Converts this string to uppercase and returns the converted string
CODE
RETURN SELF.Str(SELF.Upper())
CStringClass.Trim PROCEDURE () !,*CSTRING,PROC ! Declare Procedure
CODE
SELF.Str(Left(SELF.Str()))
SELF.Str(Clip(SELF.Str()))
RETURN SELF.Str()
CStringClass.Upper PROCEDURE () !,STRING ! Declare Procedure
CODE
RETURN Upper(SELF.Str())
CStringClass.IndexOf PROCEDURE (STRING pLookIn, BYTE pCaseSensitive=TRUE) !,LONG ! Declare Procedure
! Returns the index of the first parameter (pLookIn) is found within the SELF.CS
! zero if it is not found
CODE
IF pCaseSensitive = TRUE
RETURN InString(SELF.Str(), pLookIn, 1 , 1)
ELSE
RETURN InString(SELF.Lower(), Lower(pLookIn), 1 , 1)
END
CStringClass.FoundIn PROCEDURE (STRING pLookIn, BYTE pCaseSensitive=TRUE) !,BYTE ! Declare Procedure
! Returns TRUE if the first parameter (pLookIn) is found within the SELF.CS
! FALSE if it is no
CODE
IF SELF.IndexOf(pLookIn, pCaseSensitive) > 0
RETURN TRUE
ELSE
RETURN FALSE
END
CStringClass.SetBuffer PROCEDURE (LONG pNewBuffer) ! Declare Procedure
CODE
SELF.bufferSize = pNewBuffer
CStringClass.EscapeXml PROCEDURE (<STRING pStr>) !,STRING ! Declare Procedure
CS CStringClass
CODE
IF Omitted(pStr)=FALSE
CS.Str(pStr)
ELSE
! Make a copy so we don't alter the original
CS.Str(SELF.Str())
END
CS.Replace('&', '&amp;')
CS.Replace('<', '&lt;')
CS.Replace('>', '&gt;')
CS.Replace('"', '&quot;')
CS.Replace('''', '&apos;')
RETURN CS.Str()

View File

@@ -0,0 +1,68 @@
Member()
Include('ConsoleSupport.inc'),ONCE
Map
MODULE('32-bit Windows API')
! General functions
GetLastError(),DWORD,PASCAL
! Console functions
GetStdHandle(DWORD),HANDLE,PASCAL,PROC,RAW
WriteConsole(Handle,Long,Dword,long,long),bool,Raw,Pascal,name('WriteConsoleA')
ReadConsole(Handle,Long,Dword,long,long),bool,Raw,Pascal,name('ReadConsoleA')
SetConsoleTitle(Long),Bool,Raw,Pascal,name('SetConsoleTitleA')
GetConsoleTitle(Long,dword),Bool,Raw,Pascal,name('GetConsoleTitleA')
SetConsoleMode(Handle,dWord),BOOL,RAW,PASCAL
GetConsoleMode(Handle,Long),BOOL,RAW,PASCAL
End
End
ConsoleSupport.Construct PROCEDURE
CODE
ConsoleSupport.Destruct PROCEDURE
CODE
ConsoleSupport.Init PROCEDURE () !,BYTE,VIRTUAL
CODE
SELF.OutputHandle = GetStdHandle(STD_OUTPUT_HANDLE)
If SELF.OutputHandle = INVALID_HANDLE_VALUE
Halt(1,'Unable to get output handle (' & GetLastError() & ')')
RETURN INVALID_HANDLE_VALUE
End
SELF.InputHandle = GetStdHandle(STD_INPUT_HANDLE)
if SELF.InputHandle = INVALID_HANDLE_VALUE
Halt(2,'Unable to get console input handle (' & GetLastError() & ')')
RETURN INVALID_HANDLE_VALUE
End
If ~SetConsoleMode(SELF.InputHandle,ENABLE_PROCESSED_INPUT )
Halt(3,'Unable to set console mode (' & GetLastError() & ')')
RETURN INVALID_OTHER
End
RETURN FALSE
ConsoleSupport.WriteLine PROCEDURE (STRING pText) !,BYTE,PROC,VIRTUAL
CODE
SELF.TextBuffer = SELF.Prefix & pText & '<13,10>'
If WriteConsole(SELF.OutputHandle, ADDRESS(SELF.TextBuffer), LEN(SELF.TextBuffer),ADDRESS(SELF.BytesWritten), NULL) = 0
Halt(4,'WriteConsoleError (' & GetLastError() & ')')
RETURN -1
End
RETURN FALSE
Consolesupport.ReadKey PROCEDURE () !,STRING,PROC,VIRTUAL
CODE
SELF.WriteLine('Press any key to continue...')
Clear(SELF.InBuffer)
Loop
IF ReadConsole(SELF.InputHandle,Address(SELF.InBuffer),100,Address(SELF.BytesRead),NULL) = 0 THEN
Halt(5,'Error on read console (' & GetLastError() & ')')
Break
End
Until SELF.BytesRead > 0
RETURN SELF.InBuffer

View File

@@ -0,0 +1,10 @@
PROGRAM
MAP
END
CODE
MESSAGE('Hello World!')
RETURN

12
samples/Clarion/hello.clw Normal file
View File

@@ -0,0 +1,12 @@
MEMBER()
INCLUDE('HelloClass.inc'),ONCE
MAP
END
HelloClass.Construct PROCEDURE
CODE
HelloClass.Destruct PROCEDURE() !,VIRTUAL
CODE
HelloClass.SayHello PROCEDURE
CODE
MESSAGE('Hello World!')

View File

@@ -0,0 +1,15 @@
;; from: https://github.com/boot-clj/boot#configure-task-options
(set-env!
:source-paths #{"src"}
:dependencies '[[me.raynes/conch "0.8.0"]])
(task-options!
pom {:project 'my-project
:version "0.1.0"}
jar {:manifest {"Foo" "bar"}})
(deftask build
"Build my project."
[]
(comp (pom) (jar) (install)))

164
samples/Common Lisp/array.l Normal file
View File

@@ -0,0 +1,164 @@
;;; -*- Mode: Lisp; Package: LISP -*-
;;;
;;; This file is part of xyzzy.
;;;
(provide "array")
(in-package "lisp")
(export '(make-vector make-array vector array-dimensions array-in-bounds-p
upgraded-array-element-type adjust-array))
(defun upgraded-array-element-type (type)
(cond ((or (eq type 't)
(null type))
't)
((member type '(character base-character standard-char
extended-character) :test #'eq)
'character)
(t
(setq type (car (si:canonicalize-type type)))
(cond ((or (eq type 't)
(null type))
't)
((member type '(character base-character standard-char
extended-character) :test #'eq)
'character)
(t 't)))))
(defun check-array-initialize-option (ies-p ics-p displaced-to)
(let ((x 0))
(and ies-p (incf x))
(and ics-p (incf x))
(and displaced-to (incf x))
(when (> x 1)
(error ":initial-element, :initial-contents, :displaced-to"))))
(defun make-vector (length &key
(element-type t)
(initial-element nil ies-p)
(initial-contents nil ics-p)
fill-pointer
adjustable
displaced-to
(displaced-index-offset 0))
(setq element-type (upgraded-array-element-type element-type))
(check-array-initialize-option ies-p ics-p displaced-to)
(let ((vector (si:*make-vector length element-type initial-element adjustable
fill-pointer displaced-to displaced-index-offset)))
(when ics-p
(si:*copy-into-seq vector initial-contents))
vector))
(defun make-array (dimensions &rest rest
&key
(element-type t)
(initial-element nil ies-p)
(initial-contents nil ics-p)
fill-pointer
adjustable
displaced-to
(displaced-index-offset 0))
(cond ((integerp dimensions)
(apply #'make-vector dimensions rest))
((= (length dimensions) 1)
(apply #'make-vector (car dimensions) rest))
(t
(setq element-type (upgraded-array-element-type element-type))
(check-array-initialize-option ies-p ics-p displaced-to)
(when fill-pointer
(error ":fill-pointer"))
(let ((array (si:*make-array dimensions element-type
initial-element adjustable
displaced-to displaced-index-offset)))
(when ics-p
(let ((dims (make-list (array-rank array)
:initial-element 0))
(stack (list initial-contents))
(rank (1- (array-rank array))))
(dolist (x dims)
(push (elt (car stack) 0) stack))
(dotimes (i (array-total-size array))
(setf (row-major-aref array i) (car stack))
(do ((x dims (cdr x))
(j rank (1- j)))
((null x))
(pop stack)
(incf (car x))
(when (< (car x) (array-dimension array j))
(do ((r (- rank j) (1- r)))
((< r 0))
(push (elt (car stack) (nth r dims)) stack))
(return))
(setf (car x) 0)))))
array))))
(defun vector (&rest list)
(make-vector (length list) :element-type t :initial-contents list))
(defun array-dimensions (array)
(do ((i (1- (array-rank array)) (1- i))
(dims '()))
((minusp i) dims)
(push (array-dimension array i) dims)))
(defun array-in-bounds-p (array &rest subscripts)
(let ((r (array-rank array)))
(when (/= r (length subscripts))
(error "subscripts: ~S" subscripts))
(do ((i 0 (1+ i))
(s subscripts (cdr s)))
((= i r) t)
(unless (<= 0 (car s) (1- (array-dimension array i)))
(return nil)))))
(defun adjust-array (old-array
dimensions
&rest rest
&key
(element-type nil ets-p)
initial-element
(initial-contents nil ics-p)
(fill-pointer nil fps-p)
displaced-to
displaced-index-offset)
(when (/= (length dimensions) (array-rank old-array))
(error "?"))
(unless ets-p
(push (array-element-type old-array) rest)
(push :element-type rest))
(when (adjustable-array-p old-array)
(push t rest)
(push :adjustable rest))
(cond (fps-p
(unless (array-has-fill-pointer-p old-array)
(error "?")))
(t
(when (array-has-fill-pointer-p old-array)
(push (fill-pointer old-array) rest)
(push :fill-pointer rest))))
(when (eq old-array displaced-to)
(error "?"))
(let ((new-array (apply #'make-array dimensions rest)))
(or ics-p displaced-to
(copy-array-partially old-array new-array))
(cond ((adjustable-array-p old-array)
(si:*replace-array old-array new-array)
old-array)
(t
new-array))))
(defun copy-array-partially (src dst)
(let* ((dims (mapcar #'min (array-dimensions src) (array-dimensions dst)))
(r (array-rank src))
(s (make-list r :initial-element 0)))
(setq r (1- r))
(dotimes (x (apply #'* dims))
(setf (apply #'aref dst s) (apply #'aref src s))
(do ((i r (1- i)))
((minusp i))
(incf (nth i s))
(when (< (nth i s) (nth i dims))
(return))
(setf (nth i s) 0)))))

1201
samples/Common Lisp/common.l Normal file

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,2 @@
(DEFUN HELLO ()
(PRINT 'HELLO))

318
samples/D/mpq.d Normal file
View File

@@ -0,0 +1,318 @@
/*
* mpq.d -- D programming language module for libmpq
*
* Copyright (c) 2008 Georg Lukas <georg@op-co.de>
*
* This program is free software; you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation; either version 2 of the License, or
* (at your option) any later version.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with this program; if not, write to the Free Software
* Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
*
* This module is written to support Phobos. Patches to allow binding to
* Tango are welcome.
*/
module mpq;
/* the following pragma does not work on DMD/Linux, generates a warning on
* GDC/Linux and has not been tested on Windows. Commented out for now. */
// pragma(lib, "libmpq");
import std.string; // for format() and toStringz()
import std.traits; // for ParameterTypeTuple!()
/* XXX: this assumes that libmpq is compiled with Large File Support on */
alias long off_t;
/* libmpq error return values */
const LIBMPQ_ERROR_OPEN = -1; /* open error on file. */
const LIBMPQ_ERROR_CLOSE = -2; /* close error on file. */
const LIBMPQ_ERROR_SEEK = -3; /* lseek error on file. */
const LIBMPQ_ERROR_READ = -4; /* read error on file. */
const LIBMPQ_ERROR_WRITE = -5; /* write error on file. */
const LIBMPQ_ERROR_MALLOC = -6; /* memory allocation error. */
const LIBMPQ_ERROR_FORMAT = -7; /* format errror. */
const LIBMPQ_ERROR_NOT_INITIALIZED = -8; /* init() wasn't called. */
const LIBMPQ_ERROR_SIZE = -9; /* buffer size is to small. */
const LIBMPQ_ERROR_EXIST = -10; /* file or block does not exist in archive. */
const LIBMPQ_ERROR_DECRYPT = -11; /* we don't know the decryption seed. */
const LIBMPQ_ERROR_UNPACK = -12; /* error on unpacking file. */
/** libmpq internal meta-data for an archive */
extern struct mpq_archive_s;
extern(C) {
/* libmpq__generic information about library. */
char *libmpq__version();
/* libmpq__generic mpq archive information. */
int libmpq__archive_open(mpq_archive_s **mpq_archive, char *mpq_filename, off_t archive_offset);
int libmpq__archive_close(mpq_archive_s *mpq_archive);
int libmpq__archive_packed_size(mpq_archive_s *mpq_archive, off_t *packed_size);
int libmpq__archive_unpacked_size(mpq_archive_s *mpq_archive, off_t *unpacked_size);
int libmpq__archive_offset(mpq_archive_s *mpq_archive, off_t *offset);
int libmpq__archive_version(mpq_archive_s *mpq_archive, uint *version_);
int libmpq__archive_files(mpq_archive_s *mpq_archive, uint *files);
/* libmpq__generic file processing functions. */
int libmpq__file_packed_size(mpq_archive_s *mpq_archive, uint file_number, off_t *packed_size);
int libmpq__file_unpacked_size(mpq_archive_s *mpq_archive, uint file_number, off_t *unpacked_size);
int libmpq__file_offset(mpq_archive_s *mpq_archive, uint file_number, off_t *offset);
int libmpq__file_blocks(mpq_archive_s *mpq_archive, uint file_number, uint *blocks);
int libmpq__file_encrypted(mpq_archive_s *mpq_archive, uint file_number, uint *encrypted);
int libmpq__file_compressed(mpq_archive_s *mpq_archive, uint file_number, uint *compressed);
int libmpq__file_imploded(mpq_archive_s *mpq_archive, uint file_number, uint *imploded);
int libmpq__file_number(mpq_archive_s *mpq_archive, char *filename, uint *number);
int libmpq__file_read(mpq_archive_s *mpq_archive, uint file_number, ubyte *out_buf, off_t out_size, off_t *transferred);
/* libmpq__generic block processing functions. */
int libmpq__block_open_offset(mpq_archive_s *mpq_archive, uint file_number);
int libmpq__block_close_offset(mpq_archive_s *mpq_archive, uint file_number);
int libmpq__block_unpacked_size(mpq_archive_s *mpq_archive, uint file_number, uint block_number, off_t *unpacked_size);
int libmpq__block_read(mpq_archive_s *mpq_archive, uint file_number, uint block_number, ubyte *out_buf, off_t out_size, off_t *transferred);
}
/** exception class for failed libmpq calls */
class MPQException : Exception {
const string[] Errors = [
"unknown error",
"open error on file",
"close error on file",
"lseek error on file",
"read error on file",
"write error on file",
"memory allocation error",
"format errror",
"init() wasn't called",
"buffer size is to small",
"file or block does not exist in archive",
"we don't know the decryption seed",
"error on unpacking file"];
public int errno;
this(char[] fnname = "unknown_function", int errno = 0) {
this.errno = errno;
if (-errno >= Errors.length)
errno = 0;
super(std.string.format("Error in %s(): %s (%d)",
fnname, Errors[-errno], errno));
}
}
/** template to wrap function calls and throw exceptions in case of error
*
* thanks for the idea to while(nan) blog,
* http://while-nan.blogspot.com/2007/06/wrapping-functions-for-fun-and-profit.html
*
* use: MPQ_CHECKERR(libmpq__archive_open)(&m, "foo.mpq", -1);
* returns the retval of archive_open on success;
* throws an MPQException on failure.
*
* @param Fn libmpq__function reference
* @param args libmpq__function parameters
* @return return value of libmpq__function on success
* @throw MPQException on error
*/
int MPQ_CHECKERR(alias Fn)(ParameterTypeTuple!(Fn) args)
{
int result = Fn(args);
if (result < 0) {
/* XXX: relying on non-specified stringof() behaviour */
throw new MPQException((&Fn).stringof[2..$], result);
}
return result;
}
/** mixin alias to wrap library functions into MPQ_CHECKERR.
*
* alias mpq.func_name(...) to MPQ_CHECKERR(libmpq__func_name)(...)
* @param func_name name of the function to be wrapped
*/
template MPQ_FUNC(char[] func_name) {
const char[] MPQ_FUNC = "alias MPQ_CHECKERR!(libmpq__" ~ func_name ~ ") " ~ func_name ~ ";";
}
alias libmpq__version libversion; /* must be direct alias because it returns char*, not error int */
mixin(MPQ_FUNC!("archive_open"));
mixin(MPQ_FUNC!("archive_close"));
mixin(MPQ_FUNC!("archive_packed_size"));
mixin(MPQ_FUNC!("archive_unpacked_size"));
mixin(MPQ_FUNC!("archive_offset"));
mixin(MPQ_FUNC!("archive_version"));
mixin(MPQ_FUNC!("archive_files"));
mixin(MPQ_FUNC!("file_packed_size"));
mixin(MPQ_FUNC!("file_unpacked_size"));
mixin(MPQ_FUNC!("file_offset"));
mixin(MPQ_FUNC!("file_blocks"));
mixin(MPQ_FUNC!("file_encrypted"));
mixin(MPQ_FUNC!("file_compressed"));
mixin(MPQ_FUNC!("file_imploded"));
mixin(MPQ_FUNC!("file_number"));
mixin(MPQ_FUNC!("file_read"));
mixin(MPQ_FUNC!("block_open_offset"));
mixin(MPQ_FUNC!("block_close_offset"));
mixin(MPQ_FUNC!("block_unpacked_size"));
mixin(MPQ_FUNC!("block_read"));
/** getter function named name for returning archive_* single values:
*
* <type> Archive.<name>() { return libmpq__archive_<name>() }
*
* @param type return type for the original function reference
* @param name name of the original function
* @param name2 name for the prototype (defaults to name, used for "version")
* @return getter function mixin
*/
template MPQ_A_GET(char[] type, char[] name, char[] name2 = name) {
const char[] MPQ_A_GET = type ~ " " ~ name2 ~ "() { " ~
type ~ " ret; " ~
"archive_" ~ name ~ "(m, &ret); return ret;" ~
"}";
}
/** wrapper class for an MPQ Archive
*
* syntax: auto a = new mpq.Archive("somefile.mpq");
*/
class Archive {
mpq_archive_s *m;
File listfile;
char[][] listfiledata;
this(char[] archivename, off_t offset = -1) {
archive_open(&m, toStringz(archivename), offset);
}
mixin(MPQ_A_GET!("off_t", "packed_size"));
mixin(MPQ_A_GET!("off_t", "unpacked_size"));
mixin(MPQ_A_GET!("off_t", "offset"));
mixin(MPQ_A_GET!("uint", "version", "version_"));
mixin(MPQ_A_GET!("uint", "files"));
~this() {
archive_close(m);
}
mpq_archive_s* archive() {
return m;
}
File opIndex(char[] fname) {
return new File(this, fname);
}
File opIndex(int fno) {
return new File(this, fno);
}
char[][] filelist() {
try {
if (!listfile) {
listfile = this["(listfile)"];
listfiledata = (cast(char[])listfile.read()).splitlines();
}
return listfiledata;
} catch (MPQException e) {
return [];
}
}
/+uint filenumber(char[] filename) {
try {
if (!listfile) {
listfile = this["(listfile)"];
listfiledata = (cast(char[])listfile.read()).splitlines();
}
return listfiledata;
} catch (MPQException e) {
return [];
}
}+/
}
/** getter function named name for returning file_* single values:
*
* <type> File.<name>() { return libmpq__file_<name>() }
*
* @param type return type for the original function reference
* @param name name of the original function
* @param name2 name for the prototype (defaults to name, used for "version")
* @return getter function mixin
*/
template MPQ_F_GET(char[] type, char[] name, char[] name2 = name) {
const char[] MPQ_F_GET = type ~ " " ~ name2 ~ "() { " ~
type ~ " ret; " ~
"file_" ~ name ~ "(am, fileno, &ret); " ~
"return ret;" ~
"}";
}
/** wrapper class for a single file in an MPQ Archive
*
* syntax:
* auto a = new mpq.Archive("somefile.mpq");
* auto f = a["(listfile)"];
* auto f2 = a[0];
* auto f3 = new File(a, "(listfile)");
*/
class File {
Archive a;
mpq_archive_s* am;
char[] filename;
uint fileno;
this(Archive a, int fileno) {
this.a = a;
this.am = a.archive();
if (fileno >= a.files) {
throw new MPQException(format("File(%d)", fileno),
LIBMPQ_ERROR_EXIST);
}
this.filename = format("file%04d.xxx", fileno);
this.fileno = fileno;
}
this(Archive a, char[] filename) {
this.a = a;
this.am = a.archive();
this.filename = filename;
/* this line will throw an exception when the file is not there */
mpq.file_number(am, toStringz(filename), &this.fileno);
}
mixin(MPQ_F_GET!("off_t", "packed_size"));
mixin(MPQ_F_GET!("off_t", "unpacked_size"));
mixin(MPQ_F_GET!("off_t", "offset"));
mixin(MPQ_F_GET!("uint", "blocks"));
mixin(MPQ_F_GET!("uint", "encrypted"));
mixin(MPQ_F_GET!("uint", "compressed"));
mixin(MPQ_F_GET!("uint", "imploded"));
uint no() { return fileno; }
char[] name() { return filename; }
ubyte[] read() {
ubyte[] content;
content.length = this.unpacked_size();
off_t trans;
mpq.file_read(am, fileno, content.ptr, content.length, &trans);
content.length = trans;
return content;
}
}

View File

@@ -0,0 +1,443 @@
$!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
$! !
$! Copyright 2001, 2011 Fidelity Information Services, Inc !
$! !
$! This source code contains the intellectual property !
$! of its copyright holder(s), and is made available !
$! under a license. If you do not know the terms of !
$! the license, please stop and do not read further. !
$! !
$!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
$!
$!
$! KITINSTAL.COM PROCEDURE FOR THE GT.M PRODUCT
$!
$ ON CONTROL_Y THEN VMI$CALLBACK CONTROL_Y
$! ON WARNING THEN EXIT $STATUS !! allow warning errors for INSTALL REPLACE
$ IF P1 .EQS. "VMI$_INSTALL" THEN GOTO INSTALL
$ IF P1 .EQS. "VMI$_POSTINSTALL" THEN GOTO POSTINSTALL
$ IF P1 .EQS. "VMI$_IVP" THEN GOTO IVP
$ EXIT VMI$_UNSUPPORTED
$!
$INSTALL:
$ TYPE SYS$INPUT
GT.M (c) COPYRIGHT 1985 - 2000 by Sanchez Computer Associates
ALL RIGHTS RESERVED
$! the following 2 lines must be maintained
$ GTM$VMS_VERSION :== 072 ! Minimum VMS version required
$ ALPHA = (f$getsyi("arch_name") .eqs. "Alpha")
$ IF ALPHA
$ THEN
$ GTM$DISK_SPACE == 28000 ! Minumum disk space on system disk required
$ ELSE
$ GTM$DISK_SPACE == 16000 ! Minumum disk space on system disk required
$ ENDIF
$ IF F$ELEMENT(0,",",VMI$VMS_VERSION) .EQS. "RELEASED"
$ THEN
$ GTM$VMS_IS == F$ELEMENT(1,",",VMI$VMS_VERSION)
$ IF GTM$VMS_IS .LTS. GTM$VMS_VERSION
$ THEN
$ VMI$CALLBACK MESSAGE E VMSMISMATCH "This GT.M kit requires an existing VMS''GTM$VMS_VERSION' system."
$ EXIT VMI$_FAILURE
$ ENDIF
$ ELSE
$ GTM$VMS_IS :==
$ WRITE SYS$OUTPUT " No VMS version checking performed for field test versions."
$ ENDIF
$ IF (GTM$VMS_IS .GES. "052") THEN T1 = F$VERIFY(VMI$KIT_DEBUG)
$ VMI$CALLBACK CHECK_NET_UTILIZATION GTM$ROOM 'GTM$DISK_SPACE'
$ IF .NOT. GTM$ROOM
$ THEN
$ VMI$CALLBACK MESSAGE E NOSPACE "There is not enough disk space -- GT.M needs ''GTM$DISK_SPACE' blocks."
$ EXIT VMI$_FAILURE
$ ENDIF
$! setup default answers
$ GTM$DOPURGE :== YES
$ GTM$RUN_IVP :== YES
$ GTM$STD_CNF :== YES
$ GTM$DST_OWN :== SYSTEM
$ IF F$IDENTIFIER(GTM$DST_OWN,"NAME_TO_NUMBER") .EQ. 0 THEN GTM$DST_OWN :== 1,4
$ GTM$SYS_DST :== YES
$ GTM$DST_DIR :== GTM_DIST
$ GTM$DST_CRE == GTM$DST_DIR
$ GTM$DST_DEV :==
$ GTM$STARTDB :== YES
$ GTM$MGR_COM :== YES
$ GTM$HLP_DIR :== NO
$ GTM$DEF_DCL :== YES
$ GTM$DEF_SYS :== YES
$ GTM$LNK_LOG :== YES
$ GTM$INSTALL :== YES
$ GTM$DEF_GLD :== YES
$ GTM$GBL_DIR :== MUMPS.GLD
$ GTM$DEF_RTN :== YES
$ GTM$RTN_DIR :== [],GTM$DIST:
$ GTM$PCT_RTN :== YES
$ VMI$CALLBACK ASK GTM$DOPURGE "Do you want to purge files replaced by this installation" 'GTM$DOPURGE' B -
"@VMI$KWD:GTMKITHLP HELP_PURGE"
$ IF .NOT. GTM$DOPURGE THEN VMI$CALLBACK SET PURGE NO
$ VMI$CALLBACK ASK GTM$STD_CNF "Do you want the standard GT.M configuration (performs INSTALL)" 'GTM$STD_CNF' B -
"@VMI$KWD:GTMKITHLP HELP_STD_CNF"
$ IF GTM$STD_CNF
$ THEN
$ GTM$SYS_DST == 1
$ GTM$STARTDB == 1
$ GTM$MGR_COM == 1
$ GTM$HLP_DIR == 0
$ GTM$DEF_DCL == 1
$ GTM$DEF_SYS == 1
$ GTM$INSTALL == 1
$ GTM$LNK_LOG == 1
$ GTM$INSTALL == 1
$ GTM$DEF_GLD == 1
$ GTM$DEF_RTN == 1
$ GTM$PCT_RTN == 1
$ GTM$DST_LOG :== SYS$COMMON:['GTM$DST_DIR']
$ GTM$DIR_TYPE :== COMMON
$ ELSE ! Not standard configuration
$ VMI$CALLBACK ASK GTM$DST_OWN "What UIC should own the GT.M distribution" 'GTM$DST_OWN' S "@VMI$KWD:GTMKITHLP HELP_DST_OWN"
$ GTM$DST_OWN == GTM$DST_OWN - "[" - "]"
$ VMI$CALLBACK ASK GTM$SYS_DST "Do you want the GT.M distribution to go into a System Directory" 'GTM$SYS_DST' B -
"@VMI$KWD:GTMKITHLP HELP_SYS_DST"
$ IF GTM$SYS_DST
$ THEN
$ VMI$CALLBACK ASK GTM$DST_DIR "In what System Directory do you want to place GT.M" 'GTM$DST_DIR' S -
"@VMI$KWD:GTMKITHLP HELP_SYS_DIR"
$ GTM$DST_DIR == GTM$DST_DIR - "[" - "]"
$ GTM$DST_CRE == GTM$DST_DIR
$ GTM$DST_LOG :== SYS$COMMON:['GTM$DST_DIR']
$ GTM$DIR_TYPE :== COMMON
$ ELSE ! Not system disk
$ VMI$CALLBACK ASK GTM$DST_DEV "On which device do you want to place GT.M" "''GTM$DST_DEV'" S "@VMI$KWD:GTMKITHLP HELP_DST_DEV"
$ VMI$CALLBACK ASK GTM$DST_DIR "In what directory on that device do you want to place GT.M" 'GTM$DST_DIR' S -
"@VMI$KWD:GTMKITHLP HELP_DST_DIR"
$ GTM$DST_DEV == GTM$DST_DEV - ":"
$ GTM$DST_DIR == GTM$DST_DIR - "[" - "]"
$ GTM$DST_LOG :== 'GTM$DST_DEV':['GTM$DST_DIR']
$ GTM$DST_CRE == GTM$DST_LOG
$ GTM$DIR_TYPE :== USER
$ ENDIF ! system disk
$ VMI$CALLBACK ASK GTM$STARTDB "Do you want GTMSTART.COM in the startup database" 'GTM$STARTDB' B -
"@VMI$KWD:GTMKITHLP HELP_STARTDB"
$ IF .NOT. GTM$STARTDB
$ THEN
$ VMI$CALLBACK ASK GTM$MGR_COM "Do you want the GT.M .COM files in SYS$MANAGER" 'GTM$MGR_COM' B -
"@VMI$KWD:GTMKITHLP HELP_MGR_COM"
$ ENDIF
$ VMI$CALLBACK ASK GTM$HLP_DIR "Do you want the GT.M help files in SYS$HELP" 'GTM$HLP_DIR' B "@VMI$KWD:GTMKITHLP HELP_HLP_DIR"
$ VMI$CALLBACK ASK GTM$DEF_DCL "Do you want to define GT.M commands to the system" 'GTM$DEF_DCL' B -
"@VMI$KWD:GTMKITHLP HELP_DEF_DCL"
$ VMI$CALLBACK ASK GTM$DEF_SYS "Do you want to define GT.M logical names in the System Table" 'GTM$DEF_SYS' B -
"@VMI$KWD:GTMKITHLP HELP_DEF_SYS"
$ VMI$CALLBACK ASK GTM$LNK_LOG "Do you want to define the LNK$LIBRARY logical names" 'GTM$LNK_LOG' B -
"@VMI$KWD:GTMKITHLP HELP_LNK_LOG"
$ VMI$CALLBACK ASK GTM$RUN_IVP "Do you want to run the IVP (performs INSTALL)" 'GTM$RUN_IVP' B -
"@VMI$KWD:GTMKITHLP HELP_RUN_IVP"
$ IF GTM$RUN_IVP
$ THEN
$ GTM$PCT_RTN == 1
$ ELSE
$ VMI$CALLBACK ASK GTM$PCT_RTN "Do you want to compile the GT.M percent routines (performs INSTALL)" 'GTM$PCT_RTN' B -
"@VMI$KWD:GTMKITHLP HELP_PCT_RTN"
$ ENDIF
$ IF (GTM$RUN_IVP .OR. GTM$PCT_RTN)
$ THEN
$ GTM$INSTALL == 1
$ ELSE
$ VMI$CALLBACK ASK GTM$INSTALL "Do you want to INSTALL the GT.M shareable images now" 'GTM$INSTALL' B -
"@VMI$KWD:GTMKITHLP HELP_INSTALL"
$ ENDIF
$ VMI$CALLBACK ASK GTM$DEF_RTN "Do you want to have a default definition for GTM$ROUTINES" 'GTM$DEF_RTN' B -
"@VMI$KWD:GTMKITHLP HELP_DEF_RTN"
$ IF GTM$DEF_RTN
$ THEN
$ VMI$CALLBACK ASK GTM$RTN_DIR "What is the search specification for GTM$ROUTINES" 'GTM$RTN_DIR' S -
"@VMI$KWD:GTMKITHLP HELP_RTN_DIR"
$ ENDIF
$ VMI$CALLBACK ASK GTM$DEF_GLD "Do you want to have a default definition for GTM$GBLDIR" 'GTM$DEF_GLD' B -
"@VMI$KWD:GTMKITHLP HELP_DEF_GLD"
$ IF GTM$DEF_GLD
$ THEN
$ VMI$CALLBACK ASK GTM$GBL_DIR "What is the file specification for GTM$GBLDIR" 'GTM$GBL_DIR' S -
"@VMI$KWD:GTMKITHLP HELP_GBL_DIR"
$ ENDIF
$ ENDIF ! standard configuration
$! tell them what's happening
$ IF GTM$MGR_COM
$ THEN
$ WRITE SYS$OUTPUT " The following command files are created and copied to SYS$MANAGER:"
$ ELSE
$ WRITE SYS$OUTPUT " The following command files are created:"
$ ENDIF
$ TYPE SYS$INPUT
GTMINSTALL.COM
GTMLOGICALS.COM
GTMLOGIN.COM
GTMSTART.COM
GTMSTOP.COM
Each file contains its own user documentation.
All the questions have been asked. Installation now proceeds without your
manual intervention for about 10-15 minutes.
$ IF GTM$RUN_IVP THEN WRITE SYS$OUTPUT " Finally the Installation Verification Procedure tests the installation."
$ WRITE SYS$OUTPUT ""
$ VMI$CALLBACK CREATE_DIRECTORY 'GTM$DIR_TYPE' 'GTM$DST_CRE' "/OWNER_UIC=[''GTM$DST_OWN'] /PROTECTION=(WO:RE)"
$ VMI$CALLBACK RESTORE_SAVESET B
$ VMI$CALLBACK RESTORE_SAVESET C
$ WRITE SYS$OUTPUT ""
$ VMI$CALLBACK MESSAGE I CRECOM "Creating command files."
$! Create GTMINSTALL.COM
$ OPEN /WRITE OUFILE VMI$KWD:GTMINSTALL.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMINSTALL.COM installs GTMSECSHR and other GT.M images."
$ WRITE OUFILE "$! GTMSECSHR is a small protected image and must be installed."
$ WRITE OUFILE "$! GTMSHR is the run-time library and is installed for performance."
$ WRITE OUFILE "$! GTM$DMOD and MCOMPILE are small images frequently used in development."
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$ INSTALL"
$ WRITE OUFILE "REPLACE /OPEN/SHARED/HEADER/PROTECTED GTMSECSHR"
$ WRITE OUFILE "REPLACE /OPEN/SHARED/HEADER GTMSHR"
$ WRITE OUFILE "REPLACE /OPEN/SHARED/HEADER GTM$DMOD"
$ WRITE OUFILE "REPLACE /OPEN/SHARED/HEADER MCOMPILE"
$ WRITE OUFILE "$ EXIT"
$ CLOSE OUFILE
$! Create GTMLOGICALS.COM
$ GTM$HLP_LOG :== GTM$DIST
$ IF GTM$HLP_DIR THEN GTM$HLP_LOG :== SYS$HELP
$ OPEN /WRITE OUFILE VMI$KWD:GTMLOGICALS.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMLOGICALS.COM defines the logical names required to use GT.M."
$ WRITE OUFILE "$! By default the definitions are placed in the PROCESS table."
$ WRITE OUFILE "$! Parameter 1, if supplied should be the name of a logical name table"
$ WRITE OUFILE "$! and/or the mode of definition."
$ WRITE OUFILE "$! Assignments in a ""permanent"" table reduce GT.M activation time."
$ WRITE OUFILE "$!"
$ IF GTM$LNK_LOG THEN WRITE OUFILE "$! The LNK$LIBRARY names many require adjustment to your environment."
$ IF GTM$DEF_GLD THEN WRITE OUFILE "$! GTM$GBLDIR is defined to provide default access to a global directory."
$ IF GTM$DEF_RTN THEN WRITE OUFILE "$! GTM$ROUTINES is defined to provide access to the GT.M utilities."
$ IF GTM$DEF_RTN THEN WRITE OUFILE "$! You may wish to define a different structure for $ZROUTINES."
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$ IF (P1 .NES. """") .AND. (F$EXTRACT(0,1,P1) .NES. ""/"") THEN P1 := /'P1"
$ WRITE OUFILE "$ DEFINE 'P1' GTM$DIST ''GTM$DST_LOG'"
$ IF GTM$DEF_GLD THEN WRITE OUFILE "$ DEFINE 'P1' GTM$GBLDIR ''GTM$GBL_DIR'"
$ IF GTM$DEF_RTN THEN WRITE OUFILE "$ DEFINE 'P1' GTM$ROUTINES ""''GTM$RTN_DIR'"""
$ WRITE OUFILE "$ DEFINE 'P1' GTM$HELP ''GTM$HLP_LOG'"
$ WRITE OUFILE "$ DEFINE 'P1' GTMSHR GTM$DIST:GTMSHR.EXE"
$ WRITE OUFILE "$ DEFINE 'P1' GTMSECSHR GTM$DIST:GTMSECSHR.EXE"
$ WRITE OUFILE "$ DEFINE 'P1' GTM$DMOD GTM$DIST:GTM$DMOD.EXE"
$ WRITE OUFILE "$ DEFINE 'P1' MCOMPILE GTM$DIST:MCOMPILE.EXE"
$ IF GTM$LNK_LOG
$ THEN
$ N1 = 0
$ DN = 0
$ T1 = F$TRNLNM("LNK$LIBRARY")
$ IF (T1 .EQS. "") .OR. (F$LOCATE("GTMLIB",T1) .NE. F$LENGTH(T1)) .OR. (F$LOCATE("GTMSHR",T1) .NE. F$LENGTH(T1))
$ THEN
$ WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY GTM$DIST:GTMLIB.OLB"
$ DN = 1
$ ELSE ! lnk$library is in use
$LNK_LOOP:
$ N1 = N1 + 1
$ T1 = F$TRNLNM("LNK$LIBRARY_''N1'")
$ IF (T1 .EQS. "") .OR. (F$LOCATE("GTMLIB",T1) .NE. F$LENGTH(T1)) .OR. (F$LOCATE("GTMSHR",T1) .NE. F$LENGTH(T1))
$ THEN
$ WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY_''N1' GTM$DIST:GTMLIB.OLB"
$ DN = 1
$ ENDIF
$ IF (.NOT. DN) .AND. (N1 .LT. 998) THEN GOTO LNK_LOOP
$ ENDIF ! gtmlib handling
$ IF DN ! placed gtmlib
$ THEN
$ N1 = N1 + 1
$ WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY_''N1' GTM$DIST:GTMSHR.OLB"
$ ELSE
$ VMI$CALLBACK MESSAGE I NOLNKLOG "No LNK$LIBRARY logical names available"
$ ENDIF
$ ENDIF ! setting up LNK$LIBRARYs
$ WRITE OUFILE "$ EXIT"
$ CLOSE OUFILE
$! Create GTMLOGIN.COM
$ OPEN /WRITE OUFILE VMI$KWD:GTMLOGIN.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMLOGIN.COM performs process specific setup for GT.M."
$ WRITE OUFILE "$! It calls GTMLOGICALS.COM if the logical names are not"
$ WRITE OUFILE "$! in the SYSTEM table."
$ WRITE OUFILE "$! It defines symbols to access GT.M images."
$ WRITE OUFILE "$! It defines GT.M commands locally if they are not defined to the system."
$ WRITE OUFILE "$! When the command and logical names are not defined on a process level,"
$ WRITE OUFILE "$! a production user may save start-up time by not using GTMLOGIN."
$ WRITE OUFILE "$! CCE is infrequently used, but may be defined as a foreign command."
$ WRITE OUFILE "$!"
$ IF .NOT. GTM$DEF_SYS
$ THEN
$ WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
$ WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
$ WRITE OUFILE "$ @'dir'GTMLOGICALS.COM"
$ ENDIF
$ IF .NOT. GTM$DEF_DCL THEN WRITE OUFILE "$ SET COMMAND GTM$DIST:GTMCOMMANDS.CLD"
$ WRITE OUFILE "$ DSE :== $GTM$DIST:DSE.EXE ! Database System Editor"
$ WRITE OUFILE "$ GDE :== $GTM$DIST:GDE.EXE ! Global Directory Editor"
$ WRITE OUFILE "$ GTM :== MUMPS/DIRECT ! Direct Mode MUMPS"
$ WRITE OUFILE "$ LKE :== $GTM$DIST:LKE.EXE ! Lock Editor"
$ WRITE OUFILE "$ MUPI*P :== $GTM$DIST:MUPIP.EXE ! MUMPS Peripheral Interchange Program"
$ WRITE OUFILE "$ EXIT"
$ WRITE OUFILE "$ CCE :== $GTM$DIST:CCE.EXE ! GT.CX Operator Interface Program"
$ WRITE OUFILE "$ EXIT"
$ CLOSE OUFILE
$! Create GTMSTART.COM
$ OPEN /WRITE OUFILE VMI$KWD:GTMSTART.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMSTART.COM should be placed in the VMS startup database."
$ WRITE OUFILE "$! It invokes GTMLOGICALS.COM and GTMINSTALL.COM."
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
$ WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
$ IF GTM$DEF_SYS THEN WRITE OUFILE "$ IF P1 .EQS. """" .OR. (P1 .EQS. ""FULL"") THEN P1 := SYSTEM/EXEC"
$ WRITE OUFILE "$ @'dir'GTMLOGICALS 'P1'"
$ WRITE OUFILE "$ @'dir'GTMINSTALL"
$ WRITE OUFILE "$ EXIT"
$ CLOSE OUFILE
$! Create GTMSTOP.COM
$ OPEN /WRITE OUFILE VMI$KWD:GTMSTOP.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMSTOP.COM stops all the active GT.M processes and does a RUNDOWN."
$ WRITE OUFILE "$! Place an invocation or copy of this procedure in the site specific"
$ WRITE OUFILE "$! shutdown: SYS$MANAGER:SYSHUTDWN to ensure all GT.M databases are"
$ WRITE OUFILE "$! properly closed before VMS terminates. GTMSTOP should follow"
$ WRITE OUFILE "$! GTCMSTOP and precede GTCXSTOP, if they are used."
$ WRITE OUFILE "$! If GTMSTOP is not intended to disable subsequent use of GT.M,"
$ WRITE OUFILE "$! add a comment (!) before the INSTALL REMOVE GTMSECSHR."
$ WRITE OUFILE "$!"
$ IF .NOT. GTM$DEF_SYS
$ THEN
$ WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
$ WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
$ WRITE OUFILE "$ @'dir'GTMLOGICALS.COM"
$ ENDIF
$ WRITE OUFILE "$ MUPIP := $GTM$DIST:MUPIP.EXE"
$ WRITE OUFILE "$ STOP := $GTM$DIST:GTM$STOP"
$ WRITE OUFILE "$ STOP 'P1'"
$ WRITE OUFILE "$ MUPIP RUNDOWN"
$ WRITE OUFILE "$ INSTALL REMOVE GTMSECSHR"
$ WRITE OUFILE "$ EXIT"
$ IF GTM$DEF_SYS THEN WRITE OUFILE "$ IF P2 .EQS. """" THEN P2 := /SYSTEM/EXEC"
$ WRITE OUFILE "$ DEASSIGN 'P2' GTMSECSHR"
$ CLOSE OUFILE
$ VMI$CALLBACK MESSAGE I PREINS "Preparing files for installation."
$! GTMFILES.KIT must be maintained as kit contents change
$ GTM$HLP_LOG == GTM$DST_LOG
$ IF GTM$HLP_DIR THEN GTM$HLP_LOG :== VMI$ROOT:[SYSHLP]
$ OPEN /WRITE OUFILE VMI$KWD:GTMFILES.KIT
$ IF GTM$MGR_COM
$ THEN
$ WRITE OUFILE "GTM$ GTMINSTALL.COM VMI$ROOT:[SYSMGR] C"
$ WRITE OUFILE "GTM$ GTMLOGICALS.COM VMI$ROOT:[SYSMGR] C"
$ WRITE OUFILE "GTM$ GTMLOGIN.COM VMI$ROOT:[SYSMGR] C"
$ WRITE OUFILE "GTM$ GTMSTART.COM VMI$ROOT:[SYSMGR] C"
$ WRITE OUFILE "GTM$ GTMSTOP.COM VMI$ROOT:[SYSMGR] C"
$ ENDIF
$ WRITE OUFILE "GTM$ GTMINSTALL.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMLOGICALS.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMLOGIN.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMSTART.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMSTOP.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ DSE.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ GDE.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ LKE.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ MUMPS.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ MUPIP.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ GTMLIB.OLB ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMSHR.OLB ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMZCALL.MLB ''GTM$DST_LOG'"
$ IF ALPHA
$ THEN
$ WRITE OUFILE "GTM$ GTM$DEFAULTS.M64 ''GTM$DST_LOG'"
$ ELSE
$ WRITE OUFILE "GTM$ GTM$DEFAULTS.MAR ''GTM$DST_LOG'"
$ ENDIF
$ WRITE OUFILE "GTM$ GTM$CE.H ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMCOLLECT.OPT ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMCOMMANDS.CLD ''GTM$DST_LOG' C"
$ WRITE OUFILE "GTM$ *.M ''GTM$DST_LOG'"
$ CLOSE OUFILE
$! GTMIMAGES.KIT must be maintained as kit contents change
$ OPEN /WRITE OUFILE VMI$KWD:GTMIMAGES.KIT
$ WRITE OUFILE "GTM$ GTMSECSHR.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMSHR.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ DSE.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GDE.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTM$DMOD.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ LKE.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ MCOMPILE.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ MUPIP.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTM$STOP.EXE ''GTM$DST_LOG'"
$ CLOSE OUFILE
$! Provide with file.KITs
$ VMI$CALLBACK PROVIDE_FILE "" VMI$KWD:GTMFILES.KIT "" T
$ VMI$CALLBACK PROVIDE_IMAGE "" VMI$KWD:GTMIMAGES.KIT "" T
$ VMI$CALLBACK MESSAGE I FININS "Finalizing the installation."
$ IF GTM$DEF_DCL THEN VMI$CALLBACK PROVIDE_DCL_COMMAND GTMCOMMANDS.CLD
$ IF GTM$STARTDB THEN VMI$CALLBACK MODIFY_STARTUP_DB ADD GTMSTART.COM LPMAIN
$! GTM$INSTALL is TRUE if GTM$RUN_IVP or GTM$PCT_RTN
$ IF GTM$INSTALL THEN VMI$CALLBACK SET POSTINSTALL YES
$ IF GTM$RUN_IVP THEN VMI$CALLBACK SET IVP YES
$ EXIT VMI$_SUCCESS
$!
$POSTINSTALL:
$ ON CONTROL_Y THEN EXIT VMI$_FAILURE
$! remove MUPIP from command tables for change from V2.4 to V2.5
$ SET NOON
$ DEFINE /USER_MODE SYS$OUTPUT NL:
$ DEFINE /USER_MODE SYS$ERROR NL:
$ SET COMMAND /TABLE=SYS$COMMON:[SYSLIB]DCLTABLES /OUTPUT=SYS$COMMON:[SYSLIB]DCLTABLES /DELETE=MUPIP
$ DEFINE /USER_MODE SYS$OUTPUT NL:
$ DEFINE /USER_MODE SYS$ERROR NL:
$ SET COMMAND /DELETE=MUPIP
$ SET ON
$ IF GTM$MGR_COM
$ THEN
$ T1 := SYS$MANAGER:
$ ELSE
$ T1 = GTM$DST_LOG
$ ENDIF
$ @'T1'GTMSTART
$ @'T1'GTMLOGIN
$ ON CONTROL_Y THEN EXIT VMI$_FAILURE
$ SET DEFAULT GTM$DIST
$ T2 = F$ENVIRONMENT("PROTECTION")
$ SET PROTECTION=(S=REWD,O=REWD,G=REWD,W=RE)/DEFAULT
$ MUMPS GTM$DMOD.M
$ IF GTM$LNK_LOG
$ THEN
$ T1 :=
$ ELSE
$ T1 :=,GTMLIB.OLB/LIB,GTMSHR.OLB/LIB
$ ENDIF
$ LINK GTM$DMOD.OBJ/NOTRACE'T1
$ IF GTM$PCT_RTN
$ THEN
$ TYPE SYS$INPUT
Compiling the GT.M percent (%) routines.
$ MUMPS *
$ IF GTM$DOPURGE THEN PURGE *.*
$ SET DEFAULT VMI$KWD
$ ENDIF ! percent routines
$ SET PROTECTION=('T2')/DEFAULT
$ EXIT VMI$_SUCCESS
$!
$IVP:
$! The real Installation Verification Procedure.
$ TYPE SYS$INPUT
GT.M Installation Verification Procedure
$! Extract the IVP .COM file from the text library.
$ LIBRARIAN /EXTRACT=GTM$IVP /OUTPUT=GTM$IVP.COM GTM$IVP.TLB
$ @GTM$IVP
$ EXIT $STATUS
$!

