mirror of
				https://github.com/KevinMidboe/linguist.git
				synced 2025-10-29 17:50:22 +00:00 
			
		
		
		
	Compare commits
	
		
			831 Commits
		
	
	
		
	
	| Author | SHA1 | Date | |
|---|---|---|---|
|  | 473282d64c | ||
|  | c2c068e9db | ||
|  | 13d1f662d1 | ||
|  | bdd57f58a0 | ||
|  | b1bcabd6e6 | ||
|  | e128c3fa82 | ||
|  | efac9fe750 | ||
|  | 2b8545a8fa | ||
|  | b275b5d728 | ||
|  | 1f46cfafa7 | ||
|  | b1dcdf3418 | ||
|  | 4bfd65deb8 | ||
|  | 61102812a0 | ||
|  | 580cfce7fb | ||
|  | f1383d7a45 | ||
|  | e4ce5bfe39 | ||
|  | 6ed64f25a2 | ||
|  | 114a331106 | ||
|  | 9aa24a216a | ||
|  | 13702451ab | ||
|  | f0242f6f97 | ||
|  | 9775820398 | ||
|  | 7daf26bcd0 | ||
|  | 231f705098 | ||
|  | 893ab8fd8d | ||
|  | 5afdd2c533 | ||
|  | e4f5c0066a | ||
|  | a167f852dd | ||
|  | b428bce126 | ||
|  | e62d0e19a5 | ||
|  | 9b8bf9068f | ||
|  | 6e05edc350 | ||
|  | dd8eaf2893 | ||
|  | e24efad5ff | ||
|  | 58a34cdb7d | ||
|  | b1c6b330e9 | ||
|  | 7c3e265033 | ||
|  | 13695a716c | ||
|  | c9e43804d6 | ||
|  | 1535e3553e | ||
|  | 0ac05bbbeb | ||
|  | d3f979d640 | ||
|  | 0e9ded45dc | ||
|  | a2ca886510 | ||
|  | 25a1af3775 | ||
|  | 0d8e0a2970 | ||
|  | c0fff6c8a8 | ||
|  | e6b4428614 | ||
|  | 4e6e69833d | ||
|  | 1d9faff4c6 | ||
|  | 7025cbe760 | ||
|  | e922b7c2ca | ||
|  | 96518d2d0f | ||
|  | 1241b20ba1 | ||
|  | f03f5c1628 | ||
|  | cb550a3662 | ||
|  | d1f90d61c5 | ||
|  | 16e65fe189 | ||
|  | 62a0faa729 | ||
|  | fbb3ab2292 | ||
|  | b3b75e5ef8 | ||
|  | 8b36210db5 | ||
|  | a74f3b3e46 | ||
|  | e214a52de5 | ||
|  | 0624a9395c | ||
|  | b2e7f7ffa6 | ||
|  | b312b39a10 | ||
|  | 80e2d112b2 | ||
|  | 519b169df0 | ||
|  | 5c2cfbc334 | ||
|  | 7d91e4959a | ||
|  | 0c5aa2a7eb | ||
|  | 0d7a264981 | ||
|  | 52ff2d2e74 | ||
|  | 8a7ceaa845 | ||
|  | fd9ce2d1cf | ||
|  | c7bab11ebe | ||
|  | 6995fc28b6 | ||
|  | 102f14d0e9 | ||
|  | aac168402b | ||
|  | 152d49513f | ||
|  | d5564c808d | ||
|  | 82410e07b2 | ||
|  | 94d90b30b5 | ||
|  | 06997f0da2 | ||
|  | 55aafa416d | ||
|  | 6226a46988 | ||
|  