View File

@@ -0,0 +1,867 @@
$! make libz under VMS written by
$! Martin P.J. Zinser
$!
$! In case of problems with the install you might contact me at
$! zinser@zinser.no-ip.info(preferred) or
$! martin.zinser@eurexchange.com (work)
$!
$! Make procedure history for Zlib
$!
$!------------------------------------------------------------------------------
$! Version history
$! 0.01 20060120 First version to receive a number
$! 0.02 20061008 Adapt to new Makefile.in
$! 0.03 20091224 Add support for large file check
$! 0.04 20100110 Add new gzclose, gzlib, gzread, gzwrite
$! 0.05 20100221 Exchange zlibdefs.h by zconf.h.in
$! 0.06 20120111 Fix missing amiss_err, update zconf_h.in, fix new exmples
$! subdir path, update module search in makefile.in
$! 0.07 20120115 Triggered by work done by Alexey Chupahin completly redesigned
$! shared image creation
$! 0.08 20120219 Make it work on VAX again, pre-load missing symbols to shared
$! image
$! 0.09 20120305 SMS. P1 sets builder ("MMK", "MMS", " " (built-in)).
$! "" -> automatic, preference: MMK, MMS, built-in.
$!
$ on error then goto err_exit
$!
$ true = 1
$ false = 0
$ tmpnam = "temp_" + f$getjpi("","pid")
$ tt = tmpnam + ".txt"
$ tc = tmpnam + ".c"
$ th = tmpnam + ".h"
$ define/nolog tconfig 'th'
$ its_decc = false
$ its_vaxc = false
$ its_gnuc = false
$ s_case = False
$!
$! Setup variables holding "config" information
$!
$ Make = "''p1'"
$ name = "Zlib"
$ version = "?.?.?"
$ v_string = "ZLIB_VERSION"
$ v_file = "zlib.h"
$ ccopt = "/include = []"
$ lopts = ""
$ dnsrl = ""
$ aconf_in_file = "zconf.h.in#zconf.h_in#zconf_h.in"
$ conf_check_string = ""
$ linkonly = false
$ optfile = name + ".opt"
$ mapfile = name + ".map"
$ libdefs = ""
$ vax = f$getsyi("HW_MODEL").lt.1024
$ axp = f$getsyi("HW_MODEL").ge.1024 .and. f$getsyi("HW_MODEL").lt.4096
$ ia64 = f$getsyi("HW_MODEL").ge.4096
$!
$! 2012-03-05 SMS.
$! Why is this needed? And if it is needed, why not simply ".not. vax"?
$!
$!!! if axp .or. ia64 then set proc/parse=extended
$!
$ whoami = f$parse(f$environment("Procedure"),,,,"NO_CONCEAL")
$ mydef = F$parse(whoami,,,"DEVICE")
$ mydir = f$parse(whoami,,,"DIRECTORY") - "]["
$ myproc = f$parse(whoami,,,"Name") + f$parse(whoami,,,"type")
$!
$! Check for MMK/MMS
$!
$ if (Make .eqs. "")
$ then
$ If F$Search ("Sys$System:MMS.EXE") .nes. "" Then Make = "MMS"
$ If F$Type (MMK) .eqs. "STRING" Then Make = "MMK"
$ else
$ Make = f$edit( Make, "trim")
$ endif
$!
$ gosub find_version
$!
$ open/write topt tmp.opt
$ open/write optf 'optfile'
$!
$ gosub check_opts
$!
$! Look for the compiler used
$!
$ gosub check_compiler
$ close topt
$ close optf
$!
$ if its_decc
$ then
$ ccopt = "/prefix=all" + ccopt
$ if f$trnlnm("SYS") .eqs. ""
$ then
$ if axp
$ then
$ define sys sys$library:
$ else
$ ccopt = "/decc" + ccopt
$ define sys decc$library_include:
$ endif
$ endif
$!
$! 2012-03-05 SMS.
$! Why /NAMES = AS_IS? Why not simply ".not. vax"? And why not on VAX?
$!
$ if axp .or. ia64
$ then
$ ccopt = ccopt + "/name=as_is/opt=(inline=speed)"
$ s_case = true
$ endif
$ endif
$ if its_vaxc .or. its_gnuc
$ then
$ if f$trnlnm("SYS").eqs."" then define sys sys$library:
$ endif
$!
$! Build a fake configure input header
$!
$ open/write conf_hin config.hin
$ write conf_hin "#undef _LARGEFILE64_SOURCE"
$ close conf_hin
$!
$!
$ i = 0
$FIND_ACONF:
$ fname = f$element(i,"#",aconf_in_file)
$ if fname .eqs. "#" then goto AMISS_ERR
$ if f$search(fname) .eqs. ""
$ then
$ i = i + 1
$ goto find_aconf
$ endif
$ open/read/err=aconf_err aconf_in 'fname'
$ open/write aconf zconf.h
$ACONF_LOOP:
$ read/end_of_file=aconf_exit aconf_in line
$ work = f$edit(line, "compress,trim")
$ if f$extract(0,6,work) .nes. "#undef"
$ then
$ if f$extract(0,12,work) .nes. "#cmakedefine"
$ then
$ write aconf line
$ endif
$ else
$ cdef = f$element(1," ",work)
$ gosub check_config
$ endif
$ goto aconf_loop
$ACONF_EXIT:
$ write aconf ""
$ write aconf "/* VMS specifics added by make_vms.com: */"
$ write aconf "#define VMS 1"
$ write aconf "#include <unistd.h>"
$ write aconf "#include <unixio.h>"
$ write aconf "#ifdef _LARGEFILE"
$ write aconf "# define off64_t __off64_t"
$ write aconf "# define fopen64 fopen"
$ write aconf "# define fseeko64 fseeko"
$ write aconf "# define lseek64 lseek"
$ write aconf "# define ftello64 ftell"
$ write aconf "#endif"
$ write aconf "#if !defined( __VAX) && (__CRTL_VER >= 70312000)"
$ write aconf "# define HAVE_VSNPRINTF"
$ write aconf "#endif"
$ close aconf_in
$ close aconf
$ if f$search("''th'") .nes. "" then delete 'th';*
$! Build the thing plain or with mms
$!
$ write sys$output "Compiling Zlib sources ..."
$ if make.eqs.""
$ then
$ if (f$search( "example.obj;*") .nes. "") then delete example.obj;*
$ if (f$search( "minigzip.obj;*") .nes. "") then delete minigzip.obj;*
$ CALL MAKE adler32.OBJ "CC ''CCOPT' adler32" -
adler32.c zlib.h zconf.h
$ CALL MAKE compress.OBJ "CC ''CCOPT' compress" -
compress.c zlib.h zconf.h
$ CALL MAKE crc32.OBJ "CC ''CCOPT' crc32" -
crc32.c zlib.h zconf.h
$ CALL MAKE deflate.OBJ "CC ''CCOPT' deflate" -
deflate.c deflate.h zutil.h zlib.h zconf.h
$ CALL MAKE gzclose.OBJ "CC ''CCOPT' gzclose" -
gzclose.c zutil.h zlib.h zconf.h
$ CALL MAKE gzlib.OBJ "CC ''CCOPT' gzlib" -
gzlib.c zutil.h zlib.h zconf.h
$ CALL MAKE gzread.OBJ "CC ''CCOPT' gzread" -
gzread.c zutil.h zlib.h zconf.h
$ CALL MAKE gzwrite.OBJ "CC ''CCOPT' gzwrite" -
gzwrite.c zutil.h zlib.h zconf.h
$ CALL MAKE infback.OBJ "CC ''CCOPT' infback" -
infback.c zutil.h inftrees.h inflate.h inffast.h inffixed.h
$ CALL MAKE inffast.OBJ "CC ''CCOPT' inffast" -
inffast.c zutil.h zlib.h zconf.h inffast.h
$ CALL MAKE inflate.OBJ "CC ''CCOPT' inflate" -
inflate.c zutil.h zlib.h zconf.h infblock.h
$ CALL MAKE inftrees.OBJ "CC ''CCOPT' inftrees" -
inftrees.c zutil.h zlib.h zconf.h inftrees.h
$ CALL MAKE trees.OBJ "CC ''CCOPT' trees" -
trees.c deflate.h zutil.h zlib.h zconf.h
$ CALL MAKE uncompr.OBJ "CC ''CCOPT' uncompr" -
uncompr.c zlib.h zconf.h
$ CALL MAKE zutil.OBJ "CC ''CCOPT' zutil" -
zutil.c zutil.h zlib.h zconf.h
$ write sys$output "Building Zlib ..."
$ CALL MAKE libz.OLB "lib/crea libz.olb *.obj" *.OBJ
$ write sys$output "Building example..."
$ CALL MAKE example.OBJ "CC ''CCOPT' [.test]example" -
[.test]example.c zlib.h zconf.h
$ call make example.exe "LINK example,libz.olb/lib" example.obj libz.olb
$ write sys$output "Building minigzip..."
$ CALL MAKE minigzip.OBJ "CC ''CCOPT' [.test]minigzip" -
[.test]minigzip.c zlib.h zconf.h
$ call make minigzip.exe -
"LINK minigzip,libz.olb/lib" -
minigzip.obj libz.olb
$ else
$ gosub crea_mms
$ write sys$output "Make ''name' ''version' with ''Make' "
$ 'make'
$ endif
$!
$! Create shareable image
$!
$ gosub crea_olist
$ write sys$output "Creating libzshr.exe"
$ call map_2_shopt 'mapfile' 'optfile'
$ LINK_'lopts'/SHARE=libzshr.exe modules.opt/opt,'optfile'/opt
$ write sys$output "Zlib build completed"
$ delete/nolog tmp.opt;*
$ exit
$AMISS_ERR:
$ write sys$output "No source for config.hin found."
$ write sys$output "Tried any of ''aconf_in_file'"
$ goto err_exit
$CC_ERR:
$ write sys$output "C compiler required to build ''name'"
$ goto err_exit
$ERR_EXIT:
$ set message/facil/ident/sever/text
$ close/nolog optf
$ close/nolog topt
$ close/nolog aconf_in
$ close/nolog aconf
$ close/nolog out
$ close/nolog min
$ close/nolog mod
$ close/nolog h_in
$ write sys$output "Exiting..."
$ exit 2
$!
$!
$MAKE: SUBROUTINE !SUBROUTINE TO CHECK DEPENDENCIES
$ V = 'F$Verify(0)
$! P1 = What we are trying to make
$! P2 = Command to make it
$! P3 - P8 What it depends on
$
$ If F$Search(P1) .Eqs. "" Then Goto Makeit
$ Time = F$CvTime(F$File(P1,"RDT"))
$arg=3
$Loop:
$ Argument = P'arg
$ If Argument .Eqs. "" Then Goto Exit
$ El=0
$Loop2:
$ File = F$Element(El," ",Argument)
$ If File .Eqs. " " Then Goto Endl
$ AFile = ""
$Loop3:
$ OFile = AFile
$ AFile = F$Search(File)
$ If AFile .Eqs. "" .Or. AFile .Eqs. OFile Then Goto NextEl
$ If F$CvTime(F$File(AFile,"RDT")) .Ges. Time Then Goto Makeit
$ Goto Loop3
$NextEL:
$ El = El + 1
$ Goto Loop2
$EndL:
$ arg=arg+1
$ If arg .Le. 8 Then Goto Loop
$ Goto Exit
$
$Makeit:
$ VV=F$VERIFY(0)
$ write sys$output P2
$ 'P2
$ VV='F$Verify(VV)
$Exit:
$ If V Then Set Verify
$ENDSUBROUTINE
$!------------------------------------------------------------------------------
$!
$! Check command line options and set symbols accordingly
$!
$!------------------------------------------------------------------------------
$! Version history
$! 0.01 20041206 First version to receive a number
$! 0.02 20060126 Add new "HELP" target
$ CHECK_OPTS:
$ i = 1
$ OPT_LOOP:
$ if i .lt. 9
$ then
$ cparm = f$edit(p'i',"upcase")
$!
$! Check if parameter actually contains something
$!
$ if f$edit(cparm,"trim") .nes. ""
$ then
$ if cparm .eqs. "DEBUG"
$ then
$ ccopt = ccopt + "/noopt/deb"
$ lopts = lopts + "/deb"
$ endif
$ if f$locate("CCOPT=",cparm) .lt. f$length(cparm)
$ then
$ start = f$locate("=",cparm) + 1
$ len = f$length(cparm) - start
$ ccopt = ccopt + f$extract(start,len,cparm)
$ if f$locate("AS_IS",f$edit(ccopt,"UPCASE")) .lt. f$length(ccopt) -
then s_case = true
$ endif
$ if cparm .eqs. "LINK" then linkonly = true
$ if f$locate("LOPTS=",cparm) .lt. f$length(cparm)
$ then
$ start = f$locate("=",cparm) + 1
$ len = f$length(cparm) - start
$ lopts = lopts + f$extract(start,len,cparm)
$ endif
$ if f$locate("CC=",cparm) .lt. f$length(cparm)
$ then
$ start = f$locate("=",cparm) + 1
$ len = f$length(cparm) - start
$ cc_com = f$extract(start,len,cparm)
if (cc_com .nes. "DECC") .and. -
(cc_com .nes. "VAXC") .and. -
(cc_com .nes. "GNUC")
$ then
$ write sys$output "Unsupported compiler choice ''cc_com' ignored"
$ write sys$output "Use DECC, VAXC, or GNUC instead"
$ else
$ if cc_com .eqs. "DECC" then its_decc = true
$ if cc_com .eqs. "VAXC" then its_vaxc = true
$ if cc_com .eqs. "GNUC" then its_gnuc = true
$ endif
$ endif
$ if f$locate("MAKE=",cparm) .lt. f$length(cparm)
$ then
$ start = f$locate("=",cparm) + 1
$ len = f$length(cparm) - start
$ mmks = f$extract(start,len,cparm)
$ if (mmks .eqs. "MMK") .or. (mmks .eqs. "MMS")
$ then
$ make = mmks
$ else
$ write sys$output "Unsupported make choice ''mmks' ignored"
$ write sys$output "Use MMK or MMS instead"
$ endif
$ endif
$ if cparm .eqs. "HELP" then gosub bhelp
$ endif
$ i = i + 1
$ goto opt_loop
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Look for the compiler used
$!
$! Version history
$! 0.01 20040223 First version to receive a number
$! 0.02 20040229 Save/set value of decc$no_rooted_search_lists
$! 0.03 20060202 Extend handling of GNU C
$! 0.04 20090402 Compaq -> hp
$CHECK_COMPILER:
$ if (.not. (its_decc .or. its_vaxc .or. its_gnuc))
$ then
$ its_decc = (f$search("SYS$SYSTEM:DECC$COMPILER.EXE") .nes. "")
$ its_vaxc = .not. its_decc .and. (F$Search("SYS$System:VAXC.Exe") .nes. "")
$ its_gnuc = .not. (its_decc .or. its_vaxc) .and. (f$trnlnm("gnu_cc") .nes. "")
$ endif
$!
$! Exit if no compiler available
$!
$ if (.not. (its_decc .or. its_vaxc .or. its_gnuc))
$ then goto CC_ERR
$ else
$ if its_decc
$ then
$ write sys$output "CC compiler check ... hp C"
$ if f$trnlnm("decc$no_rooted_search_lists") .nes. ""
$ then
$ dnrsl = f$trnlnm("decc$no_rooted_search_lists")
$ endif
$ define/nolog decc$no_rooted_search_lists 1
$ else
$ if its_vaxc then write sys$output "CC compiler check ... VAX C"
$ if its_gnuc
$ then
$ write sys$output "CC compiler check ... GNU C"
$ if f$trnlnm(topt) then write topt "gnu_cc:[000000]gcclib.olb/lib"
$ if f$trnlnm(optf) then write optf "gnu_cc:[000000]gcclib.olb/lib"
$ cc = "gcc"
$ endif
$ if f$trnlnm(topt) then write topt "sys$share:vaxcrtl.exe/share"
$ if f$trnlnm(optf) then write optf "sys$share:vaxcrtl.exe/share"
$ endif
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! If MMS/MMK are available dump out the descrip.mms if required
$!
$CREA_MMS:
$ write sys$output "Creating descrip.mms..."
$ create descrip.mms
$ open/append out descrip.mms
$ copy sys$input: out
$ deck
# descrip.mms: MMS description file for building zlib on VMS
# written by Martin P.J. Zinser
# <zinser@zinser.no-ip.info or martin.zinser@eurexchange.com>
OBJS = adler32.obj, compress.obj, crc32.obj, gzclose.obj, gzlib.obj\
gzread.obj, gzwrite.obj, uncompr.obj, infback.obj\
deflate.obj, trees.obj, zutil.obj, inflate.obj, \
inftrees.obj, inffast.obj
$ eod
$ write out "CFLAGS=", ccopt
$ write out "LOPTS=", lopts
$ write out "all : example.exe minigzip.exe libz.olb"
$ copy sys$input: out
$ deck
@ write sys$output " Example applications available"
libz.olb : libz.olb($(OBJS))
@ write sys$output " libz available"
example.exe : example.obj libz.olb
link $(LOPTS) example,libz.olb/lib
minigzip.exe : minigzip.obj libz.olb
link $(LOPTS) minigzip,libz.olb/lib
clean :
delete *.obj;*,libz.olb;*,*.opt;*,*.exe;*
# Other dependencies.
adler32.obj : adler32.c zutil.h zlib.h zconf.h
compress.obj : compress.c zlib.h zconf.h
crc32.obj : crc32.c zutil.h zlib.h zconf.h
deflate.obj : deflate.c deflate.h zutil.h zlib.h zconf.h
example.obj : [.test]example.c zlib.h zconf.h
gzclose.obj : gzclose.c zutil.h zlib.h zconf.h
gzlib.obj : gzlib.c zutil.h zlib.h zconf.h
gzread.obj : gzread.c zutil.h zlib.h zconf.h
gzwrite.obj : gzwrite.c zutil.h zlib.h zconf.h
inffast.obj : inffast.c zutil.h zlib.h zconf.h inftrees.h inffast.h
inflate.obj : inflate.c zutil.h zlib.h zconf.h
inftrees.obj : inftrees.c zutil.h zlib.h zconf.h inftrees.h
minigzip.obj : [.test]minigzip.c zlib.h zconf.h
trees.obj : trees.c deflate.h zutil.h zlib.h zconf.h
uncompr.obj : uncompr.c zlib.h zconf.h
zutil.obj : zutil.c zutil.h zlib.h zconf.h
infback.obj : infback.c zutil.h inftrees.h inflate.h inffast.h inffixed.h
$ eod
$ close out
$ return
$!------------------------------------------------------------------------------
$!
$! Read list of core library sources from makefile.in and create options
$! needed to build shareable image
$!
$CREA_OLIST:
$ open/read min makefile.in
$ open/write mod modules.opt
$ src_check_list = "OBJZ =#OBJG ="
$MRLOOP:
$ read/end=mrdone min rec
$ i = 0
$SRC_CHECK_LOOP:
$ src_check = f$element(i, "#", src_check_list)
$ i = i+1
$ if src_check .eqs. "#" then goto mrloop
$ if (f$extract(0,6,rec) .nes. src_check) then goto src_check_loop
$ rec = rec - src_check
$ gosub extra_filnam
$ if (f$element(1,"\",rec) .eqs. "\") then goto mrloop
$MRSLOOP:
$ read/end=mrdone min rec
$ gosub extra_filnam
$ if (f$element(1,"\",rec) .nes. "\") then goto mrsloop
$MRDONE:
$ close min
$ close mod
$ return
$!------------------------------------------------------------------------------
$!
$! Take record extracted in crea_olist and split it into single filenames
$!
$EXTRA_FILNAM:
$ myrec = f$edit(rec - "\", "trim,compress")
$ i = 0
$FELOOP:
$ srcfil = f$element(i," ", myrec)
$ if (srcfil .nes. " ")
$ then
$ write mod f$parse(srcfil,,,"NAME"), ".obj"
$ i = i + 1
$ goto feloop
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Find current Zlib version number
$!
$FIND_VERSION:
$ open/read h_in 'v_file'
$hloop:
$ read/end=hdone h_in rec
$ rec = f$edit(rec,"TRIM")
$ if (f$extract(0,1,rec) .nes. "#") then goto hloop
$ rec = f$edit(rec - "#", "TRIM")
$ if f$element(0," ",rec) .nes. "define" then goto hloop
$ if f$element(1," ",rec) .eqs. v_string
$ then
$ version = 'f$element(2," ",rec)'
$ goto hdone
$ endif
$ goto hloop
$hdone:
$ close h_in
$ return
$!------------------------------------------------------------------------------
$!
$CHECK_CONFIG:
$!
$ in_ldef = f$locate(cdef,libdefs)
$ if (in_ldef .lt. f$length(libdefs))
$ then
$ write aconf "#define ''cdef' 1"
$ libdefs = f$extract(0,in_ldef,libdefs) + -
f$extract(in_ldef + f$length(cdef) + 1, -
f$length(libdefs) - in_ldef - f$length(cdef) - 1, -
libdefs)
$ else
$ if (f$type('cdef') .eqs. "INTEGER")
$ then
$ write aconf "#define ''cdef' ", 'cdef'
$ else
$ if (f$type('cdef') .eqs. "STRING")
$ then
$ write aconf "#define ''cdef' ", """", '''cdef'', """"
$ else
$ gosub check_cc_def
$ endif
$ endif
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Check if this is a define relating to the properties of the C/C++
$! compiler
$!
$ CHECK_CC_DEF:
$ if (cdef .eqs. "_LARGEFILE64_SOURCE")
$ then
$ copy sys$input: 'tc'
$ deck
#include "tconfig"
#define _LARGEFILE
#include <stdio.h>
int main(){
FILE *fp;
fp = fopen("temp.txt","r");
fseeko(fp,1,SEEK_SET);
fclose(fp);
}
$ eod
$ test_inv = false
$ comm_h = false
$ gosub cc_prop_check
$ return
$ endif
$ write aconf "/* ", line, " */"
$ return
$!------------------------------------------------------------------------------
$!
$! Check for properties of C/C++ compiler
$!
$! Version history
$! 0.01 20031020 First version to receive a number
$! 0.02 20031022 Added logic for defines with value
$! 0.03 20040309 Make sure local config file gets not deleted
$! 0.04 20041230 Also write include for configure run
$! 0.05 20050103 Add processing of "comment defines"
$CC_PROP_CHECK:
$ cc_prop = true
$ is_need = false
$ is_need = (f$extract(0,4,cdef) .eqs. "NEED") .or. (test_inv .eq. true)
$ if f$search(th) .eqs. "" then create 'th'
$ set message/nofac/noident/nosever/notext
$ on error then continue
$ cc 'tmpnam'
$ if .not. ($status) then cc_prop = false
$ on error then continue
$! The headers might lie about the capabilities of the RTL
$ link 'tmpnam',tmp.opt/opt
$ if .not. ($status) then cc_prop = false
$ set message/fac/ident/sever/text
$ on error then goto err_exit
$ delete/nolog 'tmpnam'.*;*/exclude='th'
$ if (cc_prop .and. .not. is_need) .or. -
(.not. cc_prop .and. is_need)
$ then
$ write sys$output "Checking for ''cdef'... yes"
$ if f$type('cdef_val'_yes) .nes. ""
$ then
$ if f$type('cdef_val'_yes) .eqs. "INTEGER" -
then call write_config f$fao("#define !AS !UL",cdef,'cdef_val'_yes)
$ if f$type('cdef_val'_yes) .eqs. "STRING" -
then call write_config f$fao("#define !AS !AS",cdef,'cdef_val'_yes)
$ else
$ call write_config f$fao("#define !AS 1",cdef)
$ endif
$ if (cdef .eqs. "HAVE_FSEEKO") .or. (cdef .eqs. "_LARGE_FILES") .or. -
(cdef .eqs. "_LARGEFILE64_SOURCE") then -
call write_config f$string("#define _LARGEFILE 1")
$ else
$ write sys$output "Checking for ''cdef'... no"
$ if (comm_h)
$ then
call write_config f$fao("/* !AS */",line)
$ else
$ if f$type('cdef_val'_no) .nes. ""
$ then
$ if f$type('cdef_val'_no) .eqs. "INTEGER" -
then call write_config f$fao("#define !AS !UL",cdef,'cdef_val'_no)
$ if f$type('cdef_val'_no) .eqs. "STRING" -
then call write_config f$fao("#define !AS !AS",cdef,'cdef_val'_no)
$ else
$ call write_config f$fao("#undef !AS",cdef)
$ endif
$ endif
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Check for properties of C/C++ compiler with multiple result values
$!
$! Version history
$! 0.01 20040127 First version
$! 0.02 20050103 Reconcile changes from cc_prop up to version 0.05
$CC_MPROP_CHECK:
$ cc_prop = true
$ i = 1
$ idel = 1
$ MT_LOOP:
$ if f$type(result_'i') .eqs. "STRING"
$ then
$ set message/nofac/noident/nosever/notext
$ on error then continue
$ cc 'tmpnam'_'i'
$ if .not. ($status) then cc_prop = false
$ on error then continue
$! The headers might lie about the capabilities of the RTL
$ link 'tmpnam'_'i',tmp.opt/opt
$ if .not. ($status) then cc_prop = false
$ set message/fac/ident/sever/text
$ on error then goto err_exit
$ delete/nolog 'tmpnam'_'i'.*;*
$ if (cc_prop)
$ then
$ write sys$output "Checking for ''cdef'... ", mdef_'i'
$ if f$type(mdef_'i') .eqs. "INTEGER" -
then call write_config f$fao("#define !AS !UL",cdef,mdef_'i')
$ if f$type('cdef_val'_yes) .eqs. "STRING" -
then call write_config f$fao("#define !AS !AS",cdef,mdef_'i')
$ goto msym_clean
$ else
$ i = i + 1
$ goto mt_loop
$ endif
$ endif
$ write sys$output "Checking for ''cdef'... no"
$ call write_config f$fao("#undef !AS",cdef)
$ MSYM_CLEAN:
$ if (idel .le. msym_max)
$ then
$ delete/sym mdef_'idel'
$ idel = idel + 1
$ goto msym_clean
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Write configuration to both permanent and temporary config file
$!
$! Version history
$! 0.01 20031029 First version to receive a number
$!
$WRITE_CONFIG: SUBROUTINE
$ write aconf 'p1'
$ open/append confh 'th'
$ write confh 'p1'
$ close confh
$ENDSUBROUTINE
$!------------------------------------------------------------------------------
$!
$! Analyze the project map file and create the symbol vector for a shareable
$! image from it
$!
$! Version history
$! 0.01 20120128 First version
$! 0.02 20120226 Add pre-load logic
$!
$ MAP_2_SHOPT: Subroutine
$!
$ SAY := "WRITE_ SYS$OUTPUT"
$!
$ IF F$SEARCH("''P1'") .EQS. ""
$ THEN
$ SAY "MAP_2_SHOPT-E-NOSUCHFILE: Error, inputfile ''p1' not available"
$ goto exit_m2s
$ ENDIF
$ IF "''P2'" .EQS. ""
$ THEN
$ SAY "MAP_2_SHOPT: Error, no output file provided"
$ goto exit_m2s
$ ENDIF
$!
$ module1 = "deflate#deflateEnd#deflateInit_#deflateParams#deflateSetDictionary"
$ module2 = "gzclose#gzerror#gzgetc#gzgets#gzopen#gzprintf#gzputc#gzputs#gzread"
$ module3 = "gzseek#gztell#inflate#inflateEnd#inflateInit_#inflateSetDictionary"
$ module4 = "inflateSync#uncompress#zlibVersion#compress"
$ open/read map 'p1
$ if axp .or. ia64
$ then
$ open/write aopt a.opt
$ open/write bopt b.opt
$ write aopt " CASE_SENSITIVE=YES"
$ write bopt "SYMBOL_VECTOR= (-"
$ mod_sym_num = 1
$ MOD_SYM_LOOP:
$ if f$type(module'mod_sym_num') .nes. ""
$ then
$ mod_in = 0
$ MOD_SYM_IN:
$ shared_proc = f$element(mod_in, "#", module'mod_sym_num')
$ if shared_proc .nes. "#"
$ then
$ write aopt f$fao(" symbol_vector=(!AS/!AS=PROCEDURE)",-
f$edit(shared_proc,"upcase"),shared_proc)
$ write bopt f$fao("!AS=PROCEDURE,-",shared_proc)
$ mod_in = mod_in + 1
$ goto mod_sym_in
$ endif
$ mod_sym_num = mod_sym_num + 1
$ goto mod_sym_loop
$ endif
$MAP_LOOP:
$ read/end=map_end map line
$ if (f$locate("{",line).lt. f$length(line)) .or. -
(f$locate("global:", line) .lt. f$length(line))
$ then
$ proc = true
$ goto map_loop
$ endif
$ if f$locate("}",line).lt. f$length(line) then proc = false
$ if f$locate("local:", line) .lt. f$length(line) then proc = false
$ if proc
$ then
$ shared_proc = f$edit(line,"collapse")
$ chop_semi = f$locate(";", shared_proc)
$ if chop_semi .lt. f$length(shared_proc) then -
shared_proc = f$extract(0, chop_semi, shared_proc)
$ write aopt f$fao(" symbol_vector=(!AS/!AS=PROCEDURE)",-
f$edit(shared_proc,"upcase"),shared_proc)
$ write bopt f$fao("!AS=PROCEDURE,-",shared_proc)
$ endif
$ goto map_loop
$MAP_END:
$ close/nolog aopt
$ close/nolog bopt
$ open/append libopt 'p2'
$ open/read aopt a.opt
$ open/read bopt b.opt
$ALOOP:
$ read/end=aloop_end aopt line
$ write libopt line
$ goto aloop
$ALOOP_END:
$ close/nolog aopt
$ sv = ""
$BLOOP:
$ read/end=bloop_end bopt svn
$ if (svn.nes."")
$ then
$ if (sv.nes."") then write libopt sv
$ sv = svn
$ endif
$ goto bloop
$BLOOP_END:
$ write libopt f$extract(0,f$length(sv)-2,sv), "-"
$ write libopt ")"
$ close/nolog bopt
$ delete/nolog/noconf a.opt;*,b.opt;*
$ else
$ if vax
$ then
$ open/append libopt 'p2'
$ mod_sym_num = 1
$ VMOD_SYM_LOOP:
$ if f$type(module'mod_sym_num') .nes. ""
$ then
$ mod_in = 0
$ VMOD_SYM_IN:
$ shared_proc = f$element(mod_in, "#", module'mod_sym_num')
$ if shared_proc .nes. "#"
$ then
$ write libopt f$fao("UNIVERSAL=!AS",-
f$edit(shared_proc,"upcase"))
$ mod_in = mod_in + 1
$ goto vmod_sym_in
$ endif
$ mod_sym_num = mod_sym_num + 1
$ goto vmod_sym_loop
$ endif
$VMAP_LOOP:
$ read/end=vmap_end map line
$ if (f$locate("{",line).lt. f$length(line)) .or. -
(f$locate("global:", line) .lt. f$length(line))
$ then
$ proc = true
$ goto vmap_loop
$ endif
$ if f$locate("}",line).lt. f$length(line) then proc = false
$ if f$locate("local:", line) .lt. f$length(line) then proc = false
$ if proc
$ then
$ shared_proc = f$edit(line,"collapse")
$ chop_semi = f$locate(";", shared_proc)
$ if chop_semi .lt. f$length(shared_proc) then -
shared_proc = f$extract(0, chop_semi, shared_proc)
$ write libopt f$fao("UNIVERSAL=!AS",-
f$edit(shared_proc,"upcase"))
$ endif
$ goto vmap_loop
$VMAP_END:
$ else
$ write sys$output "Unknown Architecture (Not VAX, AXP, or IA64)"
$ write sys$output "No options file created"
$ endif
$ endif
$ EXIT_M2S:
$ close/nolog map
$ close/nolog libopt
$ endsubroutine

View File

@@ -0,0 +1,342 @@
$! BUILD_XSLT.COM
$!
$! Build the XSLT library
$!
$! Arguments:
$!
$! p1 - "DEBUG" is you want to build with debug
$!
$! This package requires libxml to have already been installed. You need
$! to ensure that the logical name LIBXML is defined and points to the
$! directory containing libxml's .h files
$!
$! This procedure creates the object libraries
$!
$! XML_LIBDIR:LIBXSLT.OLB
$! XML_LIBDIR:LIBEXSLT.OLB
$!
$! and the program
$!
$! XSLTPROC
$!
$! After the library is built, you can link these routines into
$! your code with the command
$!
$! LINK your_modules,XML_LIBDIR:LIBEXSLT/LIB,LIBXSLT/LIBRARY,LIBXML/LIB
$!
$! Change History
$! --------------
$! Command file author : John A Fotheringham (jaf@jafsoft.com)
$! Last update : 2 Nov 2001
$!
$!- configuration -------------------------------------------------------------
$!
$!- compile command.
$!
$ cc_opts = "/INCLUDE=([],XML_SRCDIR:,[-.libxslt])/NAMES=(SHORTENED)/FLOAT=IEEE/IEEE_MODE=DENORM_RESULTS"
$!
$ if p1.eqs."DEBUG"
$ then
$ debug = "Y"
$ cc_command = "CC''cc_opts'/DEBUG/NOOPTIMIZE/LIST/SHOW=ALL"
$ else
$ debug = "N"
$ cc_command = "CC''cc_opts'"
$ endif
$!
$!- configure multiple build passes for each library. -------------------------
$!
$! For each pass:
$!
$! "libname" is the name of the library or module being created
$!
$! "progname" is the name of the program being created
$!
$! "src" is the list of sources to be built into the library or program
$! - This should be compared to the definition of
$! "<NAME>_la_SOURCES" in the MAKEFILE.IN file in
$! corresponding directory.
$!
$ num_passes = 3 ! two libraries and a program
$!
$!- pass 1 - library LIBXSLT
$!
$ libname_1 = "LIBXSLT"
$ h_file_1 = "xslt.h"
$ progname_1 = ""
$!
$ ! see "libxslt_la_SOURCES" in [.libxslt]makefile.in
$ src_1 = "xslt.c xsltutils.c pattern.c templates.c variables.c keys.c"
$ src_1 = src_1 + " numbers.c extensions.c extra.c functions.c"
$ src_1 = src_1 + " namespaces.c imports.c attributes.c documents.c"
$ src_1 = src_1 + " preproc.c transform.c security.c"
$!
$!- pass 2 - library LIBEXSLT
$!
$ libname_2 = "LIBEXSLT"
$ h_file_2 = "exslt.h"
$ progname_2 = ""
$!
$ ! see "libexslt_la_SOURCES" in [.libexslt]makefile.in
$ src_2 = "exslt.c common.c math.c sets.c functions.c strings.c date.c saxon.c dynamic.c"
$!
$!- pass 3 - program XSLTPROC
$!
$ libname_3 = ""
$ h_file_3 = ""
$ progname_3 = "XSLTPROC"
$!
$ ! see "xsltproc_SOURCES" in [.xsltproc]makefile.in
$ src_3 = "xsltproc.c"
$!
$!- set up and check logicals -----------------------------------------------
$!
$! XML_LIBDIR - object library directory
$! XML_SRCDIR - top-level build directory of libxml package -- needed for config.h and trio.h
$! LIBXML - source directory containing .h files for libxml package
$!
$ if f$trnlnm("XML_LIBDIR").eqs.""
$ then
$ on error then continue
$ globfile = f$search("[--...]libxml.olb")
$ if globfile.eqs.""
$ then
$ write sys$output ""
$ write sys$output " You need to define the XML_LIBDIR logical name to"
$ write sys$output " point to the directory containing your object"
$ write sys$output " libraries. This should already contain LIBXML.OLB"
$ write sys$output " from the libxml package, and will be the directory"
$ write sys$output " the new LIBXSLT.OLB library will be placed in"
$ write sys$output ""
$ exit
$ else
$ srcdir = f$parse(globfile,,,"DEVICE") + f$parse(globfile,,,"DIRECTORY")
$ define/process XML_LIBDIR "''srcdir'"
$ write sys$output "Defining XML_LIBDIR as ""''srcdir'"""
$ endif
$ endif
$!
$ if f$trnlnm("libxml").eqs.""
$ then
$ ! look for globals.h in a directory installed paralle to this one
$ on error then continue
$ globfile = f$search("[--...]globals.h")
$ if globfile.eqs.""
$ then
$ write sys$output ""
$ write sys$output " You need to define a LIBXML logical directory to"
$ write sys$output " point to the directory containing the .h files"
$ write sys$output " for the libxml package"
$ write sys$output ""
$ exit
$ else
$ srcdir = f$element(0,"]",globfile)+ "]"
$ define/process LIBXML "''srcdir'"
$ write sys$output "Defining LIBXML as ""''srcdir'"""
$ endif
$ endif
$!
$ if f$trnlnm("XML_SRCDIR").eqs.""
$ then
$ globfile = f$search("[--...]globals.c")
$ if globfile.eqs.""
$ then
$ write sys$output "Can't locate globals.c. You need to manually define a XML_SRCDIR logical"
$ exit
$ else
$ srcdir = f$parse(globfile,,,"DEVICE") + f$parse(globfile,,,"DIRECTORY")
$ define/process XML_SRCDIR "''srcdir'"
$ write sys$output "Defining XML_SRCDIR as ""''srcdir'"""
$ endif
$ endif
$!
$!- set up some working logicals -------------------
$!
$ pass_no = 1
$ set_pass_logical:
$!
$ if pass_no.le.num_passes
$ then
$!
$ Libname = libname_'pass_no'
$ progname = progname_'pass_no'
$ if libname.nes.""
$ then
$ logname = "''libname'_SRCDIR"
$ else
$ logname = "''progname'_SRCDIR"
$ endif
$ findfile = f$element(0," ",src_'pass_no')
$!
$!--- set up a source directory logical
$!
$ if f$trnlnm("''logname'").eqs.""
$ then
$ ! look for the target file in a parallel subdirectory
$ globfile = f$search("[-...]''findfile'")
$ if globfile.eqs.""
$ then
$ write sys$output "Can't locate ''findfile'. You need to manually define a ''logname' logical"
$ exit
$ else
$ srcdir = f$element(0,"]",globfile)+ "]"
$ define/process 'logname' "''srcdir'"
$ write sys$output "Defining ''logname' as ""''srcdir'"""
$ endif
$ endif
$!
$!--- if it's a library, set up a logical pointing to the .h files
$!
$ if libname.nes.""
$ then
$ if f$trnlnm("''libname'").eqs.""
$ then
$ ! look for the target .h file in a parallel subdirectory
$ h_file = h_file_'pass_no'
$ globfile = f$search("[-...]''h_file'")
$ if globfile.eqs.""
$ then
$ write sys$output "Can't locate ''h_file'. You need to manually define a ''libname' logical"
$ exit
$ else
$ includedir = f$element(0,"]",globfile)+ "]"
$ define/process 'libname' "''includedir'"
$ write sys$output "Defining ''libname' as ""''includedir'"""
$ endif
$ endif
$ endif
$!
$ pass_no = pass_no +1
$ goto set_pass_logical
$!
$ endif ! for each pass
$!
$!- set up error handling (such as it is) -------------------------------------
$!
$ exit_status = 1
$ saved_default = f$environment("default")
$ on error then goto ERROR_OUT
$ on control_y then goto ERROR_OUT
$!
$ goto start_here
$ start_here: ! move this line to debug/rerun parts of this command file
$!
$!- compile modules into the library ------------------------------------------
$!
$!
$ pass_no = 1 ! make three passes, one for each library, one for XSLTPROC
$ pass_loop:
$!
$ if pass_no.le.num_passes
$ then
$ Libname = libname_'pass_no'
$ progname = progname_'pass_no'
$ if libname.nes.""
$ then
$ logname = "''libname'_SRCDIR"
$ pass_description = "the XML_LIBDIR:''libname'.OLB object library"
$ else
$ logname = "''progname'_SRCDIR"
$ pass_description = "the programs in ''progname'"
$ endif
$ src = src_'pass_no'
$!
$!- create the library if need
$!
$ if libname.nes.""
$ then
$ if f$search("XML_LIBDIR:''libname'.OLB").eqs.""
$ then
$ write sys$output "Creating new object library XML_LIBDIR:''libname'.OLB..."
$ library/create XML_LIBDIR:'libname'.OLB
$ endif
$ endif
$!
$!- move to the source directory
$!
$ set def 'logname'
$!
$!- define the library and link commands (link command not used as is)
$!
$ if libname.nes.""
$ then
$ lib_command = "LIBRARY/REPLACE XML_LIBDIR:''libname'.OLB"
$ link_command = ""
$ else
$ lib_command = ""
$ link_command = "LINK"
$ endif
$!
$ write sys$output ""
$ write sys$output "Building ''pass_description'
$ write sys$output ""
$!
$ s_no = 0
$ src = f$edit(src,"COMPRESS")
$!
$ source_loop:
$!
$ next_source = f$element (S_no," ",src)
$ if next_source.nes."" .and. next_source.nes." "
$ then
$ call build 'next_source'
$ s_no = s_no + 1
$ goto source_loop
$ endif
$!
$ pass_no = pass_no + 1
$ goto pass_loop
$!
$ endif ! for each pass
$!
$!- Th-th-th-th-th-that's all folks! ------------------------------------------
$!
$EXIT_OUT:
$!
$ set def 'saved_default
$ exit 'exit_status
$!
$
$ERROR_OUT:
$ exit_status = $status
$ write sys$output "''f$message(exit_status)'"
$ goto EXIT_OUT
$!
$!- the BUILD subroutine. Compile then insert into library or link as required
$!
$BUILD: subroutine
$ on warning then goto EXIT_BUILD
$ source_file = p1
$ name = f$element(0,".",source_file)
$ object_file = f$fao("XML_LIBDIR:!AS.OBJ",name)
$!
$!- compile
$ write sys$output "Compiling ",p1,p2,"..."
$ cc_command /object='object_file 'source_file' 'p2'
$!
$!- insert into library if command defined
$!
$ if lib_command.nes.""
$ then
$ lib_command 'object_file'
$ delete/nolog 'object_file';*
$ endif
$!
$!- link module if command defined
$!
$ if link_command.nes.""
$ then
$ text = f$element(0,".",p1) ! lose the ".c"
$ write sys$output "Linking ",text,"..."
$ dbgopts = ""
$ if debug then dbgopts = "/DEBUG"
$ link_command'dbgopts' 'object_file',-
XML_LIBDIR:libexslt/lib,-
XML_LIBDIR:libxslt/lib,-
XML_LIBDIR:libxml/library
$ endif
$!
$EXIT_BUILD:
$ exit $status
$!
$endsubroutine

View File

@@ -0,0 +1,10 @@
$! Compiling with VAXC is said to work, but it requires the usual cruft
$! (vaxcrtl and all), and to avoid hair we don't supply said cruft here.
$ CC/DECC/PREFIX=all VMSBACKUP.C/DEFINE=(HAVE_MT_IOCTLS=0,HAVE_UNIXIO_H=1)
$ CC/DECC/PREFIX=all DCLMAIN.C
$! Probably we don't want match as it probably doesn't implement VMS-style
$! matching, but I haven't looking into the issues yet.
$ CC/DECC/PREFIX=all match
$ LINK/exe=VMSBACKUP.EXE -
vmsbackup.obj,dclmain.obj,match.obj,sys$input/opt
identification="VMSBACKUP4.1.1"

23
samples/DTrace/counts.d Normal file
View File

@@ -0,0 +1,23 @@
/*
* This software is in the public domain.
*
* $Id: counts.d 10510 2005-08-15 01:46:19Z kateturner $
*/
#pragma D option quiet
self int tottime;
BEGIN {
tottime = timestamp;
}
php$target:::function-entry
@counts[copyinstr(arg0)] = count();
}
END {
printf("Total time: %dus\n", (timestamp - tottime) / 1000);
printf("# calls by function:\n");
printa("%-40s %@d\n", @counts);
}

View File

@@ -0,0 +1,73 @@
/* -*- Mode: dtrace-script; tab-width: 2; indent-tabs-mode: nil; c-basic-offset: 2 -*- */
/* ***** BEGIN LICENSE BLOCK *****
* Version: MPL 1.1/GPL 2.0/LGPL 2.1
*
* The contents of this file are subject to the Mozilla Public License Version
* 1.1 (the "License"); you may not use this file except in compliance with
* the License. You may obtain a copy of the License at
* http://www.mozilla.org/MPL/
*
* Software distributed under the License is distributed on an "AS IS" basis,
* WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
* for the specific language governing rights and limitations under the
* License.
*
* Copyright (C) 2007 Sun Microsystems, Inc. All Rights Reserved.
*
* Alternatively, the contents of this file may be used under the terms of
* either the GNU General Public License Version 2 or later (the "GPL"), or
* the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
* in which case the provisions of the GPL or the LGPL are applicable instead
* of those above. If you wish to allow use of your version of this file only
* under the terms of either the GPL or the LGPL, and not to allow others to
* use your version of this file under the terms of the MPL, indicate your
* decision by deleting the provisions above and replace them with the notice
* and other provisions required by the GPL or the LGPL. If you do not delete
* the provisions above, a recipient may use your version of this file under
* the terms of any one of the MPL, the GPL or the LGPL.
*
* ***** END LICENSE BLOCK ***** */
/*
* javascript provider probes
*
* function-entry (filename, classname, funcname)
* function-info (filename, classname, funcname, lineno,
* runfilename, runlineno)
* function-args (filename, classname, funcname, argc, argv, argv0,
* argv1, argv2, argv3, argv4)
* function-rval (filename, classname, funcname, lineno, rval, rval0)
* function-return (filename, classname, funcname)
* object-create-start (filename, classname)
* object-create (filename, classname, *object, rlineno)
* object-create-done (filename, classname)
* object-finalize (NULL, classname, *object)
* execute-start (filename, lineno)
* execute-done (filename, lineno)
*/
provider javascript {
probe function__entry(char *, char *, char *);
probe function__info(char *, char *, char *, int, char *, int);
probe function__args(char *, char *, char *, int, void *, void *, void *,
void *, void *, void *);
probe function__rval(char *, char *, char *, int, void *, void *);
probe function__return(char *, char *, char *);
probe object__create__start(char *, char *);
probe object__create__done(char *, char *);
/* XXX must use unsigned longs here instead of uintptr_t for OS X
(Apple radar: 5194316 & 5565198) */
probe object__create(char *, char *, unsigned long, int);
probe object__finalize(char *, char *, unsigned long);
probe execute__start(char *, int);
probe execute__done(char *, int);
};
/*
#pragma D attributes Unstable/Unstable/Common provider mozilla provider
#pragma D attributes Private/Private/Unknown provider mozilla module
#pragma D attributes Private/Private/Unknown provider mozilla function
#pragma D attributes Unstable/Unstable/Common provider mozilla name
#pragma D attributes Unstable/Unstable/Common provider mozilla args
*/

93
samples/DTrace/probes.d Normal file
View File

@@ -0,0 +1,93 @@
/* ----------
* DTrace probes for PostgreSQL backend
*
* Copyright (c) 2006-2009, PostgreSQL Global Development Group
*
* $PostgreSQL: pgsql/src/backend/utils/probes.d,v 1.11 2009/04/02 20:59:10 momjian Exp $
* ----------
*/
/*
* Typedefs used in PostgreSQL.
*
* NOTE: Do not use system-provided typedefs (e.g. uintptr_t, uint32_t, etc)
* in probe definitions, as they cause compilation errors on Mac OS X 10.5.
*/
#define LocalTransactionId unsigned int
#define LWLockId int
#define LWLockMode int
#define LOCKMODE int
#define BlockNumber unsigned int
#define Oid unsigned int
#define ForkNumber int
#define bool char
provider postgresql {
probe transaction__start(LocalTransactionId);
probe transaction__commit(LocalTransactionId);
probe transaction__abort(LocalTransactionId);
probe lwlock__acquire(LWLockId, LWLockMode);
probe lwlock__release(LWLockId);
probe lwlock__wait__start(LWLockId, LWLockMode);
probe lwlock__wait__done(LWLockId, LWLockMode);
probe lwlock__condacquire(LWLockId, LWLockMode);
probe lwlock__condacquire__fail(LWLockId, LWLockMode);
probe lock__wait__start(unsigned int, unsigned int, unsigned int, unsigned int, unsigned int, LOCKMODE);
probe lock__wait__done(unsigned int, unsigned int, unsigned int, unsigned int, unsigned int, LOCKMODE);
probe query__parse__start(const char *);
probe query__parse__done(const char *);
probe query__rewrite__start(const char *);
probe query__rewrite__done(const char *);
probe query__plan__start();
probe query__plan__done();
probe query__execute__start();
probe query__execute__done();
probe query__start(const char *);
probe query__done(const char *);
probe statement__status(const char *);
probe sort__start(int, bool, int, int, bool);
probe sort__done(bool, long);
probe buffer__read__start(ForkNumber, BlockNumber, Oid, Oid, Oid, bool, bool);
probe buffer__read__done(ForkNumber, BlockNumber, Oid, Oid, Oid, bool, bool, bool);
probe buffer__flush__start(ForkNumber, BlockNumber, Oid, Oid, Oid);
probe buffer__flush__done(ForkNumber, BlockNumber, Oid, Oid, Oid);
probe buffer__checkpoint__start(int);
probe buffer__checkpoint__sync__start();
probe buffer__checkpoint__done();
probe buffer__sync__start(int, int);
probe buffer__sync__written(int);
probe buffer__sync__done(int, int, int);
probe buffer__write__dirty__start(ForkNumber, BlockNumber, Oid, Oid, Oid);
probe buffer__write__dirty__done(ForkNumber, BlockNumber, Oid, Oid, Oid);
probe deadlock__found();
probe checkpoint__start(int);
probe checkpoint__done(int, int, int, int, int);
probe clog__checkpoint__start(bool);
probe clog__checkpoint__done(bool);
probe subtrans__checkpoint__start(bool);
probe subtrans__checkpoint__done(bool);
probe multixact__checkpoint__start(bool);
probe multixact__checkpoint__done(bool);
probe twophase__checkpoint__start();
probe twophase__checkpoint__done();
probe smgr__md__read__start(ForkNumber, BlockNumber, Oid, Oid, Oid);
probe smgr__md__read__done(ForkNumber, BlockNumber, Oid, Oid, Oid, int, int);
probe smgr__md__write__start(ForkNumber, BlockNumber, Oid, Oid, Oid);
probe smgr__md__write__done(ForkNumber, BlockNumber, Oid, Oid, Oid, int, int);
probe xlog__insert(unsigned char, unsigned char);
probe xlog__switch();
probe wal__buffer__write__dirty__start();
probe wal__buffer__write__dirty__done();
};

View File

@@ -0,0 +1,44 @@
note
description : "nino application root class"
date : "$Date$"
revision : "$Revision$"
class
APPLICATION
inherit
ARGUMENTS
HTTP_SERVER_SHARED_CONFIGURATION
create
make
feature {NONE} -- Initialization
make
-- Run application.
local
l_server : HTTP_SERVER
l_cfg: HTTP_SERVER_CONFIGURATION
l_http_handler : HTTP_HANDLER
do
create l_cfg.make
l_cfg.http_server_port := 9_000
l_cfg.document_root := default_document_root
set_server_configuration (l_cfg)
debug ("nino")
l_cfg.set_is_verbose (True)
end
create l_server.make (l_cfg)
create {APPLICATION_CONNECTION_HANDLER} l_http_handler.make (l_server)
l_server.setup (l_http_handler)
end
feature -- Access
default_document_root: STRING = "webroot"
end

View File

@@ -0,0 +1,82 @@
class
BOOK_COLLECTION
create
make
feature {NONE} -- Initialization
make (a_name: STRING_32)
-- Create a book collection with `a_name' as `name'.
do
set_name (a_name)
create book_index.make (10)
ensure
name_set: name = a_name
end
feature -- Access
name: STRING_32
-- Name.
books: LIST [BOOK]
-- collection of book.
do
create {LINKED_LIST [BOOK]} Result.make
across
book_index as it
loop
Result.append (it.item)
end
end
books_by_author (a_author: STRING_32): LIST [BOOK]
-- Books wrote by `a_author' in this collection.
do
if attached book_index [a_author] as l_result then
Result := l_result
else
create {LINKED_LIST [BOOK]} Result.make
end
end
feature -- Change
set_name (a_name: STRING_32)
-- Set `name' with `a_name'.
do
name := a_name
ensure
name_set: name = a_name
end
add_book (a_book: BOOK)
-- Extend collection with `a_book'.
local
l: detachable LIST [BOOK]
do
l := book_index.at (a_book.author.name)
if l = Void then
create {LINKED_LIST [BOOK]} l.make
book_index.put (l, a_book.author.name)
end
l.force (a_book)
end
add_books (book_list: like books)
-- Append collection with `book_list'.
do
across
book_list as it
loop
add_book (it.item)
end
end
feature {NONE} -- Implementation
book_index: HASH_TABLE [LIST [BOOK], STRING_32]
-- Association of author name and its books.
end -- class BOOK_COLLECTION

View File

@@ -0,0 +1,41 @@
note
description: "Git checkout command."
author: "Olivier Ligot"
class
GIT_CHECKOUT_COMMAND
inherit
GIT_COMMAND
create
make,
make_master
feature {NONE} -- Initialization
make (a_branch: STRING)
-- Checkout the branch `a_branch'.
do
initialize
arguments.force_last (a_branch)
branch := a_branch
ensure
branch_set: branch = a_branch
end
make_master
-- Checkout the master branch.
do
make ("master")
end
feature -- Access
branch: STRING
-- Branch to checkout
name: STRING = "checkout"
-- Git subcommand name
end

View File

@@ -0,0 +1,10 @@
%{"cowboy": {:hex, :cowboy, "1.0.0"},
"cowlib": {:hex, :cowlib, "1.0.1"},
"hackney": {:hex, :hackney, "0.14.3"},
"hound": {:hex, :hound, "0.6.0"},
"httpoison": {:hex, :httpoison, "0.5.0"},
"idna": {:hex, :idna, "1.0.1"},
"phoenix": {:hex, :phoenix, "0.10.0"},
"plug": {:hex, :plug, "0.11.1"},
"poison": {:hex, :poison, "1.3.1"},
"ranch": {:hex, :ranch, "1.0.0"}}

View File

@@ -0,0 +1,260 @@
%% -*- mode: erlang;erlang-indent-level: 4;indent-tabs-mode: nil -*-
%% ex: ts=4 sw=4 ft=erlang et
%% This is a sample rebar.conf file that shows examples of some of rebar's
%% options.
%% == Core ==
%% Extend list of always recursive commands
{recursive_cmds, []}.
%% Check required ERTS or OTP release version
{require_erts_vsn, ".*"}.
{require_otp_vsn, ".*"}.
{require_min_otp_vsn, ".*"}.
%% Additional library directories to add to the code path
{lib_dirs, []}.
%% == Erlang Compiler ==
%% Erlang files to compile before the rest. Rebar automatically compiles
%% parse_transforms and custom behaviours before anything other than the files
%% in this list.
{erl_first_files, ["src/mymib1.erl", "src/mymib2.erl"]}.
%% Erlang compiler options
{erl_opts, [no_debug_info,
{i, "myinclude"},
{src_dirs, ["src", "src2", "src3"]},
{platform_define,
"(linux|solaris|freebsd|darwin)", 'HAVE_SENDFILE'},
{platform_define, "(linux|freebsd)", 'BACKLOG', 128},
{platform_define, "R13", 'old_inets'}]}.
%% MIB Options?
{mib_opts, []}.
%% SNMP mibs to compile first?
{mib_first_files, []}.
%% leex options
{xrl_opts, []}.
%% leex files to compile first
{xrl_first_files, []}.
%% yecc options
{yrl_opts, []}.
%% yecc files to compile first
{yrl_first_files, []}.
%% == EDoc ==
%% EDoc options
{edoc_opts, []}.
%% == Port Compiler ==
%% Port compilation environment variables. See rebar_port_compiler.erl for
%% more info. Default is `[]'
{port_env, [{"CFLAGS", "$CFLAGS -Ifoo"},
{"freebsd", "LDFLAGS", "$LDFLAGS -lfoo"}]}.
%% port_specs
%% List of filenames or wildcards to be compiled. May also contain a tuple
%% consisting of a regular expression to be applied against the system
%% architecture as a filter.
{port_specs, [{"priv/so_name.so", ["c_src/*.c"]},
{"linux", "priv/hello_linux", ["c_src/hello_linux.c"]},
{"linux", "priv/hello_linux", ["c_src/*.c"], [{env, []}]}]}.
%% == escriptize ==
{escript_name, "application"}.
{escript_incl_apps, []}.
{escript_shebang, "#!/usr/bin/env escript\n"}.
{escript_comment, "%%\n"}.
{escript_emu_args, "%%! -pa application/application/ebin\n"}.
%% == LFE Compiler ==
%% LFE files to compile before the rest
{lfe_first_files, []}.
%% Options for the LFE compiler: reuse {erl_opts, []}
%% == ErlyDTL Compiler ==
%% Options for the ErlyDTL compiler
{erlydtl_opts, []}.
%% == Proto compiler ==
{proto_opts, [
{compiler, protobuffs},
{src_dirs, ["src"]}
]}.
%% Available compilers for protocol buffer files (*.proto):
%% protobuffs (default)
%% gpb
%% Optional src_dirs which is a list of directories where
%% to look for .proto files, default is src
%% Options for the gpb protocol buffer compiler,
%% if selected by the proto_compiler option
{gpb_opts, []}.
%% == EUnit ==
%% Options for eunit:test()
{eunit_opts, []}.
%% Additional compile options for eunit. erl_opts is also used
{eunit_compile_opts, []}.
%% Same as erl_first_files, but used only when running 'eunit'
{eunit_first_files, []}.
%% == Cover ==
%% Whether to enable coverage reporting. Default is `false'
{cover_enabled, false}.
%% Whether to print coverage report to console. Default is `false'
{cover_print_enabled, false}.
%% Whether to export coverage report to file. Default is `false'
{cover_export_enabled, false}.
%% == Common Test ==
%% Override the default "test" directory in which SUITEs are located
{ct_dir, "itest"}.
%% Override the default "logs" directory in which SUITEs are logged
{ct_log_dir, "test/logs"}.
%% Option to pass extra parameters when launching Common Test
{ct_extra_params, "-boot start_sasl -s myapp"}.
%% Option to use short names (i.e., -sname test) when starting ct
{ct_use_short_names, true}.
%% == QuickCheck ==
%% If qc_mod is unspecified, rebar tries to detect Triq or EQC
{qc_opts, [{qc_mod, module()}, Options]}.
%% Additional compile options for qc. erl_opts is also used
{qc_compile_opts, []}.
%% Same as erl_first_files, but used only when running 'qc'
{qc_first_files, []}.
%% == Cleanup ==
%% Which files to cleanup
{clean_files, ["file", "file2"]}.
%% == OTP Applications ==
%% Enable validation of the OTP app module list. Default is 'true'
{validate_app_modules, true}.
%% == Dependencies ==
%% Where to put any downloaded dependencies. Default is "deps"
{deps_dir, "deps"}.
%% What dependencies we have, dependencies can be of 3 forms, an application
%% name as an atom, eg. mochiweb, a name and a version (from the .app file), or
%% an application name, a version and the SCM details on how to fetch it (SCM
%% type, location and revision).
%% Rebar currently supports git, hg, bzr, svn, rsync, fossil, and p4.
{deps, [app_name,
{rebar, "1.0.*"},
{rebar, ".*",
{git, "git://github.com/rebar/rebar.git"}},
{rebar, ".*",
{git, "git://github.com/rebar/rebar.git", "Rev"}},
{rebar, "1.0.*",
{git, "git://github.com/rebar/rebar.git", {branch, "master"}}},
{rebar, "1.0.0",
{git, "git://github.com/rebar/rebar.git", {tag, "1.0.0"}}},
%% Dependencies can be marked as 'raw'. Rebar does not require
%% such dependencies to have a standard Erlang/OTP layout
%% which assumes the presence of either
%% "src/dependency_name.app.src" or "ebin/dependency_name.app"
%% files.
%%
%% 'raw' dependencies can still contain 'rebar.config' and
%% even can have the proper OTP directory layout, but they
%% won't be compiled.
%%
%% Only a subset of rebar commands will be executed on the
%% 'raw' subdirectories: get-deps, update-deps, check-deps,
%% list-deps and delete-deps.
{rebar, "",
{git, "git://github.com/rebar/rebar.git", {branch, "master"}},
[raw]},
{app_name, ".*", {hg, "https://www.example.org/url"}},
{app_name, ".*", {rsync, "Url"}},
{app_name, ".*", {svn, "https://www.example.org/url"}},
{app_name, ".*", {svn, "svn://svn.example.org/url"}},
{app_name, ".*", {bzr, "https://www.example.org/url", "Rev"}},
{app_name, ".*", {fossil, "https://www.example.org/url"}},
{app_name, ".*", {fossil, "https://www.example.org/url", "Vsn"}},
{app_name, ".*", {p4, "//depot/subdir/app_dir"}}]}.
%% == Subdirectories ==
%% Subdirectories?
{sub_dirs, ["dir1", "dir2"]}.
%% == Plugins ==
%% Plugins you wish to include.
%% These can include any module on the code path, including deps.
%% Alternatively, plugins can be placed as source files in the plugin_dir, in
%% which case they will be compiled and loaded dynamically at runtime.
{plugins, [plugin1, plugin2]}.
%% Override the directory in which plugin sources can be found.
%% Defaults to ./plugins
{plugin_dir, "some_other_directory"}.
%% == Pre/Post Command Hooks ==
{pre_hooks, [{clean, "./prepare_package_files.sh"},
{"linux", compile, "c_src/build_linux.sh"},
{compile, "escript generate_headers"},
{compile, "escript check_headers"}]}.
{post_hooks, [{clean, "touch file1.out"},
{"freebsd", compile, "c_src/freebsd_tweaks.sh"},
{eunit, "touch file2.out"},
{compile, "touch postcompile.out"}]}.
%% == xref ==
{xref_warnings, false}.
%% optional extra paths to include in xref:set_library_path/2.
%% specified relative location of rebar.config.
%% e.g. {xref_extra_paths,["../gtknode/src"]}
{xref_extra_paths,[]}.
%% xref checks to run
{xref_checks, [undefined_function_calls, undefined_functions,
locals_not_used, exports_not_used,
deprecated_function_calls, deprecated_functions]}.
%% Optional custom xref queries (xref manual has details) specified as
%% {xref_queries, [{query_string(), expected_query_result()},...]}
%% The following for example removes all references to mod:*foo/4
%% functions from undefined external function calls as those are in a
%% generated module
{xref_queries,
[{"(XC - UC) || (XU - X - B"
" - (\"mod\":\".*foo\"/\"4\"))",[]}]}.

View File

@@ -0,0 +1,158 @@
%% THIS FILE IS GENERATED. DO NOT EDIT IT MANUALLY %%
{sub_dirs,["rel","apps/riak"]}.
{require_otp_vsn,"R16|17"}.
{cover_enabled,true}.
{lib_dirs,["apps/riak"]}.
{erl_opts,[debug_info,fail_on_warning]}.
{eunit_opts,[verbose]}.
{erlydtl_opts,[{compiler_options,[report,return,debug_info]}]}.
{deps,[{rebar_lock_deps_plugin,".*",
{git,"git://github.com/seth/rebar_lock_deps_plugin.git",
"7a5835029c42b8138325405237ea7e8516a84800"}},
{node_package,".*",
{git,"git://github.com/basho/node_package.git",
"a829631eccebe3c1d7657a0075584f55bf342977"}},
{goldrush,".*",
{git,"git://github.com/DeadZen/goldrush.git",
"71e63212f12c25827e0c1b4198d37d5d018a7fec"}},
{lager,".*",
{git,"git://github.com/basho/lager.git",
"b6b6cebcb27ccff8acc59ae775acebc2f52e4926"}},
{syslog,".*",
{git,"git://github.com/Vagabond/erlang-syslog.git",
"918c9b453e0811b24f2c99b35b712b0ef9f29c7e"}},
{lager_syslog,".*",
{git,"git://github.com/basho/lager_syslog.git",
"fa2e7e3daee0d0a59dadb820fd3381eac4a65770"}},
{cluster_info,".*",
{git,"git://github.com/basho/cluster_info.git",
"e231144ca32dc83317be3360a4a259c73826b08a"}},
{sidejob,".*",
{git,"git://github.com/basho/sidejob.git",
"c5aabba2d7daa80c340e110902bbcfcb552ccdcf"}},
{erlang_js,".*",
{git,"git://github.com/basho/erlang_js.git",
"07467d899ab90a2b719ad19ab0be0048c1c8d873"}},
{meck,".*",
{git,"git://github.com/basho/meck.git",
"dde759050eff19a1a80fd854d7375174b191665d"}},
{getopt,".*",
{git,"git://github.com/jcomellas/getopt.git",
"659a28f4145bc9843598972854299dc4ea77e4cb"}},
{neotoma,".*",
{git,"git://github.com/seancribbs/neotoma.git",
"760928ec8870da02eb11bccb501e2700925d06c6"}},
{cuttlefish,".*",
{git,"git://github.com/basho/cuttlefish.git",
"c92c8325aeaea6b6ba7516bbd434f8e408f87d60"}},
{bitcask,".*",
{git,"git://github.com/basho/bitcask.git",
"c74d0c43fdefdd435f7621ddf1fc2995b5bd123c"}},
{eper,".*",
{git,"git://github.com/basho/eper.git",
"7222ecaebceb5422e74a9c1503043bbc6036f6b7"}},
{edown,".*",
{git,"git://github.com/uwiger/edown.git",
"d62ec85281e451a46ba30045917c119d65b72a84"}},
{sext,".*",
{git,"git://github.com/basho/sext.git",
"846b9cc22456287a572efd4c924203d77778670f"}},
{poolboy,".*",
{git,"git://github.com/basho/poolboy.git",
"8bb45fbc715c5f493642a1cc572ec7017d0d5fa3"}},
{basho_stats,".*",
{git,"git://github.com/basho/basho_stats.git",
"19c532af235ae675439d491b329c55c2f9b02deb"}},
{riak_sysmon,".*",
{git,"git://github.com/basho/riak_sysmon.git",
"26a58bcaba96d07df885f7b3db4d4306f995ce14"}},
{eleveldb,".*",
{git,"git://github.com/basho/eleveldb.git",
"0e4e4e7cf3ddc26523a77f853ea9409c1707b26c"}},
{riak_ensemble,".*",
{git,"git://github.com/basho/riak_ensemble",
"78dc8f623353a212ca3cf12236d1e9ac824bde16"}},
{pbkdf2,".*",
{git,"git://github.com/basho/erlang-pbkdf2.git",
"7076584f5377e98600a7e2cb81980b2992fb2f71"}},
{parse_trans,".*",
{git,"git://github.com/uwiger/parse_trans.git",
"82cc00264aa1bad8fc5c0739b7541feb4a843432"}},
{bear,".*",
{git,"git://github.com/basho/bear.git",
"da820a13c607c3f816ee8b83c587266da5389761"}},
{folsom,".*",
{git,"git://github.com/basho/folsom.git",
"72944523b6467c9f7add5f1c96dd5020424a2681"}},
{setup,".*",
{git,"git://github.com/uwiger/setup.git",
"51ee7c9f64d2bbe9dcbb58c278e8fbfd4d0ca5e2"}},
{exometer_core,".*",
{git,"git://github.com/basho/exometer_core.git",
"b47a5d65d9500c2b8f6ccc50e34005503589ef77"}},
{clique,".*",
{git,"git://github.com/basho/clique.git",
"3af4db8ea0f74aca42f6713446dcd5915c795a74"}},
{riak_core,".*",
{git,"git://github.com/basho/riak_core.git",
"044c4e7f8dbfe8c49c45f2f7090adff4cd5aba50"}},
{riak_pipe,".*",
{git,"git://github.com/basho/riak_pipe.git",
"3c0abc7ba301d57940c5a9c5de368b70429c28ff"}},
{protobuffs,".*",
{git,"git://github.com/basho/erlang_protobuffs.git",
"f88fc3c6881687432ddd5546b3c7b08009dfb26f"}},
{riak_pb,".*",
{git,"git://github.com/basho/riak_pb.git",
"78c50efa698f33f7d6ab1c7f5fa4666ec03b46b4"}},
{mochiweb,".*",
{git,"git://github.com/basho/mochiweb.git",
"ade2a9b29a11034eb550c1d79b4f991bf5ca05ba"}},
{webmachine,".*",
{git,"git://github.com/basho/webmachine.git",
"7677c240f4a7ed020f4bab48278224966bb42311"}},
{riak_api,".*",
{git,"git://github.com/basho/riak_api.git",
"2781e66796903bc6847bffcf71a6ba7a05d69275"}},
{riak_dt,".*",
{git,"git://github.com/basho/riak_dt.git",
"f7981d4ad7407ddc085f133f204dd71bf9d50c56"}},
{eunit_formatters,".*",
{git,"git://github.com/seancribbs/eunit_formatters",
"96b6ced4d45ba641cbf2c8a8ae9b350dd300bc10"}},
{riak_kv,".*",
{git,"git://github.com/basho/riak_kv.git",
"404619cb57574cd43e2dc0dc0453884ec6732a99"}},
{merge_index,".*",
{git,"git://github.com/basho/merge_index.git",
"b701dde5c28956c3b629411e5ff7e50cbb5cb4b3"}},
{riak_search,".*",
{git,"git://github.com/basho/riak_search.git",
"8fe4a8c020a74c52ee877bf6dd410824b4f79f8b"}},
{erlydtl,".*",
{git,"git://github.com/evanmiller/erlydtl.git",
"d20b53f04837a1053ed18987f645cb60eae82453"}},
{riak_control,".*",
{git,"git://github.com/basho/riak_control.git",
"09073ce672260e1ec0ba3999fabed7f319624ba1"}},
{riaknostic,".*",
{git,"git://github.com/basho/riaknostic.git",
"101d95bddff4b70afcd1dd5442b8c6651887e0a4"}},
{kvc,".*",
{git,"git://github.com/etrepum/kvc.git",
"5565fe51857747662410cc3c06362ebcf48a2f04"}},
{ibrowse,".*",
{git,"git://github.com/cmullaparthi/ibrowse.git",
"e8ae353c16d4f0897abb9f80025b52925b974dd1"}},
{yokozuna,".*",
{git,"git://github.com/basho/yokozuna.git",
"5868266b11f131d14c85495e50f899f3fe8158ba"}},
{canola,".*",
{git,"git://github.com/basho/canola.git",
"9bdfee88fce20b3a01b7003696b53eb21913d6fb"}},
{riak_auth_mods,".*",
{git,"git://github.com/basho/riak_auth_mods.git",
"31b8b30e6c215418522eaa615264ae9769a87410"}}]}.
{plugins,[rebar_lock_deps_plugin]}.

View File

@@ -0,0 +1,16 @@
[{<<"goldrush">>,
{git,"git://github.com/DeadZen/goldrush.git",
{ref,"71e63212f12c25827e0c1b4198d37d5d018a7fec"}},
1},
{<<"riak_dt">>,
{git,"git://github.com/helium/riak_dt.git",
{ref,"15d66cb26c2028c1ad1271c359b1d5da213825c3"}},
0},
{<<"lager">>,
{git,"git://github.com/basho/lager.git",
{ref,"d33ccf3b69de09a628fe38b4d7981bb8671b8a4f"}},
0},
{<<"eleveldb">>,
{git,"git://github.com/helium/eleveldb.git",
{ref,"29a5360dc0365b3330dd0cd45b0b8166f3b854be"}},
0}].

View File

@@ -0,0 +1,35 @@
/*
* Copyright (C) 2012 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
#include "ip.rsh"
static rs_matrix4x4 Mat;
void init() {
rsMatrixLoadIdentity(&Mat);
}
void setMatrix(rs_matrix4x4 m) {
Mat = m;
}
uchar4 __attribute__((kernel)) root(uchar4 in) {
float4 f = convert_float4(in);
f = rsMatrixMultiply(&Mat, f);
f = clamp(f, 0.f, 255.f);
return convert_uchar4(f);
}

View File

@@ -0,0 +1,18 @@
#pragma version(1)
#pragma rs java_package_name(foo)
int __attribute__((kernel)) root(uint32_t ain) {
return 0;
}
void __attribute__((kernel)) in_only(uint32_t ain) {
}
int __attribute__((kernel)) out_only() {
return 0;
}
int __attribute__((kernel)) everything(uint32_t ain, uint32_t x, uint32_t y) {
return 0;
}

View File

@@ -0,0 +1,919 @@
ACCEPTABLE LEFT PRIMERS
1-based # self self hair- qual-
# sequence start ln N GC% Tm any_th end_th pin lity
0 tgctagctaggcgatgctag 411 20 0 55.00 60.028 23.16 23.16 38.59 0.028
1 actgatacgcgatgctagct 476 20 0 50.00 59.957 17.69 1.35 0.00 0.043
2 gatcgatgctagctaggcga 405 20 0 55.00 60.100 16.30 16.30 0.00 0.100
3 tcgatcgatgctagctaggc 403 20 0 55.00 60.100 18.63 8.45 0.00 0.100
4 tagctgatcgatcgtagcgg 565 20 0 55.00 60.101 25.02 17.36 0.00 0.101
5 gctgactgatcgatcgatgc 113 20 0 55.00 59.826 24.08 17.09 35.21 0.174
6 tatcatctctgcgcgatcga 361 20 0 50.00 59.747 22.07 1.72 38.48 0.253
7 agctaggcgatgctagctag 415 20 0 55.00 59.742 17.46 17.46 41.54 0.258
8 ctagctaggcgatgctagct 413 20 0 55.00 59.742 18.68 17.35 43.53 0.258
9 ggcgatctagctagctgact 583 20 0 55.00 59.671 17.44 7.44 37.58 0.329
10 tcgatgctagctaggcgatg 407 20 0 55.00 60.382 14.03 0.00 0.00 0.382
11 gctgatcgatcgatgctagc 398 20 0 55.00 59.618 25.97 24.79 35.21 0.382
12 gctagctgatcgatcgatgc 394 20 0 55.00 59.618 24.08 21.09 35.21 0.382
13 atcatctctgcgcgatcgat 362 20 0 50.00 60.382 22.07 5.02 38.48 0.382
14 gactgatacgcgatgctagc 475 20 0 55.00 59.551 8.61 8.61 0.00 0.449
15 atcgatgctagctaggcgat 406 20 0 50.00 59.452 18.43 18.43 0.00 0.548
16 gctagctgactgatacgcga 468 20 0 55.00 60.589 16.29 0.00 0.00 0.589
17 agctagctgactgatacgcg 467 20 0 55.00 60.590 17.99 3.89 0.00 0.590
18 atgctagctaggcgatgcta 410 20 0 50.00 59.375 10.59 8.91 0.00 0.625
19 ctatcatctctgcgcgatcg 360 20 0 55.00 59.347 12.19 12.19 39.07 0.653
20 gatgctagctaggcgatgct 409 20 0 55.00 60.668 7.01 7.53 0.00 0.668
21 gctactatcatctctgcgcg 356 20 0 55.00 59.273 0.00 0.00 0.00 0.727
22 cgtagcggcgatctagctag 577 20 0 60.00 60.791 15.64 15.64 37.58 0.791
23 cggcgatctagctagctgac 582 20 0 60.00 61.003 14.84 7.25 38.70 1.003
24 gctagctgatcgatcgtagc 563 20 0 55.00 58.995 23.70 23.70 0.00 1.005
25 gatcgatcgatgtgcggcta 81 20 0 55.00 61.006 19.16 0.00 41.65 1.006
26 atcgatcgatgtgcggctag 82 20 0 55.00 61.008 29.65 0.00 41.65 1.008
27 gctgactgatacgcgatgc 472 19 0 57.89 60.025 0.00 0.00 0.00 1.025
28 agctagctgatcatcgatgct 190 21 0 47.62 60.035 17.99 11.09 0.00 1.035
29 gctagctagctgactgatcga 105 21 0 52.38 60.037 34.38 0.00 46.11 1.037
30 tcatctctgcgcgatcgat 363 19 0 52.63 59.946 22.07 0.12 38.48 1.054
31 atcatctctgcgcgatcga 362 19 0 52.63 59.946 22.07 1.72 38.48 1.054
32 atcgatcgatgtgcggcta 82 19 0 52.63 59.945 29.65 0.00 41.65 1.055
33 gtagcggcgatctagctagc 578 20 0 60.00 61.071 16.97 7.15 39.86 1.071
34 gctagctgactgatcgatcg 109 20 0 55.00 58.924 16.84 13.89 0.00 1.076
35 gctgatcgatcgatgtgcg 78 19 0 57.89 60.097 29.87 18.15 42.69 1.097
36 tatcatctctgcgcgatcgat 361 21 0 47.62 60.172 22.07 11.47 38.48 1.172
37 gctagctagctgatcgatcga 390 21 0 52.38 60.172 34.38 22.52 46.11 1.172
38 gctagctagctgatcgatcga 70 21 0 52.38 60.172 34.38 22.52 46.11 1.172
39 catctctgcgcgatcgatg 364 19 0 57.89 59.810 13.74 13.74 38.48 1.190
40 tcgtagcggcgatctagcta 576 20 0 55.00 61.231 11.55 9.27 36.40 1.231
41 actgatacgcgatgctagcta 476 21 0 47.62 59.765 17.69 3.08 0.00 1.235
42 actgatcgatcgatgctagct 117 21 0 47.62 59.763 23.29 11.70 35.21 1.237
43 agctagctgatcgatcgatgt 73 21 0 47.62 59.763 17.99 2.62 35.21 1.237
44 tagcggcgatctagctagct 579 20 0 55.00 61.243 23.74 23.74 46.60 1.243
45 cgtagcggcgatctagcta 577 19 0 57.89 59.729 11.55 9.27 37.58 1.271
46 ctagctgatcgatcgtagcg 564 20 0 55.00 58.727 25.02 15.05 0.00 1.273
47 tagcggcgatctagctagc 579 19 0 57.89 59.725 16.97 9.14 39.86 1.275
48 catcgatcgatgcatgcatg 442 20 0 50.00 58.722 37.80 23.31 44.93 1.278
49 tcatctctgcgcgatcgatg 363 20 0 55.00 61.279 18.01 18.01 38.48 1.279
50 gctagctagctgatcgatcg 559 20 0 55.00 58.714 34.38 11.90 46.11 1.286
51 gctagctagctgatcgatcg 390 20 0 55.00 58.714 34.38 11.90 46.11 1.286
52 gctagctagctgatcgatcg 70 20 0 55.00 58.714 34.38 11.90 46.11 1.286
53 agcatcggattagctagctga 3 21 0 47.62 59.689 28.29 20.88 0.00 1.311
54 agctgatcgatcgtagcgg 566 19 0 57.89 60.315 25.02 17.36 0.00 1.315
55 cggcgatctagctagctga 582 19 0 57.89 59.650 21.57 16.66 38.70 1.350
56 ctagctgatcgatcgatgtgc 75 21 0 52.38 59.643 31.83 30.04 35.21 1.357
57 gctagctgatcgatcgatgtg 74 21 0 52.38 59.643 12.06 6.93 35.21 1.357
58 gctagctaggcgatgctagc 412 20 0 60.00 61.357 30.41 30.41 46.19 1.357
59 tagctagctgactgatacgcg 466 21 0 52.38 60.373 28.29 3.89 0.00 1.373
60 gctagctgactgatcgatcga 109 21 0 52.38 60.374 22.52 22.52 0.00 1.374
61 agctagctgactgatcgatcg 108 21 0 52.38 60.374 17.99 13.89 0.00 1.374
62 cgatcgatgctagctaggcg 404 20 0 60.00 61.409 15.59 9.14 0.00 1.409
63 gctagctagctgactgatcg 105 20 0 55.00 58.563 34.38 1.84 46.11 1.437
64 atgctagctaggcgatgct 410 19 0 52.63 59.561 10.59 7.53 0.00 1.439
65 agctagctgatcgatcgtagc 562 21 0 52.38 60.441 26.87 26.87 0.00 1.441
66 gctagctagctgatcgatcgt 559 21 0 52.38 60.441 34.38 2.65 46.11 1.441
67 tagctaggcgatgctagctag 414 21 0 52.38 59.559 18.42 17.46 42.44 1.441
68 ctagctaggcgatgctagcta 413 21 0 52.38 59.559 18.69 17.64 42.44 1.441
69 tagctgatcgatcgatgtgc 76 20 0 50.00 58.558 31.83 30.04 35.21 1.442
70 gatgctagctaggcgatgcta 409 21 0 52.38 60.444 9.82 8.91 0.00 1.444
71 atgctagctaggcgatgctag 410 21 0 52.38 60.444 23.16 23.16 38.59 1.444
72 gctagctgatcatcgatgct 191 20 0 50.00 58.539 16.29 12.14 0.00 1.461
73 agctagctgatcatcgatgc 190 20 0 50.00 58.539 21.42 9.22 0.00 1.461
74 gctgactgatacgcgatgct 472 20 0 55.00 61.494 2.33 0.00 0.00 1.494
75 agctgactgatacgcgatgc 471 20 0 55.00 61.494 3.47 0.00 0.00 1.494
76 ggcgatctagctagctgacta 583 21 0 52.38 59.491 17.44 5.40 37.58 1.509
77 gatcgatgctagctaggcgat 405 21 0 52.38 60.510 21.61 21.61 0.00 1.510
78 atcgatcgatgctagctaggc 402 21 0 52.38 60.510 29.65 8.45 33.56 1.510
79 ctgatcgatcgatgtgcgg 79 19 0 57.89 59.447 15.54 5.83 41.65 1.553
80 agctgatcgatcgatgtgcg 77 20 0 55.00 61.556 31.92 20.26 42.69 1.556
81 cgatcatcgatgctagctagc 548 21 0 52.38 59.444 34.89 34.89 46.99 1.556
82 tagctaggcgatgctagcta 414 20 0 50.00 58.433 19.37 17.81 42.44 1.567
83 agctagctactgatcgatgct 303 21 0 47.62 59.415 17.56 11.51 0.00 1.585
84 tcgatcgatgtgcggctag 83 19 0 57.89 60.606 18.63 0.00 41.65 1.606
85 gactgatcgatcgatgctagc 116 21 0 52.38 59.378 15.86 8.45 35.21 1.622
86 agctagctgactgatcgatca 260 21 0 47.62 59.347 26.99 26.99 35.44 1.653
87 ctgactgatacgcgatgctag 473 21 0 52.38 59.312 1.70 0.00 0.00 1.688
88 ctagctgactgatacgcgatg 469 21 0 52.38 59.312 0.00 0.00 0.00 1.688
89 gctactatcatctctgcgcga 356 21 0 52.38 60.707 2.71 2.71 0.00 1.707
90 agctactatcatctctgcgcg 355 21 0 52.38 60.709 0.00 0.00 0.00 1.709
91 actatcatctctgcgcgatc 359 20 0 50.00 58.270 4.99 0.00 0.00 1.730
92 actgatcgatcgatgctagc 117 20 0 50.00 58.270 23.29 13.61 35.21 1.730
93 gctagctgatcgatcgatgt 74 20 0 50.00 58.270 14.29 2.62 35.21 1.730
94 ctatcatctctgcgcgatcga 360 21 0 52.38 60.771 22.07 1.72 38.48 1.771
95 atcgatgctagctaggcgatg 406 21 0 52.38 60.779 21.16 4.37 0.00 1.779
96 tgactgatacgcgatgctag 474 20 0 50.00 58.207 1.70 0.00 0.00 1.793
97 ctgactgatacgcgatgcta 473 20 0 50.00 58.207 2.33 0.00 0.00 1.793
98 tagctgactgatacgcgatg 470 20 0 50.00 58.207 0.00 0.00 0.00 1.793
99 ctgactgatcgatcgatgct 114 20 0 50.00 58.197 26.44 12.40 35.21 1.803
100 agctgactgatcgatcgatg 112 20 0 50.00 58.197 23.05 13.21 35.21 1.803
101 tcggattagctagctgatgc 7 20 0 50.00 58.176 17.46 17.46 40.05 1.824
102 gcatcggattagctagctga 4 20 0 50.00 58.176 28.29 20.88 0.00 1.824
103 agcatcggattagctagctg 3 20 0 50.00 58.171 28.29 10.80 0.00 1.829
104 gatgctagctaggcgatgc 409 19 0 57.89 59.141 4.18 0.00 0.00 1.859
105 ctgatacgcgatgctagctag 477 21 0 52.38 59.113 17.46 17.46 0.00 1.887
106 gctagctgactgatacgcg 468 19 0 57.89 59.086 8.21 3.89 0.00 1.914
107 ctctgcgcgatcgatgctag 367 20 0 60.00 61.946 21.94 18.16 38.48 1.946
108 tctgcgcgatcgatgctag 368 19 0 57.89 60.966 21.94 18.16 38.48 1.966
109 ctctgcgcgatcgatgcta 367 19 0 57.89 60.966 26.61 17.10 38.48 1.966
110 cgatgctagctaggcgatgc 408 20 0 60.00 61.968 11.09 0.00 0.00 1.968
111 gactgatacgcgatgctagct 475 21 0 52.38 60.975 17.69 1.35 0.00 1.975
112 gctagctgactgatacgcgat 468 21 0 52.38 60.975 8.21 0.00 0.00 1.975
113 tgatacgcgatgctagctag 478 20 0 50.00 57.994 17.46 17.46 0.00 2.006
114 ctgatacgcgatgctagcta 477 20 0 50.00 57.994 17.69 3.08 0.00 2.006
115 cgcgatcgatgctagctagc 372 20 0 60.00 62.011 34.89 34.89 43.67 2.011
116 gcgcgatcgatgctagctag 371 20 0 60.00 62.011 21.66 17.46 38.48 2.011
117 ctgatcgatcgatgctagct 399 20 0 50.00 57.983 19.70 2.01 35.21 2.017
118 agctgatcgatcgatgctag 397 20 0 50.00 57.983 27.33 18.05 34.69 2.017
119 ctagctgatcgatcgatgct 395 20 0 50.00 57.983 33.87 33.38 38.16 2.017
120 agctagctgatcgatcgatg 393 20 0 50.00 57.983 21.99 11.03 35.21 2.017
121 ctgatcgatcgatgctagct 118 20 0 50.00 57.983 19.70 2.01 35.21 2.017
122 agctagctgatcgatcgatg 73 20 0 50.00 57.983 21.99 11.03 35.21 2.017
123 catcggattagctagctgatgc 5 22 0 50.00 59.982 24.41 24.41 40.05 2.018
124 gcatcggattagctagctgatg 4 22 0 50.00 59.982 27.81 27.81 33.28 2.018
125 tcgatgctagctaggcgat 407 19 0 52.63 58.964 14.03 3.01 0.00 2.036
126 atcgatgctagctaggcga 406 19 0 52.63 58.964 16.30 16.30 0.00 2.036
127 actatcatctctgcgcgatcg 359 21 0 52.38 61.037 12.19 12.19 39.07 2.037
128 gcgcgatcgatgctagcta 371 19 0 57.89 61.037 21.66 3.08 38.48 2.037
129 gctgatcgatcgatgctagct 398 21 0 52.38 61.044 27.88 12.70 35.21 2.044
130 agctgatcgatcgatgctagc 397 21 0 52.38 61.044 27.33 27.90 34.69 2.044
131 gctagctgatcgatcgatgct 394 21 0 52.38 61.044 33.87 33.38 38.16 2.044
132 agctagctgatcgatcgatgc 393 21 0 52.38 61.044 24.08 21.09 35.21 2.044
133 cgcgatcgatgctagctag 372 19 0 57.89 58.947 22.07 17.46 38.48 2.053
134 tcgtagcggcgatctagc 576 18 0 61.11 59.936 4.70 0.00 36.40 2.064
135 cgtagcggcgatctagct 577 18 0 61.11 59.935 11.03 11.03 37.58 2.065
136 gcggcgatctagctagct 581 18 0 61.11 59.933 23.74 23.74 38.05 2.067
137 agcggcgatctagctagc 580 18 0 61.11 59.933 16.97 7.15 39.86 2.067
138 ctagctgactgatacgcgat 469 20 0 50.00 57.918 1.43 0.00 0.00 2.082
139 ctagctgatcgatcgtagcgg 564 21 0 57.14 61.096 20.31 16.15 0.00 2.096
140 agctactatcatctctgcgc 355 20 0 50.00 57.898 0.00 0.00 0.00 2.102
141 gctagctactgatcgatgct 304 20 0 50.00 57.898 11.51 11.51 0.00 2.102
142 agctagctactgatcgatgc 303 20 0 50.00 57.898 17.56 1.76 0.00 2.102
143 agcatcggattagctagctgat 3 22 0 45.45 60.108 17.84 15.13 0.00 2.108
144 tgctagctaggcgatgcta 411 19 0 52.63 58.881 17.69 8.91 0.00 2.119
145 aagcatcggattagctagctg 2 21 0 47.62 58.879 28.29 10.80 0.00 2.121
146 tctgcgcgatcgatgcta 368 18 0 55.56 59.857 26.61 16.13 38.48 2.143
147 cgatgctagctaggcgatg 408 19 0 57.89 58.856 11.09 0.00 0.00 2.144
148 agctagctgatcatcgatgcta 190 22 0 45.45 59.845 17.99 13.09 0.00 2.155
149 tagctagctgatcatcgatgct 189 22 0 45.45 59.845 16.29 15.30 0.00 2.155
150 atcgatcgatgtgcggct 82 18 0 55.56 60.166 29.65 4.36 41.65 2.166
151 gctagctgactgatcgatca 261 20 0 50.00 57.829 26.99 26.99 35.44 2.171
152 tagctagctgactgatcgatcg 107 22 0 50.00 60.174 28.29 13.89 0.00 2.174
153 agctgatcatcatcgatgct 515 20 0 45.00 57.788 11.25 0.72 40.32 2.212
154 agctagctgactgatcgatcat 260 22 0 45.45 59.778 26.67 18.02 36.62 2.222
155 tgactgatacgcgatgctagc 474 21 0 52.38 61.238 8.61 8.61 0.00 2.238
156 gctgactgatacgcgatgcta 472 21 0 52.38 61.238 2.33 0.00 0.00 2.238
157 tagctgactgatacgcgatgc 470 21 0 52.38 61.238 3.47 0.00 0.00 2.238
158 tagctagctgatcgatcgtagc 561 22 0 50.00 60.238 26.87 26.87 0.00 2.238
159 gctagctagctgatcgatcgta 559 22 0 50.00 60.238 34.38 3.07 46.11 2.238
160 tgatcgatcgatgctagctagg 400 22 0 50.00 60.239 26.44 6.29 35.21 2.239
161 gctgactgatcgatcgatgct 113 21 0 52.38 61.244 26.44 12.40 35.21 2.244
162 agctgactgatcgatcgatgc 112 21 0 52.38 61.244 24.08 19.43 35.21 2.244
163 gatcgatcgatgtgcggct 81 19 0 57.89 61.263 19.16 0.00 41.65 2.263
164 gctgatcatcgatgctactagc 195 22 0 50.00 59.727 18.08 16.44 45.61 2.273
165 gctagctgatcatcgatgctac 191 22 0 50.00 59.727 9.57 5.47 0.00 2.273
166 gatcgatcgatgtgcggc 81 18 0 61.11 59.714 18.10 0.95 41.65 2.286
167 ctagctagctgactgatacgc 465 21 0 52.38 58.703 14.90 0.00 0.00 2.297
168 tagctgatcgatcgatgtgcg 76 21 0 52.38 61.299 31.92 20.26 42.69 2.299
169 agctgatcgatcgatgtgc 77 19 0 52.63 58.698 31.83 30.04 35.21 2.302
170 gctgatcatcatcgatgctagc 516 22 0 50.00 60.302 10.80 10.34 40.32 2.302
171 gctagctgatcatcatcgatgc 512 22 0 50.00 60.302 21.42 7.40 40.32 2.302
172 aagcatcggattagctagctga 2 22 0 45.45 60.306 28.29 20.88 0.00 2.306
173 gatcgatcgtagcggcga 570 18 0 61.11 60.318 13.01 8.51 45.59 2.318
174 atcggattagctagctgatgc 6 21 0 47.62 58.673 17.46 17.46 40.05 2.327
175 gcatcggattagctagctgat 4 21 0 47.62 58.673 17.84 15.13 0.00 2.327
176 gcggcgatctagctagctg 581 19 0 63.16 61.329 17.07 8.17 38.05 2.329
177 tgctagtgatgcatgctagt 24 20 0 45.00 57.636 24.96 11.17 35.89 2.364
178 ctactatcatctctgcgcga 357 20 0 50.00 57.636 2.71 2.71 0.00 2.364
179 actagctagctgactgatacgc 464 22 0 50.00 60.368 21.52 0.00 0.00 2.368
180 gctagctagctgatcatcga 187 20 0 50.00 57.613 34.38 0.24 46.11 2.387
181 tctctgcgcgatcgatgcta 366 20 0 55.00 62.413 26.61 17.10 38.48 2.413
182 tgatcgatcgatgctagctagt 119 22 0 45.45 59.586 26.44 5.69 35.21 2.414
183 actgatcgatcgatgctagcta 117 22 0 45.45 59.586 23.29 7.65 35.21 2.414
184 tagctagctgatcgatcgatgt 72 22 0 45.45 59.586 14.29 2.62 35.21 2.414
185 agctaggcgatgctagcta 415 19 0 52.63 58.572 17.69 3.08 41.54 2.428
186 tagctaggcgatgctagct 414 19 0 52.63 58.572 17.35 17.35 43.53 2.428
187 gatcgatcgatgctagctagg 401 21 0 52.38 58.567 23.89 6.29 35.21 2.433
188 gctagctagctgactgatcgat 105 22 0 50.00 60.434 34.38 0.00 46.11 2.434
189 gatcgatgctagctaggcg 405 19 0 57.89 58.563 15.59 9.02 0.00 2.437
190 cgatcgatgctagctaggc 404 19 0 57.89 58.563 14.87 8.45 0.00 2.437
191 tagctagctgactgatacgc 466 20 0 50.00 57.549 28.29 0.00 0.00 2.451
192 agctagctgactgatcgatc 260 20 0 50.00 57.536 19.32 19.32 0.00 2.464
193 agctagctgactgatcgatc 108 20 0 50.00 57.536 19.32 19.32 0.00 2.464
194 aaagcatcggattagctagctg 1 22 0 45.45 59.524 28.29 10.80 0.00 2.476
195 gctgactgatcgatcatcatgc 265 22 0 50.00 60.493 25.66 25.12 41.77 2.493
196 tagctactatcatctctgcgcg 354 22 0 50.00 60.495 0.00 0.00 0.00 2.495
197 ctgatcgatcgatgtgcggc 79 20 0 60.00 62.497 15.54 4.15 41.65 2.497
198 gctgatcgatcgatgtgcgg 78 20 0 60.00 62.497 29.87 22.23 41.65 2.497
199 tcgtagcggcgatctagct 576 19 0 57.89 61.503 11.03 11.03 36.40 2.503
200 agcggcgatctagctagct 580 19 0 57.89 61.519 23.74 23.74 42.96 2.519
201 ctagctagctgatcatcgatgc 188 22 0 50.00 59.470 21.42 9.22 0.00 2.530
202 gctagctagctgatcatcgatg 187 22 0 50.00 59.470 34.38 20.23 46.11 2.530
203 tcatctctgcgcgatcga 363 18 0 55.56 59.468 22.07 0.00 38.48 2.532
204 tcgatcgatgtgcggcta 83 18 0 55.56 59.465 18.63 0.00 41.65 2.535
205 tgatcgatcgatgtgcggc 80 19 0 57.89 61.549 21.27 8.44 41.65 2.549
206 ctagctaggcgatgctagctag 413 22 0 54.55 60.561 22.99 22.99 46.84 2.561
207 gctagctagctgatcgatcgat 390 22 0 50.00 60.561 34.38 30.53 46.11 2.561
208 gctagctagctgatcgatcgat 70 22 0 50.00 60.561 34.38 30.53 46.11 2.561
209 ctgcgcgatcgatgctag 369 18 0 61.11 59.415 19.79 13.97 38.48 2.585
210 aagcatcggattagctagct 2 20 0 45.00 57.413 23.74 23.74 0.00 2.587
211 gctagctgatcatcgatgcta 191 21 0 47.62 58.410 16.61 13.09 0.00 2.590
212 tagctagctgatcatcgatgc 189 21 0 47.62 58.410 21.42 9.22 0.00 2.590
213 actgatacgcgatgctagc 476 19 0 52.63 58.407 8.61 8.61 0.00 2.593
214 gctagctgactgatcgatcatc 261 22 0 50.00 59.406 23.93 21.92 36.62 2.594
215 atcgatcgatgctagctagg 402 20 0 50.00 57.396 29.65 6.29 33.56 2.604
216 atctctgcgcgatcgatgc 365 19 0 57.89 61.618 22.01 22.01 38.48 2.618
217 tgatcgatcgtagcggcg 569 18 0 61.11 60.621 20.58 0.86 0.00 2.621
218 atcatctctgcgcgatcgatg 362 21 0 52.38 61.633 18.01 18.01 38.48 2.633
219 agctagctgatcgatcgtag 562 20 0 50.00 57.344 17.99 16.86 0.00 2.656
220 ctagctagctgatcgatcgt 560 20 0 50.00 57.344 16.40 2.65 0.00 2.656
221 gctagctgactgatcgatcat 261 21 0 47.62 58.339 26.67 18.02 36.62 2.661
222 ctgatcgatcgtagcggcg 568 19 0 63.16 61.664 14.21 0.86 0.00 2.664
223 ctgactgatacgcgatgct 473 19 0 52.63 58.330 2.33 0.00 0.00 2.670
224 agctgactgatacgcgatg 471 19 0 52.63 58.330 0.00 0.00 0.00 2.670
225 gctagctgatcgatcgtagcg 563 21 0 57.14 61.676 24.18 16.49 0.00 2.676
226 ctagctgactgatcgatcga 110 20 0 50.00 57.276 22.52 22.52 0.00 2.724
227 agctagctactgatcgatgcta 303 22 0 45.45 59.252 17.56 12.23 0.00 2.748
228 tagctagctactgatcgatgct 302 22 0 45.45 59.252 27.80 11.51 0.00 2.748
229 gactgatacgcgatgctagcta 475 22 0 50.00 60.751 17.69 3.08 0.00 2.751
230 actgatacgcgatgctagctag 476 22 0 50.00 60.752 17.46 17.46 0.00 2.752
231 gactgatcgatcgatgctagct 116 22 0 50.00 60.753 18.04 9.56 35.21 2.753
232 gctagctgactgatcgatcgat 109 22 0 50.00 60.753 30.53 30.53 37.90 2.753
233 tgcgcgatcgatgctagcta 370 20 0 55.00 62.756 26.61 9.85 38.48 2.756
234 gcggcgatctagctagctga 581 20 0 60.00 62.765 21.57 16.66 38.70 2.765
235 agcggcgatctagctagctg 580 20 0 60.00 62.771 17.07 8.17 44.87 2.771
236 ctactatcatctctgcgcgatc 357 22 0 50.00 59.220 4.99 0.00 0.00 2.780
237 tatcatctctgcgcgatcg 361 19 0 52.63 58.199 12.19 12.19 39.07 2.801
238 tactatcatctctgcgcgatcg 358 22 0 50.00 60.811 12.19 12.19 39.07 2.811
239 tagctagctgactgatcgatca 259 22 0 45.45 59.187 28.29 26.99 35.44 2.813
240 gctgatcgatcgatgctagcta 398 22 0 50.00 60.816 27.88 12.57 35.21 2.816
241 tagctgatcgatcgatgctagc 396 22 0 50.00 60.816 30.84 27.90 36.80 2.816
242 gctagctgatcgatcgatgcta 394 22 0 50.00 60.816 34.11 32.56 36.80 2.816
243 tagctagctgatcgatcgatgc 392 22 0 50.00 60.816 24.08 21.09 35.21 2.816
244 gctaggcgatgctagctag 416 19 0 57.89 58.179 17.46 17.46 35.42 2.821
245 ctagctaggcgatgctagc 413 19 0 57.89 58.179 18.68 9.44 36.95 2.821
246 gctagctaggcgatgctag 412 19 0 57.89 58.179 23.16 23.16 38.59 2.821
247 catctctgcgcgatcgatgc 364 20 0 60.00 62.823 22.01 22.01 38.48 2.823
248 aaagcatcggattagctagct 1 21 0 42.86 58.168 23.74 23.74 0.00 2.832
249 ctgactgatcgatcgatgctag 114 22 0 50.00 59.155 22.81 19.44 35.21 2.845
250 ctagctgactgatcgatcgatg 110 22 0 50.00 59.155 23.05 13.21 35.21 2.845
251 tactatcatctctgcgcgatc 358 21 0 47.62 58.155 4.99 0.00 0.00 2.845
252 gctagctactgatcgatgctac 304 22 0 50.00 59.151 8.57 4.26 0.00 2.849
253 ctactatcatctctgcgcgat 357 21 0 47.62 58.150 4.99 2.52 0.00 2.850
254 agctgatcatcgatgctact 194 20 0 45.00 57.134 17.14 8.95 0.00 2.866
255 gctagctagctgatcatcgat 187 21 0 47.62 58.132 34.38 0.00 46.11 2.868
256 ctgatacgcgatgctagct 477 19 0 52.63 58.107 17.69 1.35 0.00 2.893
257 ggcgatctagctagctgac 583 19 0 57.89 58.106 14.84 7.25 37.58 2.894
258 tgactgatcgatcgatgctag 115 21 0 47.62 58.084 22.81 19.44 35.21 2.916
259 ctgactgatcgatcgatgcta 114 21 0 47.62 58.084 26.44 14.64 35.21 2.916
260 tagctgactgatcgatcgatg 111 21 0 47.62 58.084 23.05 13.21 35.21 2.916
261 actgatcgatcatcatgctagc 269 22 0 45.45 59.071 26.67 8.61 41.77 2.929
262 agctgactgatcgatcatca 264 20 0 45.00 57.064 26.49 26.49 39.98 2.936
263 ctagctagctgatcgatcga 391 20 0 50.00 57.060 22.52 22.52 0.00 2.940
264 ctagctagctgatcgatcga 71 20 0 50.00 57.060 22.52 22.52 0.00 2.940
265 gatcgatcgatgtgcggctag 81 21 0 57.14 61.947 19.16 0.00 41.65 2.947
266 tgctagctaggcgatgct 411 18 0 55.56 59.050 17.69 7.53 0.00 2.950
267 gctgatcgatcgtagcggc 567 19 0 63.16 61.960 20.49 19.38 0.00 2.960
268 cgatcgatgtgcggctag 84 18 0 61.11 59.032 10.82 0.00 41.65 2.968
269 tgatcgatcgatgtgcggct 80 20 0 55.00 62.987 22.21 0.00 41.65 2.987
270 ctgactgatcgatcatcatgct 266 22 0 45.45 59.004 20.99 6.82 41.77 2.996
271 agctgactgatcgatcatcatg 264 22 0 45.45 59.004 22.70 19.51 41.77 2.996
272 agctagctgactgatacgcga 467 21 0 52.38 62.000 17.99 0.00 0.00 3.000
273 tgactgatcgatcgatgctagc 115 22 0 50.00 61.008 18.17 12.52 35.21 3.008
274 gctgactgatcgatcgatgcta 113 22 0 50.00 61.008 26.44 14.64 35.21 3.008
275 tagctgactgatcgatcgatgc 111 22 0 50.00 61.008 24.08 19.43 35.21 3.008
276 agctagctgatcgatcgatgtg 73 22 0 50.00 61.010 17.99 6.93 35.21 3.010
277 ctgatcgatcgatgctagctag 399 22 0 50.00 58.963 19.70 17.46 35.21 3.037
278 ctagctgatcgatcgatgctag 395 22 0 50.00 58.963 37.86 37.86 43.17 3.037
279 ctagctagctgatcgatcgatg 391 22 0 50.00 58.963 21.99 11.03 35.21 3.037
280 ctgatcgatcgatgctagctag 118 22 0 50.00 58.963 19.70 17.46 35.21 3.037
281 ctagctagctgatcgatcgatg 71 22 0 50.00 58.963 21.99 11.03 35.21 3.037
282 gactgatcgatcatcatgctagc 268 23 0 47.83 60.053 24.51 9.03 41.77 3.053
283 gctagtgatgcatgctagtagtg 25 23 0 47.83 59.929 24.96 10.54 0.00 3.071
284 gctactatcatctctgcgcgat 356 22 0 50.00 61.073 4.99 2.52 0.00 3.073
285 gtagcggcgatctagctag 578 19 0 57.89 57.903 15.64 15.64 37.58 3.097
286 tgactgatcgatcatcatgct 267 21 0 42.86 57.900 26.79 12.28 41.77 3.100
287 ctagctactatcatctctgcgc 353 22 0 50.00 58.892 0.00 0.00 0.00 3.108
288 gctagctactatcatctctgcg 352 22 0 50.00 58.892 8.21 0.00 0.00 3.108
289 ctagctagctactgatcgatgc 301 22 0 50.00 58.892 14.00 1.76 0.00 3.108
290 gctagctagctactgatcgatg 300 22 0 50.00 58.892 34.38 7.78 46.11 3.108
291 catcgatcgatgctagtatgct 325 22 0 45.45 58.885 37.80 10.02 44.93 3.115
292 tgatcgatcgatgctagctag 400 21 0 47.62 57.879 26.44 17.46 35.21 3.121
293 ctgatcgatcgatgctagcta 399 21 0 47.62 57.879 19.70 3.77 35.21 3.121
294 tagctgatcgatcgatgctag 396 21 0 47.62 57.879 34.03 27.12 36.80 3.121
295 ctagctgatcgatcgatgcta 395 21 0 47.62 57.879 34.11 32.56 36.80 3.121
296 tagctagctgatcgatcgatg 392 21 0 47.62 57.879 21.99 11.03 35.21 3.121
297 tgatcgatcgatgctagctag 119 21 0 47.62 57.879 26.44 17.46 35.21 3.121
298 ctgatcgatcgatgctagcta 118 21 0 47.62 57.879 19.70 3.77 35.21 3.121
299 tagctagctgatcgatcgatg 72 21 0 47.62 57.879 21.99 11.03 35.21 3.121
300 gatcgatcgatgctagctagt 120 21 0 47.62 57.878 23.89 3.56 35.21 3.122
301 ctatcatctctgcgcgatcgat 360 22 0 50.00 61.132 22.07 11.47 38.48 3.132
302 tgatcgatcgtagcggcga 569 19 0 57.89 62.144 20.58 8.51 45.59 3.144
303 tcgtagcggcgatctagctag 576 21 0 57.14 62.173 15.64 15.64 36.40 3.173
304 tactagctagctgactgatacgc 463 23 0 47.83 60.176 13.17 0.00 0.00 3.176
305 ctgatcatcatcgatgctagct 517 22 0 45.45 58.807 17.69 1.76 40.32 3.193
306 agctgatcatcatcgatgctag 515 22 0 45.45 58.807 5.93 2.76 40.32 3.193
307 ctagctgatcatcatcgatgct 513 22 0 45.45 58.807 14.14 8.34 40.32 3.193
308 agctagctgatcatcatcgatg 511 22 0 45.45 58.807 20.23 20.23 41.48 3.193
309 ctgatcgatcatcatgctagct 270 22 0 45.45 58.807 26.67 0.00 41.77 3.193
310 ctagctgactgatcgatcgat 110 21 0 47.62 57.806 30.53 30.53 37.90 3.194
311 ttagctagctgactgatcgatca 258 23 0 43.48 59.798 28.29 26.99 35.44 3.202
312 tagctactatcatctctgcgc 354 21 0 47.62 57.798 0.00 0.00 0.00 3.202
313 gctagctactgatcgatgcta 304 21 0 47.62 57.798 12.99 12.23 0.00 3.202
314 tagctagctactgatcgatgc 302 21 0 47.62 57.798 27.80 1.76 0.00 3.202
315 tctctgcgcgatcgatgc 366 18 0 61.11 61.229 22.01 22.01 38.48 3.229
316 ctctgcgcgatcgatgct 367 18 0 61.11 61.232 26.61 0.00 38.48 3.232
317 agctagctactatcatctctgcg 351 23 0 47.83 60.238 17.56 0.00 0.00 3.238
318 ctagctagctactgatcgatgct 301 23 0 47.83 60.238 14.00 11.51 0.00 3.238
319 ctgatcgatcgtagcggc 568 18 0 61.11 58.727 14.21 0.00 0.00 3.273
320 gctgatcgatcgtagcgg 567 18 0 61.11 58.727 20.49 15.03 0.00 3.273
321 agctaggcgatgctagct 415 18 0 55.56 58.725 17.69 13.00 39.84 3.275
322 tgctagtgatgcatgctagtagt 24 23 0 43.48 60.302 24.96 12.98 35.89 3.302
323 gcgcgatcgatgctagct 371 18 0 61.11 61.306 21.66 1.35 38.48 3.306
324 tgatcatcatcgatgctagct 518 21 0 42.86 57.691 17.69 1.76 40.32 3.309
325 agctgatcatcatcgatgcta 515 21 0 42.86 57.691 0.24 0.00 40.32 3.309
326 tagctgatcatcatcgatgct 514 21 0 42.86 57.691 14.14 8.34 40.32 3.309
327 tgatcgatcatcatgctagct 271 21 0 42.86 57.691 27.48 0.00 37.38 3.309
328 ctagctagctgactgatacgcg 465 22 0 54.55 61.313 14.90 3.89 0.00 3.313
329 tgctagtgatgcatgctagtag 24 22 0 45.45 58.673 24.96 19.76 35.89 3.327
330 gctagtgatgcatgctagtagt 25 22 0 45.45 58.672 24.96 12.98 0.00 3.328
331 tagctagctgatcatcgatgcta 189 23 0 43.48 59.671 17.82 15.89 0.00 3.329
332 agctagctgactgatacgc 467 19 0 52.63 57.642 17.99 0.00 0.00 3.358
333 tatcatctctgcgcgatcgatg 361 22 0 50.00 61.383 18.01 18.01 38.48 3.383
334 agctgactgatcgatcatcat 264 21 0 42.86 57.616 26.31 18.90 41.77 3.384
335 actagctagctgatcatcatcga 508 23 0 43.48 59.607 22.43 0.00 0.00 3.393
336 tagctagctgactgatcgatcat 259 23 0 43.48 59.607 28.29 18.02 36.62 3.393
337 gatgctagctaggcgatgctag 409 22 0 54.55 61.393 23.16 23.16 38.59 3.393
338 cggcgatctagctagctgact 582 21 0 57.14 62.394 17.44 7.44 38.70 3.394
339 ctagctagctgatcgatcgat 391 21 0 47.62 57.600 30.53 30.53 37.90 3.400
340 ctagctagctgatcgatcgat 71 21 0 47.62 57.600 30.53 30.53 37.90 3.400
341 actgatcgatcatcatgctagct 269 23 0 43.48 60.428 26.67 4.70 41.77 3.428
342 ctagctagctgactgatcgatc 106 22 0 50.00 58.567 19.32 19.32 0.00 3.433
343 ctgactgatcgatcatcatgc 266 21 0 47.62 57.562 20.99 12.19 41.77 3.438
344 gctgactgatcgatcatcatg 265 21 0 47.62 57.562 22.70 19.51 41.77 3.438
345 gatcgatcgatgctagctaggc 401 22 0 54.55 61.448 23.89 8.45 35.21 3.448
346 gtgatgcatgctagtagtgatgt 29 23 0 43.48 59.551 11.60 0.00 0.00 3.449
347 tgctagtgatgcatgctagta 24 21 0 42.86 57.546 24.96 21.25 35.89 3.454
348 tagcggcgatctagctagctg 579 21 0 57.14 62.457 18.98 9.30 45.57 3.457
349 gtagcggcgatctagctagct 578 21 0 57.14 62.458 23.74 23.74 46.60 3.458
350 tagctgatcgatcgtagcg 565 19 0 52.63 57.539 25.02 11.96 0.00 3.461
351 gctagctagctactgatcgat 300 21 0 47.62 57.517 34.38 0.00 46.11 3.483
352 agctagctactgatcgatgctac 303 23 0 47.83 60.487 17.56 7.81 0.00 3.487
353 atcgatcgatgctagtatgct 326 21 0 42.86 57.502 29.65 2.17 33.56 3.498
354 agctactgatcgatgctacatc 307 22 0 45.45 58.484 7.41 0.00 37.97 3.516
355 agtgatgcatgctagtagtga 28 21 0 42.86 57.471 0.00 0.00 0.00 3.529
356 gactgatcgatcgatgctagcta 116 23 0 47.83 60.546 18.04 4.19 35.21 3.546
357 ctgatcgatcgatgctagctagt 118 23 0 47.83 60.547 22.18 3.56 35.21 3.547
358 actgatcgatcgatgctagctag 117 23 0 47.83 60.547 23.29 17.46 35.21 3.547
359 ctagctagctgatcgatcgatgt 71 23 0 47.83 60.547 14.29 2.62 35.21 3.547
360 catcgatcgatgctagtatgc 325 21 0 47.62 57.452 37.80 0.00 44.93 3.548
361 tagctagctgactgatcgatc 259 21 0 47.62 57.451 28.29 19.32 0.00 3.549
362 tagctagctgactgatcgatc 107 21 0 47.62 57.451 28.29 19.32 0.00 3.549
363 ctagctagctgactgatcgat 106 21 0 47.62 57.445 14.90 0.00 0.00 3.555
364 tcgatgctagctaggcga 407 18 0 55.56 58.427 15.59 13.52 0.00 3.573
365 tgatcgatcgatgctagctagta 119 23 0 43.48 59.424 26.44 18.77 35.21 3.576
366 ctgcgcgatcgatgctagc 369 19 0 63.16 62.586 20.26 12.12 38.48 3.586
367 agctagctgatcatcatcgat 511 21 0 42.86 57.405 17.99 0.00 0.00 3.595
368 tgcgcgatcgatgctagc 370 18 0 61.11 61.605 26.61 17.77 38.48 3.605
369 ctagctagctgatcgatcgtag 560 22 0 50.00 58.387 16.86 16.86 0.00 3.613
370 actagctagctgactgatacg 464 21 0 47.62 57.384 21.52 2.77 0.00 3.616
371 ctagctgactgatacgcga 469 19 0 52.63 57.370 16.29 0.00 0.00 3.630
372 gctactagctagctgactgat 461 21 0 47.62 57.360 15.96 3.00 44.92 3.640
373 ctgatcatcatcgatgctagc 517 21 0 47.62 57.358 8.61 8.61 40.32 3.642
374 gctgatcatcatcgatgctag 516 21 0 47.62 57.358 5.93 2.76 40.32 3.642
375 ctagctgatcatcatcgatgc 513 21 0 47.62 57.358 21.42 7.40 40.32 3.642
376 gctagctgatcatcatcgatg 512 21 0 47.62 57.358 20.23 20.23 41.48 3.642
377 ctgatcgatcatcatgctagc 270 21 0 47.62 57.358 26.67 8.61 41.77 3.642
378 agctactgatcgatgctacat 307 21 0 42.86 57.344 7.41 0.00 0.00 3.656
379 tgatcgatcgatgtgcggcta 80 21 0 52.38 62.663 22.21 0.24 41.65 3.663
380 atctctgcgcgatcgatg 365 18 0 55.56 58.327 12.03 4.19 38.48 3.673
381 catctctgcgcgatcgat 364 18 0 55.56 58.327 22.07 1.26 38.48 3.673
382 atcatctctgcgcgatcg 362 18 0 55.56 58.327 12.19 12.19 39.07 3.673
383 aagcatcggattagctagctgat 2 23 0 43.48 60.682 17.84 15.13 0.00 3.682
384 agtgatgcatgctagtagtgatg 28 23 0 43.48 59.299 7.49 7.49 0.00 3.701
385 gatcgatgctagctaggcgatg 405 22 0 54.55 61.702 24.26 6.24 0.00 3.702
386 atctctgcgcgatcgatgcta 365 21 0 52.38 62.723 26.61 17.10 38.48 3.723
387 tagctagctgactgatacgcga 466 22 0 50.00 61.730 28.29 0.00 0.00 3.730
388 tagctagctgatcgatcgtag 561 21 0 47.62 57.269 16.86 16.86 0.00 3.731
389 ctagctagctgatcgatcgta 560 21 0 47.62 57.269 11.68 3.07 0.00 3.731
390 tcgatcgatgctagctagtag 122 21 0 47.62 57.269 18.63 2.63 0.00 3.731
391 gctagctactgatcgatgctaca 304 23 0 47.83 60.734 11.21 0.06 0.00 3.734
392 agctagctgactgatcgatcatc 260 23 0 47.83 60.736 23.93 21.92 36.62 3.736
393 agctagctgactgatcgatcga 108 22 0 50.00 61.737 22.52 22.52 0.00 3.737
394 tctctgcgcgatcgatgct 366 19 0 57.89 62.740 26.61 0.00 38.48 3.740
395 tgatgcatgctagtagtgatgt 30 22 0 40.91 58.256 11.60 0.00 0.00 3.744
396 tgatcgatcgatgtgcgg 80 18 0 55.56 58.244 21.27 0.00 41.65 3.756
397 cgatcgatgctagctaggcga 404 21 0 57.14 62.770 16.30 16.30 0.00 3.770
398 tcgatcgatgctagctaggcg 403 21 0 57.14 62.770 18.63 11.67 0.00 3.770
399 atcgatcgatgcatgcatg 443 19 0 47.37 57.226 29.65 23.31 37.30 3.774
400 catcgatcgatgcatgcat 442 19 0 47.37 57.226 37.80 33.45 44.93 3.774
401 actagctagctgatcatcatcg 508 22 0 45.45 58.219 22.43 3.40 0.00 3.781
402 ctgatcatcgatgctactagct 196 22 0 45.45 58.219 10.86 0.00 45.92 3.781
403 agctgatcatcgatgctactag 194 22 0 45.45 58.219 13.67 9.68 0.00 3.781
404 ctagctgatcatcgatgctact 192 22 0 45.45 58.219 14.85 7.80 0.00 3.781
405 tttagctagctgactgatcga 257 21 0 42.86 57.216 0.38 0.00 0.00 3.784
406 tagctagctgatcgatcgatgtg 72 23 0 47.83 60.793 10.14 4.94 35.21 3.793
407 gctagctagctgatcatcatct 146 22 0 45.45 58.203 34.38 0.00 46.11 3.797
408 ctagctagctgatcatcgatgct 188 23 0 47.83 60.799 16.29 15.30 0.00 3.799
409 agctagctactatcatcgatcga 429 23 0 43.48 59.170 22.52 22.52 0.00 3.830
410 ttagctagctgactgatcgatc 258 22 0 45.45 58.159 28.29 19.32 0.00 3.841
411 ctagctgactgatcgatcatca 262 22 0 45.45 58.155 26.49 26.49 39.98 3.845
412 aaagcatcggattagctagctga 1 23 0 43.48 60.870 28.29 20.88 0.00 3.870
413 agctgactgatacgcgatgct 471 21 0 52.38 62.876 7.57 2.13 0.00 3.876
414 tagctagctactgatcgatgcta 302 23 0 43.48 59.102 27.80 12.23 0.00 3.898
415 tcatcatcgatgctagctagt 521 21 0 42.86 57.067 22.18 3.56 40.32 3.933
416 tcgatcatcatgctagctact 274 21 0 42.86 57.067 0.00 0.00 0.00 3.933
417 tgatcatcgatgctactagct 197 21 0 42.86 57.067 17.14 0.00 45.92 3.933
418 agctgatcatcgatgctacta 194 21 0 42.86 57.067 17.14 4.89 0.00 3.933
419 tagctgatcatcgatgctact 193 21 0 42.86 57.067 14.85 7.80 0.00 3.933
420 tcgatcgatgctagtatgctag 327 22 0 45.45 58.044 18.63 13.77 46.09 3.956
421 gcgatctagctagctgact 584 19 0 52.63 57.034 17.44 7.44 0.00 3.966
422 gctactgatcgatgctacatc 308 21 0 47.62 57.028 2.44 0.00 37.97 3.972
423 cggcgatctagctagctg 582 18 0 61.11 58.018 17.07 8.17 37.58 3.982
424 gctagctgactgatcgatcatca 261 23 0 47.83 60.983 26.49 26.49 39.98 3.983
425 actatcatctctgcgcgat 359 19 0 47.37 57.015 4.99 2.52 0.00 3.985
426 catcggattagctagctgatg 5 21 0 47.62 57.003 23.69 23.29 0.00 3.997
427 tagctgactgatcgatcatca 263 21 0 42.86 57.000 26.49 26.49 39.98 4.000
428 actagctagctgatcatcatcgat 508 24 0 41.67 59.995 22.43 0.00 0.00 4.005
429 agtgatgcatgctagtagtgat 28 22 0 40.91 57.984 0.00 0.00 0.00 4.016
430 ctagctagctgatcatcatcga 509 22 0 45.45 57.958 11.68 0.00 0.00 4.042
431 gctgatcatcgatgctactagct 195 23 0 47.83 61.046 20.91 5.24 45.92 4.046
432 agctgatcatcgatgctactagc 194 23 0 47.83 61.046 20.78 20.78 45.61 4.046
433 gctagctgatcatcgatgctact 191 23 0 47.83 61.046 12.59 8.92 0.00 4.046
434 agctagctgatcatcgatgctac 190 23 0 47.83 61.046 17.99 7.99 0.00 4.046
435 tagctagctactatcatctctgcg 350 24 0 45.83 60.058 27.80 0.00 0.00 4.058
436 ctagctagctactgatcgatgcta 301 24 0 45.83 60.058 14.00 12.23 0.00 4.058
437 agctactatcatctctgcgcga 355 22 0 50.00 62.058 2.71 2.71 0.00 4.058
438 gctatttagctagctgactgatcg 253 24 0 45.83 60.060 7.27 0.00 46.11 4.060
439 tgatcgatcatcatgctagctac 271 23 0 43.48 58.931 27.48 0.00 37.38 4.069
440 gtgatgcatgctagtagtgatg 29 22 0 45.45 57.921 7.49 7.49 0.00 4.079
441 ctagctagctgactgatcgatcg 106 23 0 52.17 61.091 16.84 13.89 0.00 4.091
442 ctagctactgatcgatgctaca 305 22 0 45.45 57.898 13.79 1.61 0.00 4.102
443 cggcgatctagctagctgacta 582 22 0 54.55 62.109 17.44 5.40 38.70 4.109
444 atgctagctaggcgatgc 410 18 0 55.56 57.890 10.59 0.00 0.00 4.110
445 ctgatcgatcatcatgctagctac 270 24 0 45.83 59.882 26.67 0.00 41.77 4.118
446 gctactagctagctgatcatca 505 22 0 45.45 57.879 14.37 0.00 44.92 4.121
447 gctactagctagctgatcatca 208 22 0 45.45 57.879 14.37 0.00 44.92 4.121
448 ctgactgatacgcgatgctagc 473 22 0 54.55 62.128 8.61 8.61 0.00 4.128
449 gctgactgatacgcgatgctag 472 22 0 54.55 62.128 1.70 0.00 0.00 4.128
450 ctagctgactgatacgcgatgc 469 22 0 54.55 62.128 3.47 0.00 0.00 4.128
451 gctagctgactgatacgcgatg 468 22 0 54.55 62.128 8.21 0.00 0.00 4.128
452 tgactgatcgatcatcatgctag 267 23 0 43.48 58.866 26.79 18.40 41.77 4.134
453 ctgactgatcgatcatcatgcta 266 23 0 43.48 58.866 20.99 8.89 41.77 4.134
454 tagctgactgatcgatcatcatg 263 23 0 43.48 58.866 22.70 19.51 41.77 4.134
455 ctagctagctgatcgatcgtagc 560 23 0 52.17 61.151 26.87 26.87 0.00 4.151
456 gctagctagctgatcgatcgtag 559 23 0 52.17 61.151 34.38 16.86 46.11 4.151
457 ctgatcgatcgatgctagctagg 399 23 0 52.17 61.158 22.67 6.29 35.21 4.158
458 gatcgatcgatgctagctagtag 120 23 0 47.83 58.829 23.89 2.63 35.21 4.171
459 ttagctagctgactgatcgatcat 258 24 0 41.67 60.177 28.29 18.02 36.62 4.177
460 ctgactgatcgatcatcatgctag 266 24 0 45.83 59.822 20.99 12.80 41.77 4.178
461 ctagctgactgatcgatcatcatg 262 24 0 45.83 59.822 22.70 19.51 41.77 4.178
462 ctagctgatcgatcgatgtgcg 75 22 0 54.55 62.180 31.92 20.85 42.69 4.180
463 tttagctagctgactgatcgatc 257 23 0 43.48 58.807 19.32 19.32 0.00 4.193
464 tgactgatcgatcatcatgcta 267 22 0 40.91 57.803 26.79 13.11 41.77 4.197
465 gctagctactatcatcgatcga 430 22 0 45.45 57.783 22.52 22.52 0.00 4.217
466 gatcgatcgatgctagctagta 120 22 0 45.45 57.783 23.89 18.77 35.21 4.217
467 agctagctactatcatcgatcg 429 22 0 45.45 57.777 17.56 9.87 0.00 4.223
468 atcgatcgatgctagctagtag 121 22 0 45.45 57.777 29.65 2.63 33.56 4.223
469 tgatcatcatcgatgctagctagt 518 24 0 41.67 60.238 22.18 3.56 40.32 4.238
470 tgatcgatcatcatgctagctact 271 24 0 41.67 60.238 27.48 0.00 37.38 4.238
471 actgatcgatcatcatgctagcta 269 24 0 41.67 60.238 26.67 2.76 41.77 4.238
472 catcgatcgatgctagtatgcta 325 23 0 43.48 58.753 37.80 6.23 44.93 4.247
473 tttagctagctgactgatcgat 257 22 0 40.91 57.736 0.38 0.00 0.00 4.264
474 atttagctagctgactgatcga 256 22 0 40.91 57.736 4.16 0.00 0.00 4.264
475 cgcgatcgatgctagcta 372 18 0 55.56 57.717 22.07 3.08 38.48 4.283
476 catcgatcgatgctagtatgctag 325 24 0 45.83 59.708 37.80 16.01 44.93 4.292
477 tagctagctactgatcgatgctac 302 24 0 45.83 60.297 27.80 7.81 0.00 4.297
478 agcatcggattagctagctgatg 3 23 0 47.83 61.299 27.81 27.81 33.28 4.299
479 agctagctgactgatacgcgat 467 22 0 50.00 62.317 17.99 0.00 0.00 4.317
480 tgatcatcatcgatgctagctag 518 23 0 43.48 58.678 17.46 17.46 40.32 4.322
481 ctgatcatcatcgatgctagcta 517 23 0 43.48 58.678 17.69 2.41 40.32 4.322
482 tagctgatcatcatcgatgctag 514 23 0 43.48 58.678 9.90 2.76 40.32 4.322
483 ctagctgatcatcatcgatgcta 513 23 0 43.48 58.678 14.58 9.63 40.32 4.322
484 tagctagctgatcatcatcgatg 510 23 0 43.48 58.678 20.23 20.23 41.48 4.322
485 ctgatcgatcatcatgctagcta 270 23 0 43.48 58.678 26.67 2.76 41.77 4.322
486 gatcatcatcgatgctagctagt 519 23 0 43.48 58.677 22.18 3.56 40.32 4.323
487 gatcgatcatcatgctagctact 272 23 0 43.48 58.677 21.11 0.00 0.00 4.323
488 gctagctagctgactgatcgatc 105 23 0 52.17 61.341 34.38 19.32 46.11 4.341
489 tgatcgatcgatgctagctagtag 119 24 0 45.83 60.356 26.44 2.63 35.21 4.356
490 ctgatcgatcgatgctagctagta 118 24 0 45.83 60.356 22.18 18.77 35.21 4.356
491 ctgatcatcatcgatgctagctag 517 24 0 45.83 59.644 17.46 17.46 40.32 4.356
492 ctagctgatcatcatcgatgctag 513 24 0 45.83 59.644 19.54 18.30 42.07 4.356
493 ctagctagctgatcatcatcgatg 509 24 0 45.83 59.644 20.23 20.23 41.48 4.356
494 tttagctagctgactgatcgatca 257 24 0 41.67 60.358 26.99 26.99 35.44 4.358
495 actatcatctctgcgcgatcga 359 22 0 50.00 62.365 22.07 1.72 38.48 4.365
496 agctgatcgatcgtagcg 566 18 0 55.56 57.634 25.02 11.96 0.00 4.366
497 gctactagctagctgactgatac 461 23 0 47.83 58.626 15.96 1.42 44.92 4.374
498 agctgatcgatcgatgctagct 397 22 0 50.00 62.388 30.32 30.32 38.42 4.388
499 agctagctgatcgatcgatgct 393 22 0 50.00 62.388 33.87 33.38 38.16 4.388
500 ctagctgactgatcgatcatcat 262 23 0 43.48 58.612 26.31 20.43 41.77 4.388
501 agctagctactatcatctctgc 351 22 0 45.45 57.608 17.56 0.00 0.00 4.392
502 ctagctactatcatctctgcgcg 353 23 0 52.17 61.393 0.00 0.00 0.00 4.393
503 tgatcatcatcgatgctagcta 518 22 0 40.91 57.602 17.69 3.08 40.32 4.398
504 tagctgatcatcatcgatgcta 514 22 0 40.91 57.602 15.95 9.16 40.32 4.398
505 tgatcgatcatcatgctagcta 271 22 0 40.91 57.602 27.48 3.08 37.38 4.398
506 atcatcatcgatgctagctagt 520 22 0 40.91 57.595 22.18 3.56 40.32 4.405
507 atcgatcatcatgctagctact 273 22 0 40.91 57.595 0.00 0.00 0.00 4.405
508 agctagctactatcatcgatcgat 429 24 0 41.67 59.573 25.37 25.37 35.13 4.427
509 gctagctgatcgatcgatgtgc 74 22 0 54.55 62.443 31.83 30.04 35.21 4.443
510 tagctgactgatcgatcatcat 263 22 0 40.91 57.531 26.31 20.43 41.77 4.469
511 tagctagctgactgatcgatcga 107 23 0 47.83 61.487 28.29 22.52 0.00 4.487
512 atcgatcgatgctagtatgctag 326 23 0 43.48 58.501 29.65 13.77 46.09 4.499
513 ctagtgatgcatgctagtagtga 26 23 0 43.48 58.483 20.00 1.46 0.00 4.517
514 tagctagctgactgatcgatcatc 259 24 0 45.83 60.536 28.29 21.92 36.62 4.536
515 tactagctagctgatcatcatcga 507 24 0 41.67 59.449 0.00 0.00 0.00 4.551
516 gctagctagctactatcatcga 426 22 0 45.45 57.437 34.38 0.00 46.11 4.563
517 tgactgatacgcgatgctagct 474 22 0 50.00 62.569 17.69 1.35 0.00 4.569
518 agctgactgatacgcgatgcta 471 22 0 50.00 62.569 7.57 0.00 0.00 4.569
519 tagctgactgatacgcgatgct 470 22 0 50.00 62.569 10.87 8.44 0.00 4.569
520 atcgatcgatgctagtatgcta 326 22 0 40.91 57.423 29.65 0.00 33.56 4.577
521 ctagctagctgatcatcatcgat 509 23 0 43.48 58.422 11.68 0.00 0.00 4.578
522 agctgactgatcgatcgatgct 112 22 0 50.00 62.580 26.44 23.13 35.21 4.580
523 ctagctagctgatcatcgatgcta 188 24 0 45.83 60.596 16.78 15.81 0.00 4.596
524 gtgatgcatgctagtagtgatgta 29 24 0 41.67 59.398 11.60 8.84 0.00 4.602
525 gctgatcatcatcgatgctagct 516 23 0 47.83 61.603 20.15 8.14 40.32 4.603
526 agctgatcatcatcgatgctagc 515 23 0 47.83 61.603 20.04 19.26 40.32 4.603
527 gctagctgatcatcatcgatgct 512 23 0 47.83 61.603 14.14 8.34 40.32 4.603
528 agctagctgatcatcatcgatgc 511 23 0 47.83 61.603 21.42 7.40 40.32 4.603
529 tagtgatgcatgctagtagtga 27 22 0 40.91 57.391 0.01 0.00 0.00 4.609
530 ctactagctagctgactgatacg 462 23 0 47.83 58.387 3.12 0.00 0.00 4.613
531 tagctactgatcgatgctacatc 306 23 0 43.48 58.368 13.79 0.00 37.97 4.632
532 gactgatacgcgatgctagctag 475 23 0 52.17 61.633 17.46 17.46 0.00 4.633
533 ctagctactgatcgatgctacat 305 23 0 43.48 58.364 13.79 0.09 0.00 4.636
534 gctagctactatcatctctgcgc 352 23 0 52.17 61.644 8.21 0.00 0.00 4.644
535 gctagctagctactgatcgatgc 300 23 0 52.17 61.644 34.38 12.71 46.11 4.644
536 gctactagctagctgatcatcat 505 23 0 43.48 58.350 14.37 0.00 44.92 4.650
537 gctactagctagctgatcatcat 208 23 0 43.48 58.350 14.37 0.00 44.92 4.650
538 ctagctactgatcgatgctacatc 305 24 0 45.83 59.349 13.79 0.00 37.97 4.651
539 gctactagctagctgatcatcatc 505 24 0 45.83 59.343 14.37 0.00 44.92 4.657
540 gctactagctagctgatcatcatc 208 24 0 45.83 59.343 14.37 0.00 44.92 4.657
541 gctgatcatcatctagctagtagc 154 24 0 45.83 59.343 15.25 15.25 45.79 4.657
542 tagctagctgatcatcatcgat 510 22 0 40.91 57.329 10.14 0.00 0.00 4.671
543 ctactatcatctctgcgcgatcg 357 23 0 52.17 61.686 12.19 12.19 39.07 4.686
544 tactagctagctgactgatacg 463 22 0 45.45 57.310 13.17 0.00 0.00 4.690
545 gctgatcgatcgatgctagctag 398 23 0 52.17 61.697 27.88 18.22 35.21 4.697
546 ctagctgatcgatcgatgctagc 395 23 0 52.17 61.697 38.64 35.38 43.05 4.697
547 gctagctgatcgatcgatgctag 394 23 0 52.17 61.697 41.07 41.07 46.89 4.697
548 ctagctagctgatcgatcgatgc 391 23 0 52.17 61.697 24.08 21.09 35.21 4.697
549 gctagctagctgatcgatcgatg 390 23 0 52.17 61.697 34.38 11.03 46.11 4.697
550 gctagctagctgatcgatcgatg 70 23 0 52.17 61.697 34.38 11.03 46.11 4.697
551 gctactagctagctgactgata 461 22 0 45.45 57.286 15.96 3.69 44.92 4.714
552 gatcgatcatcatgctagctac 272 22 0 45.45 57.284 21.11 0.00 0.00 4.716
553 cgatgctagctaggcgat 408 18 0 55.56 57.277 10.81 3.01 0.00 4.723
554 atcgatgctagctaggcg 406 18 0 55.56 57.277 15.59 9.02 0.00 4.723
555 tagctactgatcgatgctacat 306 22 0 40.91 57.270 13.79 0.09 0.00 4.730
556 gctagctactatcatcgatcgat 430 23 0 43.48 58.251 25.37 25.37 35.13 4.749
557 tgcatgctagtagtgatgtatacg 33 24 0 41.67 59.224 20.79 0.00 0.00 4.776
558 gcatgctagtagtgatgtatacgt 34 24 0 41.67 59.223 11.60 0.00 0.00 4.777
559 atttagctagctgactgatcgatc 256 24 0 41.67 59.219 19.32 19.32 0.00 4.781
560 gactgatcgatcatcatgctag 268 22 0 45.45 57.215 24.51 15.87 41.77 4.785
561 atttagctagctgactgatcgat 256 23 0 39.13 58.215 4.16 0.00 0.00 4.785
562 gctgactgatcgatcatcatgct 265 23 0 47.83 61.788 27.72 15.10 41.77 4.788
563 agctgactgatcgatcatcatgc 264 23 0 47.83 61.788 27.74 27.74 41.77 4.788
564 tagctactatcatctctgcgcga 354 23 0 47.83 61.796 2.71 2.71 0.00 4.796
565 gctgatcatcgatgctactagcta 195 24 0 45.83 60.834 20.91 7.37 45.92 4.834
566 tagctgatcatcgatgctactagc 193 24 0 45.83 60.834 20.78 20.78 45.61 4.834
567 gctagctgatcatcgatgctacta 191 24 0 45.83 60.834 11.65 8.83 0.00 4.834
568 tagctagctgatcatcgatgctac 189 24 0 45.83 60.834 17.82 12.06 0.00 4.834
569 tagtgatgcatgctagtagtgatg 27 24 0 41.67 59.155 11.56 7.49 0.00 4.845
570 agtgatgcatgctagtagtgatgt 28 24 0 41.67 60.846 11.60 0.00 0.00 4.846
571 tgatgcatgctagtagtgatgta 30 23 0 39.13 58.147 11.60 8.84 0.00 4.853
572 ctgactgatcgatcgatgctagc 114 23 0 52.17 61.878 18.17 12.52 35.21 4.878
573 gctgactgatcgatcgatgctag 113 23 0 52.17 61.878 22.81 19.44 35.21 4.878
574 ctagctgactgatcgatcgatgc 110 23 0 52.17 61.878 24.08 19.43 35.21 4.878
575 gctagctgactgatcgatcgatg 109 23 0 52.17 61.878 23.05 13.21 35.21 4.878
576 tcatcatcgatgctagctagtag 521 23 0 43.48 58.114 2.81 0.00 40.32 4.886
577 tactagctagctgatcatcatcg 507 23 0 43.48 58.114 0.00 0.00 0.00 4.886
578 tcgatcatcatgctagctactag 274 23 0 43.48 58.114 0.00 0.00 37.62 4.886
579 tgatcatcgatgctactagctag 197 23 0 43.48 58.114 20.04 20.04 45.92 4.886
580 ctgatcatcgatgctactagcta 196 23 0 43.48 58.114 10.86 0.00 45.92 4.886
581 tagctgatcatcgatgctactag 193 23 0 43.48 58.114 13.67 9.68 0.00 4.886
582 ctagctgatcatcgatgctacta 192 23 0 43.48 58.114 11.65 8.83 0.00 4.886
583 ctactagctagctgatcatcatcg 506 24 0 45.83 59.110 1.08 0.00 0.00 4.890
584 ctgatcatcgatgctactagctag 196 24 0 45.83 59.110 20.04 20.04 45.92 4.890
585 ctagctgatcatcgatgctactag 192 24 0 45.83 59.110 15.68 15.68 0.00 4.890
586 gctagctagctgatcatcatctag 146 24 0 45.83 59.102 34.38 13.13 44.71 4.898
587 gctagctagctgatcatcatcta 146 23 0 43.48 58.097 34.38 0.00 46.11 4.903
588 ctagtgatgcatgctagtagtg 26 22 0 45.45 57.072 20.00 3.96 0.00 4.928
589 gctactatcatctctgcgcgatc 356 23 0 52.17 61.936 4.99 0.00 0.00 4.936
590 gctgatcgatcgatgtgc 78 18 0 55.56 57.052 29.71 26.38 35.21 4.948
591 tagctagctactatcatcgatcga 428 24 0 41.67 59.031 27.80 22.52 0.00 4.969
592 agctagctgatcgatcgtagcg 562 22 0 54.55 62.971 27.20 18.31 0.00 4.971
593 tgactgatacgcgatgct 474 18 0 50.00 57.028 2.33 0.00 0.00 4.972
594 gatcatcatcgatgctagctag 519 22 0 45.45 57.019 17.46 17.46 40.32 4.981
595 tcatcatcgatgctagctagta 521 22 0 40.91 57.005 22.18 18.77 40.32 4.995
596 tcgatcatcatgctagctacta 274 22 0 40.91 57.005 0.00 0.00 0.00 4.995
597 tgatcatcgatgctactagcta 197 22 0 40.91 57.005 17.14 1.01 45.92 4.995
598 tagctgatcatcgatgctacta 193 22 0 40.91 57.005 12.62 8.42 0.00 4.995
599 tagctagctgactgatacgcgat 466 23 0 47.83 62.044 28.29 0.00 0.00 5.044
600 ctagctagctactatcatcgatcga 427 25 0 44.00 59.949 27.80 22.52 0.00 5.051
601 agctagctgactgatcgatcgat 108 23 0 47.83 62.053 30.53 30.53 37.90 5.053
602 ctactagctagctgactgatacgc 462 24 0 50.00 61.062 3.61 0.00 0.00 5.062
603 gctactagctagctgactgatacg 461 24 0 50.00 61.062 14.37 0.00 44.92 5.062
604 tgatcatcatcgatgctagctagta 518 25 0 40.00 60.062 22.18 18.77 40.32 5.062
605 tgatcgatcatcatgctagctacta 271 25 0 40.00 60.062 27.48 0.00 37.38 5.062
606 ctagtgatgcatgctagtagtgatg 26 25 0 44.00 60.064 20.00 7.49 0.00 5.064
607 gctagctagctactatcatcgatc 426 24 0 45.83 58.932 34.38 4.20 46.11 5.068
608 gctagctactgatcgatgctacat 304 24 0 45.83 61.072 11.21 0.00 0.00 5.072
609 gctagctagctactatcatcgat 426 23 0 43.48 57.922 34.38 0.00 46.11 5.078
610 ctagtgatgcatgctagtagtgat 26 24 0 41.67 58.911 20.00 4.64 0.00 5.089
611 tactatcatctctgcgcgatcga 358 23 0 47.83 62.092 22.07 1.72 38.48 5.092
612 agctgatcgatcgatgctagcta 397 23 0 47.83 62.111 31.26 14.51 40.03 5.111
613 tagctgatcgatcgatgctagct 396 23 0 47.83 62.111 33.22 33.22 42.08 5.111
614 agctagctgatcgatcgatgcta 393 23 0 47.83 62.111 34.11 32.56 36.80 5.111
615 tagctagctgatcgatcgatgct 392 23 0 47.83 62.111 33.87 33.38 38.16 5.111
616 tagtgatgcatgctagtagtgat 27 23 0 39.13 57.886 11.56 0.00 0.00 5.114
617 tactagctagctgatcatcatcgat 507 25 0 40.00 59.828 0.00 0.00 0.00 5.172
618 gctagctagctgatcatcgatgc 187 23 0 52.17 62.193 34.38 9.22 46.11 5.193
619 gctagtgatgcatgctagtagtga 25 24 0 45.83 61.195 24.96 4.57 0.00 5.195
620 aaagcatcggattagctagctgat 1 24 0 41.67 61.209 17.84 15.13 0.00 5.209
621 gtgatgcatgctagtagtgatgtat 29 25 0 40.00 59.774 1.07 1.07 0.00 5.226
622 ctatcatctctgcgcgatcgatg 360 23 0 52.17 62.227 18.01 18.01 38.48 5.227
623 tgactgatacgcgatgctagcta 474 23 0 47.83 62.287 17.69 3.08 0.00 5.287
624 tagctgactgatacgcgatgcta 470 23 0 47.83 62.287 12.64 9.09 0.00 5.287
625 tgctagtagtgatgtatacgtagct 37 25 0 40.00 59.713 9.37 8.73 0.00 5.287
626 tgactgatcgatcgatgctagct 115 23 0 47.83 62.296 20.19 11.59 35.21 5.296
627 agctgactgatcgatcgatgcta 112 23 0 47.83 62.296 26.44 14.64 35.21 5.296
628 tagctgactgatcgatcgatgct 111 23 0 47.83 62.296 31.98 30.27 35.21 5.296
629 ctagctagctactatcatcgatcg 427 24 0 45.83 58.703 12.49 9.87 0.00 5.297
630 tagctagctactatcatcgatcg 428 23 0 43.48 57.691 27.80 9.87 0.00 5.309
631 gactgatcgatcatcatgctagct 268 24 0 45.83 61.313 24.51 7.81 41.77 5.313
632 gctagctgactgatcgatcatcat 261 24 0 45.83 61.313 26.31 20.43 41.77 5.313
633 ctatttagctagctgactgatcga 254 24 0 41.67 58.679 0.00 0.00 0.00 5.321
634 gcatgctagtagtgatgtatacg 34 23 0 43.48 57.659 11.60 0.00 0.00 5.341
635 tatttagctagctgactgatcga 255 23 0 39.13 57.650 0.00 0.00 0.00 5.350
636 ctactagctagctgatcatcatcga 506 25 0 44.00 60.352 1.08 0.00 0.00 5.352
637 agctactatcatctctgcgcgat 355 23 0 47.83 62.360 4.99 2.52 0.00 5.360
638 gctgatcatcatcgatgctagcta 516 24 0 45.83 61.370 20.15 8.49 40.32 5.370
639 tagctgatcatcatcgatgctagc 514 24 0 45.83 61.370 20.04 19.26 40.32 5.370
640 gctagctgatcatcatcgatgcta 512 24 0 45.83 61.370 14.58 9.63 40.32 5.370
641 tagctagctgatcatcatcgatgc 510 24 0 45.83 61.370 21.42 7.40 40.32 5.370
642 atgcatgctagtagtgatgtatacg 32 25 0 40.00 59.604 11.70 0.00 0.00 5.396
643 tgatgcatgctagtagtgatgtat 30 24 0 37.50 58.592 12.66 12.66 0.00 5.408
644 gactgatcgatcgatgctagctag 116 24 0 50.00 61.409 18.04 17.46 35.21 5.409
645 gctatttagctagctgactgatc 253 23 0 43.48 57.572 7.27 0.00 46.11 5.428
646 tgctagtgatgcatgctagtagtg 24 24 0 45.83 61.434 24.96 10.54 35.89 5.434
647 ctagctagctactatcatctctgc 349 24 0 45.83 58.562 27.80 0.00 0.00 5.438
648 gctagctagctactatcatctctg 348 24 0 45.83 58.562 34.38 6.79 46.11 5.438
649 gatcatcatcgatgctagctagta 519 24 0 41.67 58.557 22.18 18.77 40.32 5.443
650 gatcgatcatcatgctagctacta 272 24 0 41.67 58.557 21.11 0.00 0.00 5.443
651 atcatcatcgatgctagctagtag 520 24 0 41.67 58.554 2.13 0.00 40.32 5.446
652 atcgatcatcatgctagctactag 273 24 0 41.67 58.554 0.00 0.00 37.62 5.446
653 tagctagctactatcatctctgc 350 23 0 43.48 57.527 27.80 0.00 0.00 5.473
654 atcatcatcgatgctagctagta 520 23 0 39.13 57.514 22.18 18.77 40.32 5.486
655 atcgatcatcatgctagctacta 273 23 0 39.13 57.514 0.00 0.00 0.00 5.486
656 gatcatcatcgatgctagctagtag 519 25 0 44.00 59.494 0.21 0.00 40.32 5.506
657 gatcgatcatcatgctagctactag 272 25 0 44.00 59.494 21.11 0.00 37.62 5.506
658 actagctagctgatcatcatctact 211 25 0 40.00 59.471 22.43 6.99 0.00 5.529
659 tgactgatcgatcatcatgctagc 267 24 0 45.83 61.547 26.79 14.13 41.77 5.547
660 gctgactgatcgatcatcatgcta 265 24 0 45.83 61.547 27.72 16.42 41.77 5.547
661 tagctgactgatcgatcatcatgc 263 24 0 45.83 61.547 27.74 27.74 41.77 5.547
662 tgctagtagtgatgtatacgtagc 37 24 0 41.67 58.446 4.93 4.93 0.00 5.554
663 ctagctagctgactgatacgcga 465 23 0 52.17 62.571 14.90 0.00 0.00 5.571
664 tagctagctactatcatcgatcgat 428 25 0 40.00 59.423 27.80 25.37 35.13 5.577
665 gctactagctagctgatcatcatct 208 25 0 44.00 60.585 14.37 0.00 44.92 5.585
666 agctgatcatcatctagctagtagc 153 25 0 44.00 60.585 15.25 15.25 40.45 5.585
667 ctagctagctgatcgatcgatgtg 71 24 0 50.00 61.642 11.68 4.94 35.21 5.642
668 agtgatgcatgctagtagtgatgta 28 25 0 40.00 60.646 11.60 8.84 0.00 5.646
669 tagtgatgcatgctagtagtgatgt 27 25 0 40.00 60.646 11.60 0.00 0.00 5.646
670 actatcatctctgcgcgatcgat 359 23 0 47.83 62.652 22.07 11.47 38.48 5.652
671 ctatttagctagctgactgatcg 254 23 0 43.48 57.339 0.00 0.00 0.00 5.661
672 tagctagctgatcgatcgtagcg 561 23 0 52.17 62.677 27.20 18.31 0.00 5.677
673 gcatcggattagctagctgatgc 4 23 0 52.17 62.687 34.10 34.10 41.15 5.687
674 tgcatgctagtagtgatgtatacgt 33 25 0 40.00 60.700 20.79 0.00 0.00 5.700
675 tttagctagctgactgatcgatcat 257 25 0 40.00 60.702 26.67 18.02 36.62 5.702
676 atttagctagctgactgatcgatca 256 25 0 40.00 60.702 26.99 26.99 35.44 5.702
677 gctagctagctactatcatctct 348 23 0 43.48 57.266 34.38 0.00 46.11 5.734
678 aagcatcggattagctagctgatg 2 24 0 45.83 61.794 27.81 27.81 33.28 5.794
679 agtgatgtatacgtagctagtagc 44 24 0 41.67 58.201 15.25 15.25 45.79 5.799
680 gctagtagtgatgtatacgtagct 38 24 0 41.67 58.201 5.92 5.92 0.00 5.799
681 tagctagctgactgatcgatcgat 107 24 0 45.83 61.800 30.53 30.53 37.90 5.800
682 actagctagctgactgatacgcg 464 23 0 52.17 62.816 21.52 3.89 0.00 5.816
683 actagctagctgatcatcatctac 211 24 0 41.67 58.178 22.43 0.00 0.00 5.822
684 tagctgatcgatcgatgctagcta 396 24 0 45.83 61.857 34.98 33.55 41.05 5.857
685 tagctagctgatcgatcgatgcta 392 24 0 45.83 61.857 34.11 32.56 36.80 5.857
686 tatttagctagctgactgatcgat 255 24 0 37.50 58.112 1.68 0.00 0.00 5.888
687 gcatgctagtagtgatgtatacgta 34 25 0 40.00 59.089 11.60 0.00 0.00 5.911
688 tatttagctagctgactgatcgatc 255 25 0 40.00 59.084 19.32 19.32 0.00 5.916
689 ctatttagctagctgactgatcgat 254 25 0 40.00 59.082 0.00 0.00 0.00 5.918
690 ctagctagctactatcatctctgcg 349 25 0 48.00 60.920 27.80 5.75 0.00 5.920
691 tgatcgatcgatgctagctaggc 400 23 0 52.17 62.955 26.44 12.49 35.21 5.955
692 agctagctactgatcgatgctaca 303 24 0 45.83 61.988 17.56 3.03 0.00 5.988
693 tgactgatcgatcgatgctagcta 115 24 0 45.83 62.034 20.19 11.16 35.21 6.034
694 tagctgactgatcgatcgatgcta 111 24 0 45.83 62.034 33.43 30.74 35.21 6.034
695 catgctagtagtgatgtatacgtagc 35 26 0 42.31 59.961 4.93 4.93 0.00 6.039
696 gcatgctagtagtgatgtatacgtag 34 26 0 42.31 59.961 11.60 0.00 0.00 6.039
697 actgatcgatcgatgctagctagt 117 24 0 45.83 62.039 23.29 15.07 35.21 6.039
698 ctatttagctagctgactgatcgatc 254 26 0 42.31 59.960 19.32 19.32 0.00 6.040
699 ttagctagctgactgatcgatcatc 258 25 0 44.00 61.041 28.29 21.92 36.62 6.041
700 atgctagtagtgatgtatacgtagct 36 26 0 38.46 60.068 9.37 8.73 0.00 6.068
701 ctagctagctgatcatcatctact 212 24 0 41.67 57.930 11.68 6.99 0.00 6.070
702 ctactagctagctgatcatcatct 209 24 0 41.67 57.930 1.08 0.00 0.00 6.070
703 agctgatcatcatctagctagtag 153 24 0 41.67 57.930 7.49 3.73 40.45 6.070
704 ctagctgatcatcatctagctagt 151 24 0 41.67 57.930 21.70 5.56 46.15 6.070
705 tagctactatcatctctgcgcgat 354 24 0 45.83 62.096 4.99 2.52 0.00 6.096
706 gactgatcgatcatcatgctagcta 268 25 0 44.00 61.099 24.51 4.57 41.77 6.099
707 ctgatcatcatcgatgctagctagt 517 25 0 44.00 61.101 22.18 3.56 40.32 6.101
708 actagctagctgatcatcatcgatg 508 25 0 44.00 61.101 22.43 20.23 41.48 6.101
709 ctgatcgatcatcatgctagctact 270 25 0 44.00 61.101 26.67 0.00 41.77 6.101
710 atgctagtagtgatgtatacgtagc 36 25 0 40.00 58.855 4.93 4.93 0.00 6.145
711 ctagctagctactgatcgatgctac 301 25 0 48.00 61.145 14.00 7.81 0.00 6.145
712 gctagctagctactatcatctctgc 348 25 0 48.00 61.152 34.38 11.74 46.11 6.152
713 agctagctgatcatcatctactatca 214 26 0 38.46 59.840 17.99 0.00 0.00 6.160
714 ctgatcgatcgatgctagctagtag 118 25 0 48.00 61.197 19.70 5.49 35.21 6.197
715 agctagctgactgatcgatcatca 260 24 0 45.83 62.232 26.49 26.49 39.98 6.232
716 gctagctagctactatcatcgatcg 426 25 0 48.00 61.252 34.38 9.87 46.11 6.252
717 gctatttagctagctgactgatcga 253 25 0 44.00 61.268 7.27 0.00 46.11 6.268
718 ctagctagctactatcatcgatcgat 427 26 0 42.31 60.291 27.80 25.37 35.13 6.291
719 agctgatcatcgatgctactagct 194 24 0 45.83 62.294 24.11 23.60 45.92 6.294
720 agctagctgatcatcgatgctact 190 24 0 45.83 62.294 17.99 10.88 0.00 6.294
721 ctagctagctgactgatcgatcga 106 24 0 50.00 62.312 22.52 22.52 0.00 6.312
722 actgatcgatcatcatgctagctac 269 25 0 44.00 61.328 26.67 0.00 41.77 6.328
723 tgatgcatgctagtagtgatgtatac 30 26 0 38.46 59.623 9.19 6.43 0.00 6.377
724 gtgatgcatgctagtagtgatgtata 29 26 0 38.46 59.623 4.23 0.00 0.00 6.377
725 tactatcatctctgcgcgatcgat 358 24 0 45.83 62.379 22.07 11.47 38.48 6.379
726 gctagctgatcatcatctactatca 215 25 0 40.00 58.607 8.21 0.00 0.00 6.393
727 gctactagctagctgatcatcatcta 208 26 0 42.31 60.404 14.37 0.00 44.92 6.404
728 tagctgatcatcatctagctagtagc 152 26 0 42.31 60.404 15.25 15.25 41.48 6.404
729 tgctagtagtgatgtatacgtagcta 37 26 0 38.46 59.564 10.00 8.05 0.00 6.436
730 gatgcatgctagtagtgatgtatacg 31 26 0 42.31 60.453 7.40 0.00 0.00 6.453
731 tagtgatgcatgctagtagtgatgta 27 26 0 38.46 60.461 11.60 8.84 0.00 6.461
732 gctagtgatgcatgctagtagtgat 25 25 0 44.00 61.506 24.96 8.51 0.00 6.506
733 tgcatgctagtagtgatgtatacgta 33 26 0 38.46 60.515 20.79 0.00 0.00 6.515
734 tatttagctagctgactgatcgatca 255 26 0 38.46 60.516 26.99 26.99 35.44 6.516
735 tgatgcatgctagtagtgatgtata 30 25 0 36.00 58.479 4.13 0.00 0.00 6.521
736 tactagctagctgactgatacgcg 463 24 0 50.00 62.538 13.17 3.89 0.00 6.538
737 ctagctactatcatctctgcgcga 353 24 0 50.00 62.603 2.71 2.71 0.00 6.603
738 agctagctgatcatcatctactatc 214 25 0 40.00 58.369 17.99 0.00 0.00 6.631
739 agctagctgatcatcatctactat 214 24 0 37.50 57.345 17.99 0.00 0.00 6.655
740 gctactagctagctgatcatcatcg 505 25 0 48.00 61.656 14.37 0.00 44.92 6.656
741 gctgatcatcgatgctactagctag 195 25 0 48.00 61.656 20.91 20.04 45.92 6.656
742 ctagctgatcatcgatgctactagc 192 25 0 48.00 61.656 20.78 20.78 45.61 6.656
743 gctagctgatcatcgatgctactag 191 25 0 48.00 61.656 20.13 20.13 0.00 6.656
744 ctagctagctgatcatcgatgctac 188 25 0 48.00 61.656 17.82 12.06 0.00 6.656
745 actagctagctgatcatcatctacta 211 26 0 38.46 59.328 22.43 8.11 0.00 6.672
746 tactagctagctgatcatcatctact 210 26 0 38.46 59.328 6.99 6.99 0.00 6.672
747 ctactagctagctgatcatcatcgat 506 26 0 42.31 60.681 1.08 0.00 0.00 6.681
748 tagctagctactgatcgatgctaca 302 25 0 44.00 61.746 27.80 5.02 0.00 6.746
749 gtagtgatgtatacgtagctagtagc 42 26 0 42.31 59.249 15.25 15.25 45.79 6.751
750 actgatcgatcgatgctagctagta 117 25 0 44.00 61.797 23.29 18.77 35.21 6.797
751 gatgcatgctagtagtgatgtatac 31 25 0 40.00 58.175 20.79 1.70 0.00 6.825
752 agctgatcatcatcgatgctagct 515 24 0 45.83 62.835 23.00 22.41 41.74 6.835
753 agctagctgatcatcatcgatgct 511 24 0 45.83 62.835 17.99 8.34 40.32 6.835
754 ctagctagctgactgatacgcgat 465 24 0 50.00 62.838 14.90 0.00 0.00 6.838
755 atgcatgctagtagtgatgtatac 32 24 0 37.50 57.161 11.70 0.53 0.00 6.839
756 agctagctactatcatctctgcgc 351 24 0 50.00 62.858 17.56 0.00 0.00 6.858
757 gctagctagctactgatcgatgct 300 24 0 50.00 62.858 34.38 11.51 46.11 6.858
758 ctactatcatctctgcgcgatcga 357 24 0 50.00 62.878 22.07 1.72 38.48 6.878
759 gctagctactgatcgatgctacatc 304 25 0 48.00 61.879 11.21 4.40 37.97 6.879
760 tagtgatgtatacgtagctagtagc 43 25 0 40.00 58.104 15.25 15.25 45.79 6.896
761 gctagtagtgatgtatacgtagcta 38 25 0 40.00 58.104 7.24 5.34 0.00 6.896
762 tgatcatcatcgatgctagctagtag 518 26 0 42.31 60.902 14.93 0.00 40.32 6.902
763 ctgatcatcatcgatgctagctagta 517 26 0 42.31 60.902 22.18 18.77 40.32 6.902
764 tactagctagctgatcatcatcgatg 507 26 0 42.31 60.902 20.23 20.23 41.48 6.902
765 tgatcgatcatcatgctagctactag 271 26 0 42.31 60.902 27.48 0.00 37.38 6.902
766 ctgatcgatcatcatgctagctacta 270 26 0 42.31 60.902 26.67 1.37 41.77 6.902
767 agctgatcgatcgatgctagctag 397 24 0 50.00 62.904 31.26 19.90 40.03 6.904
768 ctagctgatcgatcgatgctagct 395 24 0 50.00 62.904 35.51 33.22 43.05 6.904
769 agctagctgatcgatcgatgctag 393 24 0 50.00 62.904 41.07 41.07 46.89 6.904
770 ctagctagctgatcgatcgatgct 391 24 0 50.00 62.904 33.87 33.38 38.16 6.904
771 tactagctagctgatcatcatctac 210 25 0 40.00 58.081 0.00 0.00 0.00 6.919
772 gctagctgatcatcatctactatc 215 24 0 41.67 57.062 8.21 0.00 0.00 6.938
773 agtgatgcatgctagtagtgatgtat 28 26 0 38.46 60.969 1.07 1.07 0.00 6.969
774 gctagtagtgatgtatacgtagctag 38 26 0 42.31 59.027 8.99 8.99 0.00 6.973
775 tagctagctgactgatcgatcatca 259 25 0 44.00 61.981 28.29 26.49 39.98 6.981
776 ctactagctagctgatcatcatctac 209 26 0 42.31 59.015 1.08 0.00 0.00 6.985
777 agtagtgatgtatacgtagctagt 41 24 0 37.50 57.012 8.68 8.68 0.00 6.988
778 gctagctgatcatcatctactatcat 215 26 0 38.46 59.001 8.21 0.00 0.00 6.999
779 agctgatcatcatctactatcatca 218 25 0 36.00 57.993 0.00 0.00 0.00 7.007
780 atgcatgctagtagtgatgtatacgt 32 26 0 38.46 61.018 11.70 0.00 0.00 7.018
781 atttagctagctgactgatcgatcat 256 26 0 38.46 61.022 26.67 18.02 36.62 7.022
782 agctgatcatcgatgctactagcta 194 25 0 44.00 62.040 24.59 9.79 45.92 7.040
783 tagctgatcatcgatgctactagct 193 25 0 44.00 62.040 27.00 27.00 45.92 7.040
784 agctagctgatcatcgatgctacta 190 25 0 44.00 62.040 17.99 11.59 0.00 7.040
785 tagctagctgatcatcgatgctact 189 25 0 44.00 62.040 17.55 15.53 0.00 7.040
786 atgctagtagtgatgtatacgtagcta 36 27 0 37.04 59.911 10.00 8.05 0.00 7.089
787 gctagctgatcatcatctactatcatc 215 27 0 40.74 59.861 8.21 0.00 0.00 7.139
788 ctagctagctgatcatcatctacta 212 25 0 40.00 57.842 11.68 8.11 0.00 7.158
789 ctactagctagctgatcatcatcta 209 25 0 40.00 57.842 1.08 0.00 0.00 7.158
790 tagctgatcatcatctagctagtag 152 25 0 40.00 57.842 13.40 3.73 41.48 7.158
791 ctagctgatcatcatctagctagta 151 25 0 40.00 57.842 21.70 7.13 46.15 7.158
792 gctgatcatcatcgatgctagctag 516 25 0 48.00 62.165 20.15 17.46 40.32 7.165
793 ctagctgatcatcatcgatgctagc 513 25 0 48.00 62.165 19.27 19.26 41.96 7.165
794 gctagctgatcatcatcgatgctag 512 25 0 48.00 62.165 23.70 23.70 45.51 7.165
795 ctagctagctgatcatcatcgatgc 509 25 0 48.00 62.165 21.42 7.40 40.32 7.165
796 agctagctgatcatcatctactatcat 214 27 0 37.04 60.181 17.99 0.00 0.00 7.181
797 ctactagctagctgatcatcatctact 209 27 0 40.74 60.181 6.99 6.99 0.00 7.181
798 ctagctgatcatcatctagctagtag 151 26 0 42.31 58.789 21.70 10.73 46.15 7.211
799 aaagcatcggattagctagctgatg 1 25 0 44.00 62.249 27.81 27.81 33.28 7.249
800 agctagctactgatcgatgctacat 303 25 0 44.00 62.272 17.56 6.16 0.00 7.272
801 tagctagctgatcatcatctactatca 213 27 0 37.04 59.689 8.31 0.00 0.00 7.311
802 actagctagctgatcatcatctactat 211 27 0 37.04 59.688 22.43 2.36 0.00 7.312
803 ctgactgatcgatcatcatgctagc 266 25 0 48.00 62.333 20.99 8.86 41.77 7.333
804 gctgactgatcgatcatcatgctag 265 25 0 48.00 62.333 27.72 21.73 41.77 7.333
805 ctagctgactgatcgatcatcatgc 262 25 0 48.00 62.333 27.74 27.74 41.77 7.333
806 gctagctgactgatcgatcatcatg 261 25 0 48.00 62.333 22.70 19.51 41.77 7.333
807 tgctagtagtgatgtatacgtagctag 37 27 0 40.74 60.395 8.99 8.99 0.00 7.395
808 agtagtgatgtatacgtagctagtagc 41 27 0 40.74 60.395 15.25 15.25 45.79 7.395
809 gctagtagtgatgtatacgtagctagt 38 27 0 40.74 60.395 15.55 15.55 0.00 7.395
810 ctagtgatgcatgctagtagtgatgt 26 26 0 42.31 61.460 20.00 0.00 0.00 7.460
811 gctgatcatcatctactatcatcatca 219 27 0 37.04 59.533 0.00 0.00 0.00 7.467
812 agctagctgactgatcgatcatcat 260 25 0 44.00 62.507 26.31 20.43 41.77 7.507
813 tttagctagctgactgatcgatcatc 257 26 0 42.31 61.507 23.93 21.92 36.62 7.507
814 catgctagtagtgatgtatacgtag 35 25 0 40.00 57.441 4.74 0.00 0.00 7.559
815 agctgatcatcatcgatgctagcta 515 25 0 44.00 62.561 23.50 10.90 43.19 7.561
816 tagctgatcatcatcgatgctagct 514 25 0 44.00 62.561 26.21 26.21 44.79 7.561
817 agctagctgatcatcatcgatgcta 511 25 0 44.00 62.561 17.99 9.63 40.32 7.561
818 tagctagctgatcatcatcgatgct 510 25 0 44.00 62.561 14.14 10.38 40.32 7.561
819 gctatttagctagctgactgatcgat 253 26 0 42.31 61.564 7.27 0.00 46.11 7.564
820 ctagctagctgactgatcgatcgat 106 25 0 48.00 62.579 30.53 30.53 37.90 7.579
821 agctgatcatcatctactatcatcat 218 26 0 34.62 58.415 0.00 0.00 0.00 7.585
822 tagctagctactatcatctctgcgc 350 25 0 48.00 62.587 27.80 0.00 0.00 7.587
823 gctagctagctactgatcgatgcta 300 25 0 48.00 62.587 34.38 12.23 46.11 7.587
824 tgctagtgatgcatgctagtagtga 24 25 0 44.00 62.622 24.96 13.57 35.89 7.622
825 tagctgatcgatcgatgctagctag 396 25 0 48.00 62.632 33.71 21.46 41.05 7.632
826 ctagctgatcgatcgatgctagcta 395 25 0 48.00 62.632 35.51 32.61 43.05 7.632
827 tagctagctgatcgatcgatgctag 392 25 0 48.00 62.632 41.07 41.07 46.89 7.632
828 ctagctagctgatcgatcgatgcta 391 25 0 48.00 62.632 34.11 32.56 36.80 7.632
829 gtgatgcatgctagtagtgatgtatac 29 27 0 40.74 60.659 9.56 7.17 0.00 7.659
830 agctgatcatcatctactatcatcatc 218 27 0 37.04 59.314 0.00 0.00 0.00 7.686
831 tagctagctgatcatcatctactat 213 25 0 36.00 57.279 8.31 0.00 0.00 7.721
832 tagctagctgatcatcatctactatc 213 26 0 38.46 58.269 8.31 0.00 0.00 7.731
833 tgactgatcgatcatcatgctagct 267 25 0 44.00 62.733 26.79 10.55 41.77 7.733
834 agctgactgatcgatcatcatgcta 264 25 0 44.00 62.733 30.60 18.10 41.77 7.733
835 tagctgactgatcgatcatcatgct 263 25 0 44.00 62.733 32.31 32.31 41.77 7.733
836 ctagctagctgatcatcatctactat 212 26 0 38.46 58.265 9.41 0.00 0.00 7.735
837 agtgatgcatgctagtagtgatgtata 28 27 0 37.04 60.779 4.23 0.00 0.00 7.779
838 tagtgatgcatgctagtagtgatgtat 27 27 0 37.04 60.779 11.56 0.00 0.00 7.779
839 tgactgatcgatcgatgctagctag 115 25 0 48.00 62.800 20.19 17.46 35.21 7.800
840 ctgactgatcgatcgatgctagcta 114 25 0 48.00 62.800 20.19 11.97 35.21 7.800
841 tagctgactgatcgatcgatgctag 111 25 0 48.00 62.800 31.45 26.34 35.21 7.800
842 ctagctgactgatcgatcgatgcta 110 25 0 48.00 62.800 31.54 29.68 35.21 7.800
843 tagctagctgactgatcgatcgatg 107 25 0 48.00 62.800 28.29 13.21 35.21 7.800
844 gactgatcgatcgatgctagctagt 116 25 0 48.00 62.802 22.18 12.64 35.21 7.802
845 tactagctagctgatcatcatctacta 210 27 0 37.04 59.196 8.79 8.11 0.00 7.804
846 tagctgatcatcgatgctactagcta 193 26 0 42.31 61.805 28.86 27.39 45.92 7.805
847 tagctagctgatcatcgatgctacta 189 26 0 42.31 61.805 18.93 16.03 0.00 7.805
848 atgcatgctagtagtgatgtatacgta 32 27 0 37.04 60.828 11.70 0.00 0.00 7.828
849 tatttagctagctgactgatcgatcat 255 27 0 37.04 60.831 26.67 18.02 36.62 7.831
850 ctagctagctgatcatcatctactatc 212 27 0 40.74 59.162 9.41 0.06 0.00 7.838
851 tagctactatcatctctgcgcgatc 354 25 0 48.00 62.854 0.00 0.00 0.00 7.854
852 gctgatcatcatctactatcatcat 219 25 0 36.00 57.142 0.00 0.00 0.00 7.858
853 ctagctactatcatctctgcgcgat 353 25 0 48.00 62.859 4.99 2.52 0.00 7.859
854 gctgatcatcatctactatcatcatc 219 26 0 38.46 58.126 0.00 0.00 0.00 7.874
855 tagctagctactgatcgatgctacat 302 26 0 42.31 62.028 27.80 3.08 0.00 8.028
856 agtagtgatgtatacgtagctagtag 41 26 0 38.46 57.950 9.92 1.30 0.00 8.050
857 ctagtagtgatgtatacgtagctagt 39 26 0 38.46 57.950 15.52 15.52 0.00 8.050
858 catgctagtagtgatgtatacgtagct 35 27 0 40.74 61.089 9.37 8.73 0.00 8.089
859 gactgatcgatcatcatgctagctac 268 26 0 46.15 62.094 24.51 8.36 41.77 8.094
860 tagctgatcatcatctactatcatca 217 26 0 34.62 57.906 0.00 0.00 0.00 8.094
861 ctagctgatcatcatctactatcatca 216 27 0 37.04 58.826 0.00 0.00 0.00 8.174
862 ctagctgatcatcatctagctagtagc 151 27 0 44.44 61.196 21.70 15.25 46.15 8.196
863 tagctagctgactgatcgatcatcat 259 26 0 42.31 62.255 28.29 20.43 41.77 8.255
864 ctagtgatgcatgctagtagtgatgta 26 27 0 40.74 61.255 20.00 8.84 0.00 8.255
865 tgcatgctagtagtgatgtatacgtag 33 27 0 40.74 61.300 20.79 0.00 0.00 8.300
866 ctatttagctagctgactgatcgatca 254 27 0 40.74 61.304 26.99 26.99 35.44 8.304
867 tagctgatcatcatcgatgctagcta 514 26 0 42.31 62.307 28.23 26.63 43.19 8.307
868 tagctagctgatcatcatcgatgcta 510 26 0 42.31 62.307 14.58 11.03 40.32 8.307
869 gctagctagctactatcatcgatcga 426 26 0 46.15 62.381 34.38 22.52 46.11 8.381
870 gctactagctagctgatcatcatctac 208 27 0 44.44 61.407 14.37 0.00 44.92 8.407
871 ttagctagctgactgatcgatcatca 258 26 0 42.31 62.416 28.29 26.49 39.98 8.416
872 tgactgatcgatcatcatgctagcta 267 26 0 42.31 62.472 26.79 11.24 41.77 8.472
873 tagctgactgatcgatcatcatgcta 263 26 0 42.31 62.472 33.83 32.61 41.77 8.472
874 actgatcgatcatcatgctagctact 269 26 0 42.31 62.478 26.67 0.00 41.77 8.478
875 gctagtgatgcatgctagtagtgatg 25 26 0 46.15 62.484 24.96 9.07 0.00 8.484
876 ctagctagctactgatcgatgctaca 301 26 0 46.15 62.503 14.00 5.87 0.00 8.503
877 gactgatcgatcgatgctagctagta 116 26 0 46.15 62.543 22.18 18.77 35.21 8.543
878 actgatcgatcgatgctagctagtag 117 26 0 46.15 62.548 23.29 12.42 35.21 8.548
879 ctagctgatcatcatctactatcatc 216 26 0 38.46 57.395 0.00 0.00 0.00 8.605
880 ctgatcatcatcgatgctagctagtag 517 27 0 44.44 61.665 10.30 1.36 40.32 8.665
881 ctactagctagctgatcatcatcgatg 506 27 0 44.44 61.665 20.23 20.23 41.48 8.665
882 ctgatcgatcatcatgctagctactag 270 27 0 44.44 61.665 26.67 8.14 41.77 8.665
883 tagctgatcatcatctactatcatcat 217 27 0 33.33 58.315 0.00 0.00 0.00 8.685
884 tgatgcatgctagtagtgatgtatacg 30 27 0 40.74 61.778 9.81 0.00 0.00 8.778
885 gatgcatgctagtagtgatgtatacgt 31 27 0 40.74 61.779 7.40 0.00 0.00 8.779
886 gctactagctagctgatcatcatcga 505 26 0 46.15 62.779 14.37 0.00 44.92 8.779
887 agctgatcatcgatgctactagctag 194 26 0 46.15 62.784 24.59 20.04 45.92 8.784
888 ctagctgatcatcgatgctactagct 192 26 0 46.15 62.784 27.00 27.00 45.92 8.784
889 agctagctgatcatcgatgctactag 190 26 0 46.15 62.784 20.13 20.13 0.00 8.784
890 ctagctagctgatcatcgatgctact 188 26 0 46.15 62.784 17.55 15.53 0.00 8.784
891 atttagctagctgactgatcgatcatc 256 27 0 40.74 61.785 23.93 21.92 36.62 8.785
892 tctactatcatcatcatctactagct 230 26 0 34.62 57.155 0.00 0.00 0.00 8.845
893 tgctagtgatgcatgctagtagtgat 24 26 0 42.31 62.874 24.96 8.51 35.89 8.874
894 ctgatcatcatctactatcatcatca 220 26 0 34.62 57.026 0.00 0.00 0.00 8.974
895 agctagctactgatcgatgctacatc 303 26 0 46.15 62.999 17.56 7.89 37.97 8.999
896 tagtagtgatgtatacgtagctagtag 40 27 0 37.04 57.869 16.78 1.30 0.00 9.131
897 ctagtagtgatgtatacgtagctagta 39 27 0 37.04 57.869 16.85 15.97 0.00 9.131
898 actgatcgatcatcatgctagctacta 269 27 0 40.74 62.236 26.67 1.37 41.77 9.236
899 gcatgctagtagtgatgtatacgtagc 34 27 0 44.44 62.283 11.60 4.93 0.00 9.283
900 gctatttagctagctgactgatcgatc 253 27 0 44.44 62.291 19.32 19.32 46.11 9.291
901 atctactatcatcatcatctactagct 229 27 0 33.33 57.592 0.00 0.00 0.00 9.408
902 catctactatcatcatcatctactagc 228 27 0 37.04 57.549 0.00 0.00 0.00 9.451
903 tgatcatcatctactatcatcatcatc 221 27 0 33.33 57.467 0.00 0.00 0.00 9.533
904 tagctgatcatcgatgctactagctag 193 27 0 44.44 62.534 27.70 20.04 45.92 9.534
905 ctagctgatcatcgatgctactagcta 192 27 0 44.44 62.534 27.76 26.73 45.92 9.534
906 tagctagctgatcatcgatgctactag 189 27 0 44.44 62.534 20.13 20.13 0.00 9.534
907 ctagctagctgatcatcgatgctacta 188 27 0 44.44 62.534 17.74 15.95 0.00 9.534
908 ctgatcatcatctactatcatcatcat 220 27 0 33.33 57.462 0.00 0.00 0.00 9.538
909 gctagctagctactatcatcgatcgat 426 27 0 44.44 62.627 34.38 25.37 46.11 9.627
910 ttagctagctgactgatcgatcatcat 258 27 0 40.74 62.665 28.29 20.43 41.77 9.665
911 tagctagctactgatcgatgctacatc 302 27 0 44.44 62.742 27.80 7.89 37.97 9.742
912 ctagctagctactgatcgatgctacat 301 27 0 44.44 62.747 14.00 2.51 0.00 9.747
913 gatcatcatctactatcatcatcatct 222 27 0 33.33 57.242 0.00 0.00 0.00 9.758
914 tttagctagctgactgatcgatcatca 257 27 0 40.74 62.820 26.49 26.49 39.98 9.820
915 tctactatcatcatcatctactagcta 230 27 0 33.33 57.100 0.00 0.00 0.00 9.900

File diff suppressed because it is too large Load Diff

File diff suppressed because it is too large Load Diff

File diff suppressed because it is too large Load Diff

91
samples/GAS/hello.ms Normal file
View File

@@ -0,0 +1,91 @@
# output(): Hello, world.\n
# mach(): all
# Emit hello world while switching back and forth between arm/thumb.
# ??? Unfinished
.macro invalid
# This is "undefined" but it's not properly decoded yet.
.word 0x07ffffff
# This is stc which isn't recognized yet.
stc 0,cr0,[r0]
.endm
.global _start
_start:
# Run some simple insns to confirm the engine is at least working.
nop
# Skip over output text.
bl skip_output
hello_text:
.asciz "Hello, world.\n"
.p2align 2
skip_output:
# Prime loop.
mov r4, r14
output_next:
# Switch arm->thumb to output next chacter.
# At this point r4 must point to the next character to output.
adr r0, into_thumb + 1
bx r0
into_thumb:
.thumb
# Output a character.
mov r0,#3 @ writec angel call
mov r1,r4
swi 0xab @ ??? Confirm number.
# Switch thumb->arm.
adr r5, back_to_arm
bx r5
.p2align 2
back_to_arm:
.arm
# Load next character, see if done.
add r4,r4,#1
sub r3,r3,r3
ldrb r5,[r4,r3]
teq r5,#0
beq done
# Output a character (in arm mode).
mov r0,#3
mov r1,r4
swi #0x123456
# Load next character, see if done.
add r4,r4,#1
sub r3,r3,r3
ldrb r5,[r4,r3]
teq r5,#0
bne output_next
done:
mov r0,#0x18
ldr r1,exit_code
swi #0x123456
# If that fails, try to die with an invalid insn.
invalid
exit_code:
.word 0x20026

1157
samples/Go/api.pb.go Normal file

File diff suppressed because it is too large Load Diff

852
samples/Go/embedded.go Normal file

File diff suppressed because one or more lines are too long

View File

@@ -0,0 +1,18 @@
// Autogenerated by Thrift Compiler (1.0.0-dev)
// DO NOT EDIT UNLESS YOU ARE SURE THAT YOU KNOW WHAT YOU ARE DOING
package linguist
import (
"bytes"
"fmt"
"git.apache.org/thrift.git/lib/go/thrift"
)
// (needed to ensure safety because of naive import list construction.)
var _ = thrift.ZERO
var _ = fmt.Printf
var _ = bytes.Equal
func init() {
}

275
samples/Groff/Tcl.n Normal file
View File

@@ -0,0 +1,275 @@
'\"
'\" Copyright (c) 1993 The Regents of the University of California.
'\" Copyright (c) 1994-1996 Sun Microsystems, Inc.
'\"
'\" See the file "license.terms" for information on usage and redistribution
'\" of this file, and for a DISCLAIMER OF ALL WARRANTIES.
'\"
.TH Tcl n "8.6" Tcl "Tcl Built-In Commands"
.so man.macros
.BS
.SH NAME
Tcl \- Tool Command Language
.SH SYNOPSIS
Summary of Tcl language syntax.
.BE
.SH DESCRIPTION
.PP
The following rules define the syntax and semantics of the Tcl language:
.IP "[1] \fBCommands.\fR"
A Tcl script is a string containing one or more commands.
Semi-colons and newlines are command separators unless quoted as
described below.
Close brackets are command terminators during command substitution
(see below) unless quoted.
.IP "[2] \fBEvaluation.\fR"
A command is evaluated in two steps.
First, the Tcl interpreter breaks the command into \fIwords\fR
and performs substitutions as described below.
These substitutions are performed in the same way for all
commands.
Secondly, the first word is used to locate a command procedure to
carry out the command, then all of the words of the command are
passed to the command procedure.
The command procedure is free to interpret each of its words
in any way it likes, such as an integer, variable name, list,
or Tcl script.
Different commands interpret their words differently.
.IP "[3] \fBWords.\fR"
Words of a command are separated by white space (except for
newlines, which are command separators).
.IP "[4] \fBDouble quotes.\fR"
If the first character of a word is double-quote
.PQ \N'34'
then the word is terminated by the next double-quote character.
If semi-colons, close brackets, or white space characters
(including newlines) appear between the quotes then they are treated
as ordinary characters and included in the word.
Command substitution, variable substitution, and backslash substitution
are performed on the characters between the quotes as described below.
The double-quotes are not retained as part of the word.
.IP "[5] \fBArgument expansion.\fR"
If a word starts with the string
.QW {*}
followed by a non-whitespace character, then the leading
.QW {*}
is removed and the rest of the word is parsed and substituted as any other
word. After substitution, the word is parsed as a list (without command or
variable substitutions; backslash substitutions are performed as is normal for
a list and individual internal words may be surrounded by either braces or
double-quote characters), and its words are added to the command being
substituted. For instance,
.QW "cmd a {*}{b [c]} d {*}{$e f {g h}}"
is equivalent to
.QW "cmd a b {[c]} d {$e} f {g h}" .
.IP "[6] \fBBraces.\fR"
If the first character of a word is an open brace
.PQ {
and rule [5] does not apply, then
the word is terminated by the matching close brace
.PQ } "" .
Braces nest within the word: for each additional open
brace there must be an additional close brace (however,
if an open brace or close brace within the word is
quoted with a backslash then it is not counted in locating the
matching close brace).
No substitutions are performed on the characters between the
braces except for backslash-newline substitutions described
below, nor do semi-colons, newlines, close brackets,
or white space receive any special interpretation.
The word will consist of exactly the characters between the
outer braces, not including the braces themselves.
.IP "[7] \fBCommand substitution.\fR"
If a word contains an open bracket
.PQ [
then Tcl performs \fIcommand substitution\fR.
To do this it invokes the Tcl interpreter recursively to process
the characters following the open bracket as a Tcl script.
The script may contain any number of commands and must be terminated
by a close bracket
.PQ ] "" .
The result of the script (i.e. the result of its last command) is
substituted into the word in place of the brackets and all of the
characters between them.
There may be any number of command substitutions in a single word.
Command substitution is not performed on words enclosed in braces.
.IP "[8] \fBVariable substitution.\fR"
If a word contains a dollar-sign
.PQ $
followed by one of the forms
described below, then Tcl performs \fIvariable
substitution\fR: the dollar-sign and the following characters are
replaced in the word by the value of a variable.
Variable substitution may take any of the following forms:
.RS
.TP 15
\fB$\fIname\fR
.
\fIName\fR is the name of a scalar variable; the name is a sequence
of one or more characters that are a letter, digit, underscore,
or namespace separators (two or more colons).
Letters and digits are \fIonly\fR the standard ASCII ones (\fB0\fR\(en\fB9\fR,
\fBA\fR\(en\fBZ\fR and \fBa\fR\(en\fBz\fR).
.TP 15
\fB$\fIname\fB(\fIindex\fB)\fR
.
\fIName\fR gives the name of an array variable and \fIindex\fR gives
the name of an element within that array.
\fIName\fR must contain only letters, digits, underscores, and
namespace separators, and may be an empty string.
Letters and digits are \fIonly\fR the standard ASCII ones (\fB0\fR\(en\fB9\fR,
\fBA\fR\(en\fBZ\fR and \fBa\fR\(en\fBz\fR).
Command substitutions, variable substitutions, and backslash
substitutions are performed on the characters of \fIindex\fR.
.TP 15
\fB${\fIname\fB}\fR
.
\fIName\fR is the name of a scalar variable or array element. It may contain
any characters whatsoever except for close braces. It indicates an array
element if \fIname\fR is in the form
.QW \fIarrayName\fB(\fIindex\fB)\fR
where \fIarrayName\fR does not contain any open parenthesis characters,
.QW \fB(\fR ,
or close brace characters,
.QW \fB}\fR ,
and \fIindex\fR can be any sequence of characters except for close brace
characters. No further
substitutions are performed during the parsing of \fIname\fR.
.PP
There may be any number of variable substitutions in a single word.
Variable substitution is not performed on words enclosed in braces.
.PP
Note that variables may contain character sequences other than those listed
above, but in that case other mechanisms must be used to access them (e.g.,
via the \fBset\fR command's single-argument form).
.RE
.IP "[9] \fBBackslash substitution.\fR"
If a backslash
.PQ \e
appears within a word then \fIbackslash substitution\fR occurs.
In all cases but those described below the backslash is dropped and
the following character is treated as an ordinary
character and included in the word.
This allows characters such as double quotes, close brackets,
and dollar signs to be included in words without triggering
special processing.
The following table lists the backslash sequences that are
handled specially, along with the value that replaces each sequence.
.RS
.TP 7
\e\fBa\fR
Audible alert (bell) (Unicode U+000007).
.TP 7
\e\fBb\fR
Backspace (Unicode U+000008).
.TP 7
\e\fBf\fR
Form feed (Unicode U+00000C).
.TP 7
\e\fBn\fR
Newline (Unicode U+00000A).
.TP 7
\e\fBr\fR
Carriage-return (Unicode U+00000D).
.TP 7
\e\fBt\fR
Tab (Unicode U+000009).
.TP 7
\e\fBv\fR
Vertical tab (Unicode U+00000B).
.TP 7
\e\fB<newline>\fIwhiteSpace\fR
.
A single space character replaces the backslash, newline, and all spaces
and tabs after the newline. This backslash sequence is unique in that it
is replaced in a separate pre-pass before the command is actually parsed.
This means that it will be replaced even when it occurs between braces,
and the resulting space will be treated as a word separator if it is not
in braces or quotes.
.TP 7
\e\e
Backslash
.PQ \e "" .
.TP 7
\e\fIooo\fR
.
The digits \fIooo\fR (one, two, or three of them) give a eight-bit octal
value for the Unicode character that will be inserted, in the range
\fI000\fR\(en\fI377\fR (i.e., the range U+000000\(enU+0000FF).
The parser will stop just before this range overflows, or when
the maximum of three digits is reached. The upper bits of the Unicode
character will be 0.
.TP 7
\e\fBx\fIhh\fR
.
The hexadecimal digits \fIhh\fR (one or two of them) give an eight-bit
hexadecimal value for the Unicode character that will be inserted. The upper
bits of the Unicode character will be 0 (i.e., the character will be in the
range U+000000\(enU+0000FF).
.TP 7
\e\fBu\fIhhhh\fR
.
The hexadecimal digits \fIhhhh\fR (one, two, three, or four of them) give a
sixteen-bit hexadecimal value for the Unicode character that will be
inserted. The upper bits of the Unicode character will be 0 (i.e., the
character will be in the range U+000000\(enU+00FFFF).
.TP 7
\e\fBU\fIhhhhhhhh\fR
.
The hexadecimal digits \fIhhhhhhhh\fR (one up to eight of them) give a
twenty-one-bit hexadecimal value for the Unicode character that will be
inserted, in the range U+000000\(enU+10FFFF. The parser will stop just
before this range overflows, or when the maximum of eight digits
is reached. The upper bits of the Unicode character will be 0.
.RS
.PP
The range U+010000\(enU+10FFFD is reserved for the future.
.RE
.PP
Backslash substitution is not performed on words enclosed in braces,
except for backslash-newline as described above.
.RE
.IP "[10] \fBComments.\fR"
If a hash character
.PQ #
appears at a point where Tcl is
expecting the first character of the first word of a command,
then the hash character and the characters that follow it, up
through the next newline, are treated as a comment and ignored.
The comment character only has significance when it appears
at the beginning of a command.
.IP "[11] \fBOrder of substitution.\fR"
Each character is processed exactly once by the Tcl interpreter
as part of creating the words of a command.
For example, if variable substitution occurs then no further
substitutions are performed on the value of the variable; the
value is inserted into the word verbatim.
If command substitution occurs then the nested command is
processed entirely by the recursive call to the Tcl interpreter;
no substitutions are performed before making the recursive
call and no additional substitutions are performed on the result
of the nested script.
.RS
.PP
Substitutions take place from left to right, and each substitution is
evaluated completely before attempting to evaluate the next. Thus, a
sequence like
.PP
.CS
set y [set x 0][incr x][incr x]
.CE
.PP
will always set the variable \fIy\fR to the value, \fI012\fR.
.RE
.IP "[12] \fBSubstitution and word boundaries.\fR"
Substitutions do not affect the word boundaries of a command,
except for argument expansion as specified in rule [5].
For example, during variable substitution the entire value of
the variable becomes part of a single word, even if the variable's
value contains spaces.
.SH KEYWORDS
backslash, command, comment, script, substitution, variable
'\" Local Variables:
'\" mode: nroff
'\" fill-column: 78
'\" End:

135
samples/Groff/create_view.l Normal file
View File

@@ -0,0 +1,135 @@
.\\" auto-generated by docbook2man-spec $Revision: 1.1.1.1 $
.TH "CREATE VIEW" "" "2005-11-05" "SQL - Language Statements" "SQL Commands"
.SH NAME
CREATE VIEW \- define a new view
.SH SYNOPSIS
.sp
.nf
CREATE [ OR REPLACE ] [ TEMP | TEMPORARY ] VIEW \fIname\fR [ ( \fIcolumn_name\fR [, ...] ) ]
AS \fIquery\fR
.sp
.fi
.SH "DESCRIPTION"
.PP
\fBCREATE VIEW\fR defines a view of a query. The view
is not physically materialized. Instead, the query is run every time
the view is referenced in a query.
.PP
\fBCREATE OR REPLACE VIEW\fR is similar, but if a view
of the same name already exists, it is replaced. You can only replace
a view with a new query that generates the identical set of columns
(i.e., same column names and data types).
.PP
If a schema name is given (for example, CREATE VIEW
myschema.myview ...) then the view is created in the specified
schema. Otherwise it is created in the current schema. Temporary
views exist in a special schema, so a schema name may not be given
when creating a temporary view. The name of the view must be
distinct from the name of any other view, table, sequence, or index
in the same schema.
.SH "PARAMETERS"
.TP
\fBTEMPORARY or TEMP\fR
If specified, the view is created as a temporary view.
Temporary views are automatically dropped at the end of the
current session. Existing
permanent relations with the same name are not visible to the
current session while the temporary view exists, unless they are
referenced with schema-qualified names.
If any of the tables referenced by the view are temporary,
the view is created as a temporary view (whether
TEMPORARY is specified or not).
.TP
\fB\fIname\fB\fR
The name (optionally schema-qualified) of a view to be created.
.TP
\fB\fIcolumn_name\fB\fR
An optional list of names to be used for columns of the view.
If not given, the column names are deduced from the query.
.TP
\fB\fIquery\fB\fR
A query (that is, a \fBSELECT\fR statement) which will
provide the columns and rows of the view.
Refer to SELECT [\fBselect\fR(l)]
for more information about valid queries.
.SH "NOTES"
.PP
Currently, views are read only: the system will not allow an insert,
update, or delete on a view. You can get the effect of an updatable
view by creating rules that rewrite inserts, etc. on the view into
appropriate actions on other tables. For more information see
CREATE RULE [\fBcreate_rule\fR(l)].
.PP
Use the DROP VIEW [\fBdrop_view\fR(l)]
statement to drop views.
.PP
Be careful that the names and types of the view's columns will be
assigned the way you want. For example,
.sp
.nf
CREATE VIEW vista AS SELECT 'Hello World';
.sp
.fi
is bad form in two ways: the column name defaults to ?column?,
and the column data type defaults to \fBunknown\fR. If you want a
string literal in a view's result, use something like
.sp
.nf
CREATE VIEW vista AS SELECT text 'Hello World' AS hello;
.sp
.fi
.PP
Access to tables referenced in the view is determined by permissions of
the view owner. However, functions called in the view are treated the
same as if they had been called directly from the query using the view.
Therefore the user of a view must have permissions to call all functions
used by the view.
.SH "EXAMPLES"
.PP
Create a view consisting of all comedy films:
.sp
.nf
CREATE VIEW comedies AS
SELECT *
FROM films
WHERE kind = 'Comedy';
.sp
.fi
.SH "COMPATIBILITY"
.PP
The SQL standard specifies some additional capabilities for the
\fBCREATE VIEW\fR statement:
.sp
.nf
CREATE VIEW \fIname\fR [ ( \fIcolumn_name\fR [, ...] ) ]
AS \fIquery\fR
[ WITH [ CASCADED | LOCAL ] CHECK OPTION ]
.sp
.fi
.PP
The optional clauses for the full SQL command are:
.TP
\fBCHECK OPTION\fR
This option has to do with updatable views. All
\fBINSERT\fR and \fBUPDATE\fR commands on the view
will be checked to ensure data satisfy the view-defining
condition (that is, the new data would be visible through the
view). If they do not, the update will be rejected.
.TP
\fBLOCAL\fR
Check for integrity on this view.
.TP
\fBCASCADED\fR
Check for integrity on this view and on any dependent
view. CASCADED is assumed if neither
CASCADED nor LOCAL is specified.
.PP
.PP
\fBCREATE OR REPLACE VIEW\fR is a
PostgreSQL language extension.
So is the concept of a temporary view.
.SH "SEE ALSO"
DROP VIEW [\fBdrop_view\fR(l)]

1174
samples/Groff/fsinterface.ms Normal file

File diff suppressed because it is too large Load Diff

31
samples/HTML/rpanel.inc Normal file
View File

@@ -0,0 +1,31 @@
<!DOCTYPE html>
<html>
<head>
<link rel="stylesheet" charset="UTF-8" type="text/css" href="main.css">
<meta charset="UTF-8">
</head>
<body>
<div id="panel_header_main_form">
<p id="panel_header_main_form_title">Поддержка:</p>
</div>
<table>
<tbody>
<tr>
<td>
<p>Москва:</p>
</td>
<td>
<p>+7-902-7-800-807</p>
</td>
</tr>
<tr>
<td>
<p>Регионы:</p>
</td>
<td>
<p>+7-902-7-800-807</p>
</td>
</tr>
</tbody>
</table>
</body>

5
samples/HTML/tailDel.inc Normal file
View File

@@ -0,0 +1,5 @@
</UL>
<P><A HREF="devices.html">Supported Targets</A></P>
</BODY>
</HEAD>

114
samples/Haskell/HsColour.hs Normal file
View File

@@ -0,0 +1,114 @@
-- | This is a library which colourises Haskell code.
-- It currently has six output formats:
--
-- * ANSI terminal codes
--
-- * LaTeX macros
--
-- * HTML 3.2 with font tags
--
-- * HTML 4.01 with external CSS.
--
-- * XHTML 1.0 with internal CSS.
--
-- * mIRC chat client colour codes.
--
module Language.Haskell.HsColour (Output(..), ColourPrefs(..),
hscolour) where
import Language.Haskell.HsColour.Colourise (ColourPrefs(..))
import qualified Language.Haskell.HsColour.TTY as TTY
import qualified Language.Haskell.HsColour.HTML as HTML
import qualified Language.Haskell.HsColour.CSS as CSS
import qualified Language.Haskell.HsColour.ACSS as ACSS
import qualified Language.Haskell.HsColour.InlineCSS as ICSS
import qualified Language.Haskell.HsColour.LaTeX as LaTeX
import qualified Language.Haskell.HsColour.MIRC as MIRC
import Data.List(mapAccumL, isPrefixOf)
import Data.Maybe
import Language.Haskell.HsColour.Output
--import Debug.Trace
-- | Colourise Haskell source code with the given output format.
hscolour :: Output -- ^ Output format.
-> ColourPrefs -- ^ Colour preferences (for formats that support them).
-> Bool -- ^ Whether to include anchors.
-> Bool -- ^ Whether output document is partial or complete.
-> String -- ^ Title for output.
-> Bool -- ^ Whether input document is literate haskell or not
-> String -- ^ Haskell source code.
-> String -- ^ Coloured Haskell source code.
hscolour output pref anchor partial title False =
(if partial then id else top'n'tail output title) .
hscolour' output pref anchor
hscolour output pref anchor partial title True =
(if partial then id else top'n'tail output title) .
concatMap chunk . joinL . classify . inlines
where
chunk (Code c) = hscolour' output pref anchor c
chunk (Lit c) = c
-- | The actual colourising worker, despatched on the chosen output format.
hscolour' :: Output -- ^ Output format.
-> ColourPrefs -- ^ Colour preferences (for formats that support them)
-> Bool -- ^ Whether to include anchors.
-> String -- ^ Haskell source code.
-> String -- ^ Coloured Haskell source code.
hscolour' TTY pref _ = TTY.hscolour pref
hscolour' (TTYg tt) pref _ = TTY.hscolourG tt pref
hscolour' MIRC pref _ = MIRC.hscolour pref
hscolour' LaTeX pref _ = LaTeX.hscolour pref
hscolour' HTML pref anchor = HTML.hscolour pref anchor
hscolour' CSS _ anchor = CSS.hscolour anchor
hscolour' ICSS pref anchor = ICSS.hscolour pref anchor
hscolour' ACSS _ anchor = ACSS.hscolour anchor
-- | Choose the right headers\/footers, depending on the output format.
top'n'tail :: Output -- ^ Output format
-> String -- ^ Title for output
-> (String->String) -- ^ Output transformer
top'n'tail TTY _ = id
top'n'tail (TTYg _) _ = id
top'n'tail MIRC _ = id
top'n'tail LaTeX title = LaTeX.top'n'tail title
top'n'tail HTML title = HTML.top'n'tail title
top'n'tail CSS title = CSS.top'n'tail title
top'n'tail ICSS title = ICSS.top'n'tail title
top'n'tail ACSS title = CSS.top'n'tail title
-- | Separating literate files into code\/comment chunks.
data Lit = Code {unL :: String} | Lit {unL :: String} deriving (Show)
-- Re-implementation of 'lines', for better efficiency (but decreased laziness).
-- Also, importantly, accepts non-standard DOS and Mac line ending characters.
-- And retains the trailing '\n' character in each resultant string.
inlines :: String -> [String]
inlines s = lines' s id
where
lines' [] acc = [acc []]
lines' ('\^M':'\n':s) acc = acc ['\n'] : lines' s id -- DOS
--lines' ('\^M':s) acc = acc ['\n'] : lines' s id -- MacOS
lines' ('\n':s) acc = acc ['\n'] : lines' s id -- Unix
lines' (c:s) acc = lines' s (acc . (c:))
-- | The code for classify is largely stolen from Language.Preprocessor.Unlit.
classify :: [String] -> [Lit]
classify [] = []
classify (x:xs) | "\\begin{code}"`isPrefixOf`x
= Lit x: allProg xs
where allProg [] = [] -- Should give an error message,
-- but I have no good position information.
allProg (x:xs) | "\\end{code}"`isPrefixOf`x
= Lit x: classify xs
allProg (x:xs) = Code x: allProg xs
classify (('>':x):xs) = Code ('>':x) : classify xs
classify (x:xs) = Lit x: classify xs
-- | Join up chunks of code\/comment that are next to each other.
joinL :: [Lit] -> [Lit]
joinL [] = []
joinL (Code c:Code c2:xs) = joinL (Code (c++c2):xs)
joinL (Lit c :Lit c2 :xs) = joinL (Lit (c++c2):xs)
joinL (any:xs) = any: joinL xs

View File

@@ -0,0 +1,252 @@
if (Rows (modelMatrixList) == 0)
{
modelMatrixList =
{
{"Equal Input", "EIAA.mdl", "19"}
{"Dayhoff","Dayhoff.mdl","0"}
{"Dayhoff+F","Dayhoff_F.mdl","19"}
{"JTT", "Jones.mdl", "0"}
{"JTT+F", "Jones_F.mdl", "19"}
{"WAG", "WAG.mdl", "0"}
{"WAG+F", "WAG_F.mdl", "19"}
{"rtREV", "rtREV.mdl", "0"}
{"rtREV+F", "rtREV_F.mdl", "19"}
{"mtMAM", "mtMAM.mdl", "0"}
{"mtMAM+F", "mtMAM_F.mdl", "19"}
{"mtREV 24", "mtREV_24.mdl", "0"}
{"mtREV 24+F", "mtREV_24_F.mdl", "19"}
{"HIV within", "HIVwithin.mdl", "0"}
{"HIV within+F", "HIVwithin+F.mdl", "19"}
{"HIV between", "HIVbetween.mdl", "0"}
{"HIV between+F", "HIVbetween+F.mdl", "19"}
{"REV-1 step", "reducedREV.mdl", "19"}
{"REV", "mtREV.mdl", "19"}
};
}
/*___________________________________________________________________________________________________________*/
function runAModel (modelID, fileName, xtraP, midx)
{
ExecuteCommands ("#include \"TemplateModels/"+fileName+"\";");
Tree givenTree = treeString;
LikelihoodFunction lf = (filteredData,givenTree);
GetString (lf_info, lf, -1);
locals = lf_info["Local Independent"];
if (Columns (branchLengthStash))
{
USE_LAST_RESULTS = 1;
for (_iv = 0; _iv < Columns (locals); _iv = _iv+1)
{
ExecuteCommands (locals[_iv] + "=1;\n");
}
currentBL = BranchLength (givenTree,0);
currentBN = BranchName (givenTree,-1);
for (_iv = 0; _iv < Columns (currentBN); _iv = _iv+1)
{
ExecuteCommands ("givenTree."+currentBN[_iv]+".t="+branchLengthStash[_iv]/currentBL+";");
}
}
else
{
for (_iv = 0; _iv < Columns (locals); _iv = _iv+1)
{
ExecuteCommands (locals[_iv] + "=0.1;\n");
}
USE_LAST_RESULTS = 1;
}
Optimize (res,lf);
fprintf (stdout, "| ", modelID);
for (k=0; k<maxModelWidth-Abs(modelID)-1; k=k+1)
{
fprintf (stdout, " ");
}
params = res[1][1]+xtraP;
AIC = 2(-res[1][0]+params);
if (filteredData.sites-params>1)
{
cAIC = 2(-res[1][0]+params*(filteredData.sites/(filteredData.sites-params-1)));
}
else
{
cAIC = 0;
}
branchLengths = BranchLength (givenTree,-1);
TL = 0;
for (k=Rows(branchLengths)*Columns(branchLengths)-1; k>=0; k=k-1)
{
TL = TL + branchLengths[k];
}
fprintf (stdout, "| ", Format (res[1][0],14,3), " | ", Format (params,5,0), " | ",
Format (AIC, 9,3), " | ",);
if (cAIC > 0)
{
fprintf (stdout, Format (cAIC,11,3), " | ");
}
else
{
fprintf (stdout, " N/A | ");
}
fprintf (stdout, Format (TL,11,3), " |\n", sepString);
resultMatrix[midx][0] = res[1][0];
resultMatrix[midx][1] = params;
resultMatrix[midx][2] = AIC;
resultMatrix[midx][3] = cAIC;
resultMatrix[midx][4] = TL;
if (AIC < bestAIC)
{
bestAIC = AIC;
bestAICidx = midx;
branchLengthStash = BranchLength (givenTree,-1);
}
if (cAIC > 0)
{
if (bestCAIC > cAIC)
{
bestCAIC = cAIC;
bestCAICidx = midx;
}
}
return 0;
}
/*___________________________________________________________________________________________________________*/
maxModelWidth = 7;
skipCodeSelectionStep = 0;
ChoiceList (doREV, "Include REV?", 1, SKIP_NONE, "Yes", "Include REV and reduced REV models. CAUTION: these models take a long time to fit.",
"No", "Only use empirical models");
if (doREV < 0)
{
return 0;
}
if (doREV == 0)
{
#include "TemplateModels/chooseGeneticCode.def";
skipCodeSelectionStep = 1;
}
modelCount = Rows (modelMatrixList) - 2*doREV;
for (k=0; k<modelCount; k=k+1)
{
maxModelWidth = Max(maxModelWidth,Abs (modelMatrixList[k][0])+2);
}
sepString = "";
capString = "";
sepString * 256;
sepString * "+";
capString * 256;
capString * "| Model";
for (k=0; k<maxModelWidth; k=k+1)
{
sepString * "-";
}
for (k=0; k<maxModelWidth-6; k=k+1)
{
capString * " ";
}
capString * "| Log Likelihood | #prms | AIC Score | c-AIC Score | Tree Length |\n";
sepString * "+----------------+-------+-----------+-------------+-------------+\n";
sepString * 0;
capString * 0;
branchLengthStash = 0;
SKIP_MODEL_PARAMETER_LIST = 0;
#include "TemplateModels/modelParameters2.mdl";
if (modelType == 1)
{
#include "TemplateModels/defineGamma.mdl";
}
if (modelType == 2)
{
#include "TemplateModels/defineHM.mdl";
}
SKIP_MODEL_PARAMETER_LIST = 1;
SetDialogPrompt ("Please load an amino-acid data file:");
DataSet ds = ReadDataFile (PROMPT_FOR_FILE);
DataSetFilter filteredData = CreateFilter (ds,1);
fprintf (stdout,"\nRunning aminoacid model comparisons on ", LAST_FILE_PATH, "\n\nThe alignment has ",ds.species, " sequences and ", ds.sites, " sites\n");
_DO_TREE_REBALANCE_ = 1;
#include "queryTree.bf";
resultMatrix = {modelCount, 5};
fprintf (stdout, "\n",sepString,capString,sepString);
bestAIC = 1e100;
bestCAIC = 1e100;
bestAICidx = 0;
bestCAICidx = -1;
for (mid=0; mid<modelCount; mid=mid+1)
{
runAModel (modelMatrixList[mid][0], modelMatrixList[mid][1], 0+modelMatrixList[mid][2], mid);
}
fprintf (stdout, "\n\nBest AIC model:\n\t", modelMatrixList[bestAICidx][0], " with the score of ", bestAIC);
if (bestCAICidx>=0)
{
fprintf (stdout, "\n\nBest c-AIC model:\n\t", modelMatrixList[bestCAICidx][0], " with the score of ", bestCAIC);
}
labelMatrix = {{"Log-likelihood","Parameters","AIC","c-AIC","Total tree length",""}};
aaString = "Model";
for (fC = 0; fC < modelCount; fC = fC+1)
{
aaString = aaString + ";" + modelMatrixList[fC][0];
}
USE_LAST_RESULTS = 0;
labelMatrix[5] = aaString;
skipCodeSelectionStep = 0;
OpenWindow (CHARTWINDOW,{{"Model Fits"}
{"labelMatrix"},
{"resultMatrix"},
{"Bar Chart"},
{"Index"},
{"c-AIC"},
{"Model Index"},
{""},
{"AIC"}
},
"SCREEN_WIDTH-60;SCREEN_HEIGHT-60;30;30");

File diff suppressed because it is too large Load Diff

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1 @@
fprintf (stdout, "\n1). Spawning a zero-populated 5x6 matrix and setting it's values to random numbers in [0,1].\n");

View File

@@ -0,0 +1,147 @@
#include "molclockBootstrap.bf";
RESTORE_GLOBALS = 1;
_DO_TREE_REBALANCE_ = 0;
VERBOSITY_LEVEL = -1;
function RestoreGlobalValues (lfIndex)
{
if (lfIndex==0)
{
for (i=0;i<SAVE_GLOBALS;i=i+1)
{
SetParameter (lf,i,globalSpoolMatrix[i]);
}
}
if (lfIndex==1)
{
for (i=0;i<SAVE_GLOBALS2;i=i+1)
{
SetParameter (lfConstrained,i,globalSpoolMatrix2[i]);
}
}
return 0;
}
fprintf(stdout,"\n ---- RUNNING MOLECULAR CLOCK ANALYSIS ---- \n");
ChoiceList (dataType,"Data type",1,SKIP_NONE,"Nucleotide/Protein","Nucleotide or amino-acid (protein).",
"Codon","Codon (several available genetic codes).");
if (dataType<0)
{
return;
}
if (dataType)
{
NICETY_LEVEL = 3;
#include "TemplateModels/chooseGeneticCode.def";
}
SetDialogPrompt ("Choose the data file:");
DataSet ds = ReadDataFile (PROMPT_FOR_FILE);
fprintf (stdout,"The following data was read:\n",ds,"\n");
if (dataType)
{
DataSetFilter filteredData = CreateFilter (ds,3,"","",GeneticCodeExclusions);
}
else
{
DataSetFilter filteredData = CreateFilter (ds,1);
}
SelectTemplateModel(filteredData);
#include "queryTree.bf";
global RelRatio;
RelRatio = 1.0;
relationString = ":=RelRatio*";
parameter2Constrain = 0;
if (Rows("LAST_MODEL_PARAMETER_LIST")>1)
{
ChoiceList (parameter2Constrain, "Parameter(s) to constrain:",1,SKIP_NONE,LAST_MODEL_PARAMETER_LIST);
if (parameter2Constrain<0)
{
return;
}
if (parameter2Constrain==0)
{
parameter2ConstrainString = "";
for (parameter2Constrain=Rows("LAST_MODEL_PARAMETER_LIST")-1; parameter2Constrain; parameter2Constrain = parameter2Constrain-1)
{
GetString (funnyString,LAST_MODEL_PARAMETER_LIST,parameter2Constrain);
parameter2ConstrainString = parameter2ConstrainString + funnyString + ",";
}
GetString (funnyString,LAST_MODEL_PARAMETER_LIST,0);
parameter2ConstrainString = parameter2ConstrainString + funnyString;
}
else
{
GetString (parameter2ConstrainString,LAST_MODEL_PARAMETER_LIST,parameter2Constrain-1);
}
}
else
{
GetString (parameter2ConstrainString,LAST_MODEL_PARAMETER_LIST,0);
}
timer = Time(0);
LikelihoodFunction lf = (filteredData,givenTree);
Optimize (res,lf);
separator = "*-----------------------------------------------------------*";
fprintf (stdout, "\n", separator, "\nRESULTS WITHOUT THE CLOCK:\n",lf);
fullModelLik = res[1][0];
fullVars = res[1][1];
/* now specify the constraint */
Tree clockTree = treeString;
ExecuteCommands ("MolecularClock (clockTree,"+parameter2ConstrainString+");");
LikelihoodFunction lfConstrained = (filteredData, clockTree);
USE_LAST_RESULTS = 1;
Optimize (res1,lfConstrained);
USE_LAST_RESULTS = 0;
SAVE_GLOBALS = res1[1][2];
if (SAVE_GLOBALS)
{
globalSpoolMatrix = {1,SAVE_GLOBALS};
for (i=0;i<SAVE_GLOBALS;i=i+1)
{
globalSpoolMatrix[i]=res1[0][i];
}
}
fprintf (stdout, "\n", separator,"\n\nRESULTS WITH THE CLOCK:\n",lfConstrained);
lnLikDiff = 2(fullModelLik-res1[1][0]);
degFDiff = fullVars - res1[1][1];
fprintf (stdout, "\n", separator,"\n\n-2(Ln Likelihood Ratio)=",lnLikDiff,"\n","Constrained parameters:",Format(degFDiff,0,0));
fprintf (stdout, "\nP-Value:",1-CChi2(lnLikDiff,degFDiff));
fprintf (stdout, "\nCPU time taken: ", Time(0)-timer, " seconds.\n");

File diff suppressed because it is too large Load Diff

11003
samples/HyPhy/hyphy_cmds.bf Normal file

File diff suppressed because one or more lines are too long

1
samples/HyPhy/profile_test.bf Executable file
View File

@@ -0,0 +1 @@
#profile START;

View File

@@ -0,0 +1,71 @@
update=Sun 15 Feb 2015 01:10:10 PM EST
last_client=eeschema
[pcbnew]
version=1
PageLayoutDescrFile=
LastNetListRead=
UseCmpFile=1
PadDrill=0.6
PadDrillOvalY=0.6
PadSizeH=1.5
PadSizeV=1.5
PcbTextSizeV=1.5
PcbTextSizeH=1.5
PcbTextThickness=0.3
ModuleTextSizeV=1
ModuleTextSizeH=1
ModuleTextSizeThickness=0.15
SolderMaskClearance=0
SolderMaskMinWidth=0
DrawSegmentWidth=0.2
BoardOutlineThickness=0.09999999999999999
ModuleOutlineThickness=0.15
[pcbnew/libraries]
LibDir=
[general]
version=1
[eeschema]
version=1
PageLayoutDescrFile=
SubpartIdSeparator=0
SubpartFirstId=65
LibDir=/home/hschmale/KiCad/LibMods-3rdParty
NetFmtName=
RptD_X=0
RptD_Y=100
RptLab=1
LabSize=60
[eeschema/libraries]
LibName1=power
LibName2=device
LibName3=transistors
LibName4=conn
LibName5=linear
LibName6=regul
LibName7=74xx
LibName8=cmos4000
LibName9=adc-dac
LibName10=memory
LibName11=xilinx
LibName12=special
LibName13=microcontrollers
LibName14=dsp
LibName15=microchip
LibName16=analog_switches
LibName17=motorola
LibName18=texas
LibName19=intel
LibName20=audio
LibName21=interface
LibName22=digital-audio
LibName23=philips
LibName24=display
LibName25=cypress
LibName26=siliconi
LibName27=opto
LibName28=atmel
LibName29=contrib
LibName30=valves
LibName31=arduino_shieldsNCL
LibName32=con-usb-2
LibName33=2axispotwselect

File diff suppressed because it is too large Load Diff

742
samples/JFlex/LexScan.flex Normal file
View File

@@ -0,0 +1,742 @@
/* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
* JFlex 1.7.0-SNAPSHOT *
* Copyright (C) 1998-2015 Gerwin Klein <lsf@jflex.de> *
* All rights reserved. *
* *
* License: BSD *
* *
* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * */
package jflex;
import java_cup.runtime.Symbol;
import java.io.*;
import java.util.Stack;
import java.util.ArrayList;
import java.util.List;
import java.util.Map;
import java.util.HashMap;
import jflex.unicode.UnicodeProperties;
%%
%final
%public
%class LexScan
%implements sym, java_cup.runtime.Scanner
%function next_token
%type Symbol
%unicode
%column
%line
%eofclose
%state COMMENT, STATELIST, MACROS, REGEXPSTART
%state REGEXP, JAVA_CODE, STATES, STRING_CONTENT
%state CHARCLASS, COPY, REPEATEXP, EATWSPNL
%state CTOR_ARG, REGEXP_CODEPOINT_SEQUENCE
%state STRING_CODEPOINT_SEQUENCE, CHARCLASS_CODEPOINT
%inputstreamctor false
%cupdebug
%{
int balance = 0;
int commentbalance = 0;
int action_line = 0;
int bufferSize = 16384;
File file;
Stack<File> files = new Stack<File>();
StringBuilder userCode = new StringBuilder();
String classCode;
String initCode;
String initThrow;
String eofCode;
String eofThrow;
String lexThrow;
String eofVal;
String scanErrorException;
String cupSymbol = "sym";
StringBuilder actionText = new StringBuilder();
StringBuilder string = new StringBuilder();
private UnicodeProperties unicodeProperties;
boolean charCount;
boolean lineCount;
boolean columnCount;
boolean cupCompatible;
boolean cup2Compatible;
boolean cupDebug;
boolean isInteger;
boolean isIntWrap;
boolean isYYEOF;
boolean notUnix;
boolean isPublic;
boolean isFinal;
boolean isAbstract;
boolean bolUsed;
boolean standalone;
boolean debugOption;
boolean caseless;
boolean inclusive_states;
boolean eofclose;
boolean isASCII;
// TODO: In the version of JFlex after 1.6, the InputStream ctor
// TODO: will never be emitted, and this option will cease to exist.
boolean emitInputStreamCtor = Options.emitInputStreamCtor;
String isImplementing;
String isExtending;
String className = "Yylex";
String functionName;
String tokenType;
String visibility = "public";
List<String> ctorArgs = new ArrayList<String>();
List<String> ctorTypes = new ArrayList<String>();
LexicalStates states = new LexicalStates();
List<Action> actions = new ArrayList<Action>();
private int nextState;
boolean macroDefinition;
Timer t = new Timer();
// CharClasses.init() is delayed until UnicodeProperties.init() has been called,
// since the max char code won't be known until then.
private CharClasses charClasses = new CharClasses();
public CharClasses getCharClasses() {
return charClasses;
}
public int currentLine() {
return yyline;
}
public void setFile(File file) {
this.file = file;
}
private Symbol symbol(int type, Object value) {
return new Symbol(type, yyline, yycolumn, value);
}
private Symbol symbol(int type) {
return new Symbol(type, yyline, yycolumn);
}
// updates line and column count to the beginning of the first
// non whitespace character in yytext, but leaves yyline+yycolumn
// untouched
private Symbol symbol_countUpdate(int type, Object value) {
int lc = yyline;
int cc = yycolumn;
String text = yytext();
for (int i=0; i < text.length(); i++) {
char c = text.charAt(i);
if (c != '\n' && c != '\r' && c != ' ' && c != '\t' )
return new Symbol(type, lc, cc, value);
if (c == '\n') {
lc++;
cc = 0;
}
else
cc++;
}
return new Symbol(type, yyline, yycolumn, value);
}
private String makeMacroIdent() {
String matched = yytext().trim();
return matched.substring(1, matched.length()-1).trim();
}
public static String conc(Object a, Object b) {
if (a == null && b == null) return null;
if (a == null) return b.toString();
if (b == null) return a.toString();
return a.toString()+b.toString();
}
public static String concExc(Object a, Object b) {
if (a == null && b == null) return null;
if (a == null) return b.toString();
if (b == null) return a.toString();
return a.toString()+", "+b.toString();
}
public UnicodeProperties getUnicodeProperties() {
return unicodeProperties;
}
private void populateDefaultVersionUnicodeProperties() {
try {
unicodeProperties = new UnicodeProperties();
} catch (UnicodeProperties.UnsupportedUnicodeVersionException e) {
throw new ScannerException
(file, ErrorMessages.UNSUPPORTED_UNICODE_VERSION, yyline);
}
charClasses.init
(Options.jlex ? 127 : unicodeProperties.getMaximumCodePoint(), this);
}
private void includeFile(String filePath) {
File f = new File(file.getParentFile(), filePath);
if ( !f.canRead() )
throw new ScannerException(file,ErrorMessages.NOT_READABLE, yyline);
// check for cycle
if (files.search(f) > 0)
throw new ScannerException(file,ErrorMessages.FILE_CYCLE, yyline);
try {
yypushStream( new FileReader(f) );
files.push(file);
file = f;
Out.println("Including \""+file+"\"");
}
catch (FileNotFoundException e) {
throw new ScannerException(file,ErrorMessages.NOT_READABLE, yyline);
}
}
%}
%init{
states.insert("YYINITIAL", true);
%init}
Digit = [0-9]
HexDigit = [0-9a-fA-F]
OctDigit = [0-7]
Number = {Digit}+
HexNumber = \\ x {HexDigit} {2}
OctNumber = \\ [0-3]? {OctDigit} {1, 2}
// Unicode4 can encode chars only in the BMP with the 16 bits provided by its
// 4 hex digits.
Unicode4 = \\ u {HexDigit} {4}
// Unicode6 can encode all Unicode chars, both in the BMP and in the
// supplementary planes -- only 21 bits are required as of Unicode 5.0,
// but its six hex digits provide 24 bits.
Unicode6 = \\ U {HexDigit} {6}
// see http://www.unicode.org/unicode/reports/tr18/
WSP = [ \t\b]
WSPNL = [\u2028\u2029\u000A\u000B\u000C\u000D\u0085\t\b\ ]
NWSPNL = [^\u2028\u2029\u000A\u000B\u000C\u000D\u0085\t\b\ ]
NL = [\u2028\u2029\u000A\u000B\u000C\u000D\u0085] | \u000D\u000A
NNL = [^\u2028\u2029\u000A\u000B\u000C\u000D\u0085]
Ident = {IdentStart} {IdentPart}*
QualIdent = {Ident} ( {WSP}* "." {WSP}* {Ident} )*
QUIL = {QualIdent} ( {WSP}* "," {WSP}* {QualIdent} )*
Array = "[" {WSP}* "]"
ParamPart = {IdentStart}|{IdentPart}|"<"|">"|","|{WSP}|"&"|"?"|"."
GenParam = "<" {ParamPart}+ ">"
ClassT = {Ident} ({WSP}* {GenParam})?
QClassT = {QualIdent} ({WSP}* {GenParam})?
ArrType = ({GenParam} {WSP}*)? {QClassT} ({WSP}* {Array})*
IdentStart = [:jletter:]
IdentPart = [:jletterdigit:]
JFlexCommentChar = [^*/]|"/"+[^*/]|"*"+[^*/]
JFlexComment = {JFlexCommentChar}+
/* Java comments */
JavaComment = {TraditionalComment}|{EndOfLineComment}
TraditionalComment = "/*"{CommentContent}\*+"/"
EndOfLineComment = "//".*{NL}
CommentContent = ([^*]|\*+[^*/])*
StringCharacter = [^\u2028\u2029\u000A\u000B\u000C\u000D\u0085\"\\]
CharLiteral = \'([^\u2028\u2029\u000A\u000B\u000C\u000D\u0085\'\\]|{EscapeSequence})\'
StringLiteral = \"({StringCharacter}|{EscapeSequence})*\"
EscapeSequence = \\[^\u2028\u2029\u000A\u000B\u000C\u000D\u0085]|\\+u{HexDigit}{4}|\\[0-3]?{OctDigit}{1,2}
/* \\(b|t|n|f|r|\"|\'|\\|[0-3]?{OctDigit}{1,2}|u{HexDigit}{4}) */
JavaRest = [^\{\}\"\'/]|"/"[^*/]
JavaCode = ({JavaRest}|{StringLiteral}|{CharLiteral}|{JavaComment})+
DottedVersion = [1-9][0-9]*(\.[0-9]+){0,2}
%%
<YYINITIAL> {
"%%".*{NL}? {
t.start();
yybegin(MACROS);
macroDefinition = true;
return symbol(USERCODE,userCode);
}
.*{NL} | .+ { userCode.append(yytext()); }
<<EOF>> { return symbol(EOF); }
}
<MACROS> ("%{"|"%init{"|"%initthrow{"|"%eof{"|"%eofthrow{"|"%yylexthrow{"|"%eofval{").*{NL}
{ string.setLength(0); yybegin(COPY); }
<COPY> {
"%}".*{NL} { classCode = conc(classCode,string); yybegin(MACROS); }
"%init}".*{NL} { initCode = conc(initCode,string); yybegin(MACROS); }
"%initthrow}".*{NL} { initThrow = concExc(initThrow,string); yybegin(MACROS); }
"%eof}".*{NL} { eofCode = conc(eofCode,string); yybegin(MACROS); }
"%eofthrow}".*{NL} { eofThrow = concExc(eofThrow,string); yybegin(MACROS); }
"%yylexthrow}".*{NL} { lexThrow = concExc(lexThrow,string); yybegin(MACROS); }
"%eofval}".*{NL} { eofVal = string.toString(); yybegin(MACROS); }
.*{NL} { string.append(yytext()); }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_MACROS); }
}
<MACROS> ^"%s" ("tate" "s"?)? {WSP}+ { inclusive_states = true; yybegin(STATELIST); }
<MACROS> ^"%x" ("state" "s"?)? {WSP}+ { inclusive_states = false; yybegin(STATELIST); }
<STATELIST> {
{Ident} { states.insert(yytext(),inclusive_states); }
([\ \t]*","[\ \t]*)|([\ \t]+) { }
{NL} { yybegin(MACROS); }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_MACROS); }
}
<MACROS> {
"%char" { charCount = true; }
"%line" { lineCount = true; }
"%column" { columnCount = true; }
"%byaccj" { isInteger = true;
if (eofVal == null)
eofVal = "return 0;";
eofclose = true;
}
"%cup2" { cup2Compatible = true;
isImplementing = concExc(isImplementing, "Scanner");
lineCount = true;
columnCount = true;
if (functionName == null)
functionName = "readNextTerminal";
if (tokenType == null)
tokenType = "ScannerToken<? extends Object>";
if (eofVal == null)
eofVal = "return token(SpecialTerminals.EndOfInputStream);";
if (!Options.jlex) eofclose = true;
return symbol(UNICODE); // %unicode
}
"%cup" { cupCompatible = true;
isImplementing = concExc(isImplementing, "java_cup.runtime.Scanner");
if (functionName == null)
functionName = "next_token";
if (tokenType == null)
tokenType = "java_cup.runtime.Symbol";
if (eofVal == null)
eofVal = "return new java_cup.runtime.Symbol("+cupSymbol+".EOF);";
if (!Options.jlex) eofclose = true;
}
"%cupsym"{WSP}+{QualIdent} {WSP}* { cupSymbol = yytext().substring(8).trim();
if (cupCompatible) Out.warning(ErrorMessages.CUPSYM_AFTER_CUP, yyline); }
"%cupsym"{WSP}+{NNL}* { throw new ScannerException(file,ErrorMessages.QUIL_CUPSYM, yyline); }
"%cupdebug" { cupDebug = true; }
"%eofclose"({WSP}+"true")? { eofclose = true; }
"%eofclose"({WSP}+"false") { eofclose = false; }
"%class"{WSP}+{ClassT} {WSP}* { className = yytext().substring(7).trim(); }
"%ctorarg"{WSP}+{ArrType}{WSP}+ { yybegin(CTOR_ARG); ctorTypes.add(yytext().substring(8).trim()); }
"%function"{WSP}+{Ident} {WSP}* { functionName = yytext().substring(10).trim(); }
"%type"{WSP}+{ArrType} {WSP}* { tokenType = yytext().substring(6).trim(); }
"%integer"|"%int" { isInteger = true; }
"%intwrap" { isIntWrap = true; }
"%yyeof" { isYYEOF = true; }
"%notunix" { notUnix = true; }
"%7bit" { isASCII = true; return symbol(ASCII); }
"%full"|"%8bit" { return symbol(FULL); }
"%16bit" { populateDefaultVersionUnicodeProperties();
return symbol(UNICODE);
}
"%unicode"({WSP}+{DottedVersion})? { String v = yytext().substring(8).trim();
if (v.length() == 0) {
populateDefaultVersionUnicodeProperties();
} else {
try {
unicodeProperties = new UnicodeProperties(v);
} catch (UnicodeProperties.UnsupportedUnicodeVersionException e) {
throw new ScannerException
(file, ErrorMessages.UNSUPPORTED_UNICODE_VERSION, yyline);
}
charClasses.init
(Options.jlex ? 127 : unicodeProperties.getMaximumCodePoint(), this);
}
return symbol(UNICODE);
}
"%caseless"|"%ignorecase" { caseless = true; }
"%implements"{WSP}+.* { isImplementing = concExc(isImplementing, yytext().substring(12).trim()); }
"%extends"{WSP}+{QClassT}{WSP}* { isExtending = yytext().substring(9).trim(); }
"%public" { isPublic = true; }
"%apiprivate" { visibility = "private"; Skeleton.makePrivate(); }
"%final" { isFinal = true; }
"%abstract" { isAbstract = true; }
"%debug" { debugOption = true; }
"%standalone" { standalone = true; isInteger = true; }
"%pack" { /* no-op - this is the only generation method */ }
"%include" {WSP}+ .* { includeFile(yytext().substring(9).trim()); }
"%buffer" {WSP}+ {Number} {WSP}* { bufferSize = Integer.parseInt(yytext().substring(8).trim()); }
"%buffer" {WSP}+ {NNL}* { throw new ScannerException(file,ErrorMessages.NO_BUFFER_SIZE, yyline); }
"%initthrow" {WSP}+ {QUIL} {WSP}* { initThrow = concExc(initThrow,yytext().substring(11).trim()); }
"%initthrow" {WSP}+ {NNL}* { throw new ScannerException(file,ErrorMessages.QUIL_INITTHROW, yyline); }
"%eofthrow" {WSP}+ {QUIL} {WSP}* { eofThrow = concExc(eofThrow,yytext().substring(10).trim()); }
"%eofthrow" {WSP}+ {NNL}* { throw new ScannerException(file,ErrorMessages.QUIL_EOFTHROW, yyline); }
"%yylexthrow"{WSP}+ {QUIL} {WSP}* { lexThrow = concExc(lexThrow,yytext().substring(12).trim()); }
"%throws" {WSP}+ {QUIL} {WSP}* { lexThrow = concExc(lexThrow,yytext().substring(8).trim()); }
"%yylexthrow"{WSP}+ {NNL}* { throw new ScannerException(file,ErrorMessages.QUIL_YYLEXTHROW, yyline); }
"%throws" {WSP}+ {NNL}* { throw new ScannerException(file,ErrorMessages.QUIL_THROW, yyline); }
"%scanerror" {WSP}+ {QualIdent} {WSP}* { scanErrorException = yytext().substring(11).trim(); }
"%scanerror" {WSP}+ {NNL}* { throw new ScannerException(file,ErrorMessages.QUIL_SCANERROR, yyline); }
// TODO: In the version of JFlex after 1.6, the %inputstreamctor directive will become a no-op: the InputStream ctor will never be emitted.
"%inputstreamctor"({WSP}+"true")? { emitInputStreamCtor = true; }
"%inputstreamctor"{WSP}+"false" { emitInputStreamCtor = false; }
{Ident} { return symbol(IDENT, yytext()); }
"="{WSP}* { if (null == unicodeProperties && ! isASCII) {
populateDefaultVersionUnicodeProperties();
}
yybegin(REGEXP);
return symbol(EQUALS);
}
"/*" { nextState = MACROS; yybegin(COMMENT); }
{EndOfLineComment} { }
^"%%" {NNL}* { if (null == unicodeProperties && ! isASCII) {
populateDefaultVersionUnicodeProperties();
}
macroDefinition = false;
yybegin(REGEXPSTART);
return symbol(DELIMITER);
}
"%"{Ident} { throw new ScannerException(file,ErrorMessages.UNKNOWN_OPTION, yyline, yycolumn); }
"%" { throw new ScannerException(file,ErrorMessages.UNKNOWN_OPTION, yyline, yycolumn); }
^{WSP}+"%" { Out.warning(ErrorMessages.NOT_AT_BOL, yyline); yypushback(1); }
{WSP}+ { }
{NL}+ { }
<<EOF>> { if ( yymoreStreams() ) {
file = (File) files.pop();
yypopStream();
}
else
throw new ScannerException(file,ErrorMessages.EOF_IN_MACROS);
}
}
<CTOR_ARG> {
{Ident} {WSP}* { yybegin(MACROS); ctorArgs.add(yytext().trim()); }
[^] { throw new ScannerException(file,ErrorMessages.CTOR_ARG,yyline,yycolumn); }
}
<REGEXPSTART> {
^ {WSP}* "%include" {WSP}+ .* { includeFile(yytext().trim().substring(9).trim()); }
{WSP}* "/*" { nextState = REGEXPSTART; yybegin(COMMENT); }
{WSP}* "<" { yybegin(STATES); return symbol_countUpdate(LESSTHAN, null); }
{WSP}* "}" { return symbol_countUpdate(RBRACE, null); }
{WSP}* "//" {NNL}* { }
{WSP}* "<<EOF>>" {WSPNL}* "{" { actionText.setLength(0); yybegin(JAVA_CODE);
Symbol s = symbol_countUpdate(EOFRULE, null);
action_line = s.left+1;
return s;
}
^ {WSP}* {NWSPNL} { yypushback(yylength()); yybegin(REGEXP); }
{WSP} | {NL} { }
}
<STATES> {
{Ident} { return symbol(IDENT, yytext()); }
"," { return symbol(COMMA); }
{WSPNL}+ { }
// "{" will be caught in REGEXP
">"{WSPNL}* { yybegin(REGEXP); return symbol(MORETHAN); }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_STATES); }
}
<REGEXP> {
"<<EOF>>" {WSPNL}+ "{" { actionText.setLength(0); yybegin(JAVA_CODE); action_line = yyline+1; return symbol(EOFRULE); }
"<<EOF>>" { throw new ScannerException(file,ErrorMessages.EOF_WO_ACTION); }
{WSPNL}*"|"{WSP}*$ { if (macroDefinition) {
yybegin(EATWSPNL);
return symbol(BAR);
}
else {
yybegin(REGEXPSTART);
return symbol(NOACTION);
}
}
// stategroup
"{" { yybegin(REGEXPSTART); return symbol(LBRACE); }
{WSPNL}*"|" { return symbol(BAR); }
{WSPNL}*\" { string.setLength(0); nextState = REGEXP; yybegin(STRING_CONTENT); }
{WSPNL}*"\\u{" { string.setLength(0); yybegin(REGEXP_CODEPOINT_SEQUENCE); }
{WSPNL}*"!" { return symbol(BANG); }
{WSPNL}*"~" { return symbol(TILDE); }
{WSPNL}*"(" { return symbol(OPENBRACKET); }
{WSPNL}*")" { return symbol(CLOSEBRACKET); }
{WSPNL}*"*" { return symbol(STAR); }
{WSPNL}*"+" { return symbol(PLUS); }
{WSPNL}*"?" { return symbol(QUESTION); }
{WSPNL}*"$" { return symbol(DOLLAR); }
{WSPNL}*"^" { bolUsed = true; return symbol(HAT); }
{WSPNL}*"." { return symbol(POINT); }
{WSPNL}*"\\R" { return symbol(NEWLINE); }
{WSPNL}*"[" { yybegin(CHARCLASS); return symbol(OPENCLASS); }
{WSPNL}*"/" { return symbol(LOOKAHEAD); }
{WSPNL}* "{" {WSP}* {Ident} {WSP}* "}" { return symbol_countUpdate(MACROUSE, makeMacroIdent()); }
{WSPNL}* "{" {WSP}* {Number} { yybegin(REPEATEXP);
return symbol(REPEAT,
new Integer(yytext().trim().substring(1).trim()));
}
{WSPNL}+ "{" { actionText.setLength(0); yybegin(JAVA_CODE); action_line = yyline+1; return symbol(REGEXPEND); }
{NL} { if (macroDefinition) { yybegin(MACROS); } return symbol(REGEXPEND); }
{WSPNL}*"/*" { nextState = REGEXP; yybegin(COMMENT); }
{WSPNL}*"//"{NNL}* { }
{WSP}+ { }
<CHARCLASS> {
{WSPNL}*"[:jletter:]" { return symbol(JLETTERCLASS); }
{WSPNL}*"[:jletterdigit:]" { return symbol(JLETTERDIGITCLASS); }
{WSPNL}*"[:letter:]" { return symbol(LETTERCLASS); }
{WSPNL}*"[:uppercase:]" { return symbol(UPPERCLASS); }
{WSPNL}*"[:lowercase:]" { return symbol(LOWERCLASS); }
{WSPNL}*"[:digit:]" { return symbol(DIGITCLASS); }
{WSPNL}*"\\d" { return symbol(DIGITCLASS); }
{WSPNL}*"\\D" { return symbol(DIGITCLASSNOT); }
{WSPNL}*"\\s" { return symbol(WHITESPACECLASS); }
{WSPNL}*"\\S" { return symbol(WHITESPACECLASSNOT); }
{WSPNL}*"\\w" { return symbol(WORDCLASS); }
{WSPNL}*"\\W" { return symbol(WORDCLASSNOT); }
{WSPNL}*"\\p{"[^}]*"}" { String trimmedText = yytext().trim();
String propertyValue = trimmedText.substring(3,trimmedText.length()-1);
IntCharSet set = unicodeProperties.getIntCharSet(propertyValue);
if (null == set) {
throw new ScannerException(file,ErrorMessages.INVALID_UNICODE_PROPERTY, yyline, yycolumn + 3);
}
return symbol(UNIPROPCCLASS, set);
}
{WSPNL}*"\\P{"[^}]*"}" { String trimmedText = yytext().trim();
String propertyValue = trimmedText.substring(3,trimmedText.length()-1);
IntCharSet set = unicodeProperties.getIntCharSet(propertyValue);
if (null == set) {
throw new ScannerException(file,ErrorMessages.INVALID_UNICODE_PROPERTY, yyline, yycolumn + 3);
}
return symbol(UNIPROPCCLASSNOT, set);
}
}
. { return symbol(CHAR, yytext().codePointAt(0)); }
}
<EATWSPNL> {WSPNL}+ { yybegin(REGEXP); }
<REPEATEXP> {
"}" { yybegin(REGEXP); return symbol(RBRACE); }
"," {WSP}* {Number} { return symbol(REPEAT, new Integer(yytext().substring(1).trim())); }
{WSP}+ { }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_REGEXP); }
}
<CHARCLASS> {
"{"{Ident}"}" { return symbol(MACROUSE, yytext().substring(1,yylength()-1)); }
"[" { balance++; return symbol(OPENCLASS); }
"]" { if (balance > 0) balance--; else yybegin(REGEXP); return symbol(CLOSECLASS); }
"^" { return symbol(HAT); }
"-" { return symbol(DASH); }
"--" { return symbol(DIFFERENCE); }
"&&" { return symbol(INTERSECTION); }
"||" { /* union is the default operation - '||' can be ignored */ }
"~~" { return symbol(SYMMETRICDIFFERENCE); }
"\\u{" { yybegin(CHARCLASS_CODEPOINT); }
// this is a hack to keep JLex compatibilty with char class
// expressions like [+-]
"-]" { yypushback(1); yycolumn--; return symbol(CHAR, (int)'-'); }
\" { string.setLength(0); nextState = CHARCLASS; yybegin(STRING_CONTENT); }
. { return symbol(CHAR, yytext().codePointAt(0)); }
\n { throw new ScannerException(file,ErrorMessages.EOL_IN_CHARCLASS,yyline,yycolumn); }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_REGEXP); }
}
<STRING_CONTENT> {
\" { yybegin(nextState); return symbol(STRING, string.toString()); }
\\\" { string.append('\"'); }
[^\"\\\u2028\u2029\u000A\u000B\u000C\u000D\u0085]+ { string.append(yytext()); }
{NL} { throw new ScannerException(file,ErrorMessages.UNTERMINATED_STR, yyline, yycolumn); }
{HexNumber} { string.append( (char) Integer.parseInt(yytext().substring(2,yylength()), 16)); }
{OctNumber} { string.append( (char) Integer.parseInt(yytext().substring(1,yylength()), 8)); }
{Unicode4} { string.append( (char) Integer.parseInt(yytext().substring(2,yylength()), 16)); }
{Unicode6} { int codePoint = Integer.parseInt(yytext().substring(2,yylength()), 16);
if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
string.append(Character.toChars(codePoint));
} else {
throw new ScannerException(file,ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn+2);
}
}
"\\u{" { yybegin(STRING_CODEPOINT_SEQUENCE); }
\\b { string.append('\b'); }
\\n { string.append('\n'); }
\\t { string.append('\t'); }
\\f { string.append('\f'); }
\\r { string.append('\r'); }
\\. { string.append(yytext().substring(1, yytext().offsetByCodePoints(1, 1))); }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_STRING); }
}
<REGEXP, CHARCLASS> {
{HexNumber} { return symbol(CHAR, Integer.parseInt(yytext().substring(2,yylength()), 16)); }
{OctNumber} { return symbol(CHAR, Integer.parseInt(yytext().substring(1,yylength()), 8)); }
{Unicode4} { return symbol(CHAR, Integer.parseInt(yytext().substring(2,yylength()), 16)); }
{Unicode6} { int codePoint = Integer.parseInt(yytext().substring(2,yylength()), 16);
if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
return symbol(CHAR, codePoint);
} else {
throw new ScannerException(file,ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn+2);
}
}
\\b { return symbol(CHAR, (int)'\b'); }
\\n { return symbol(CHAR, (int)'\n'); }
\\t { return symbol(CHAR, (int)'\t'); }
\\f { return symbol(CHAR, (int)'\f'); }
\\r { return symbol(CHAR, (int)'\r'); }
\\. { return symbol(CHAR, yytext().codePointAt(1)); }
}
<JAVA_CODE> {
"{" { balance++; actionText.append('{'); }
"}" { if (balance > 0) {
balance--;
actionText.append('}');
}
else {
yybegin(REGEXPSTART);
Action a = new Action(actionText.toString(), action_line);
actions.add(a);
return symbol(ACTION, a);
}
}
{JavaCode} { actionText.append(yytext()); }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_ACTION, action_line-1); }
}
<COMMENT> {
"/"+ "*" { commentbalance++; }
"*"+ "/" { if (commentbalance > 0)
commentbalance--;
else
yybegin(nextState);
}
{JFlexComment} { /* ignore */ }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_COMMENT); }
}
<REGEXP_CODEPOINT_SEQUENCE> {
"}" { yybegin(REGEXP); return symbol(STRING, string.toString()); }
{HexDigit}{1,6} { int codePoint = Integer.parseInt(yytext(), 16);
if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
string.append(Character.toChars(codePoint));
} else {
throw new ScannerException(file,ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn);
}
}
{WSPNL}+ { }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_REGEXP); }
}
<STRING_CODEPOINT_SEQUENCE> { // Specialized form: newlines disallowed, and doesn't return a symbol
"}" { yybegin(STRING_CONTENT); }
{HexDigit}{1,6} { int codePoint = Integer.parseInt(yytext(), 16);
if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
string.append(Character.toChars(codePoint));
} else {
throw new ScannerException(file, ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn);
}
}
{NL} { throw new ScannerException(file,ErrorMessages.UNTERMINATED_STR, yyline, yycolumn); }
{WSP}+ { }
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_STRING); }
}
<CHARCLASS_CODEPOINT> { // Specialized form: only one codepoint allowed, no whitespace allowed
{HexDigit}{1,6} "}" { int codePoint = Integer.parseInt(yytext().substring(0, yylength() - 1), 16);
if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
yybegin(CHARCLASS);
return symbol(CHAR, codePoint);
} else {
throw new ScannerException(file, ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn);
}
}
<<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_REGEXP); }
}
. { throw new ScannerException(file,ErrorMessages.UNEXPECTED_CHAR, yyline, yycolumn); }
\R { throw new ScannerException(file,ErrorMessages.UNEXPECTED_NL, yyline, yycolumn); }
<<EOF>> { if ( yymoreStreams() ) {
file = (File) files.pop();
yypopStream();
}
else {
return symbol(EOF);
}
}

Some files were not shown because too many files have changed in this diff Show More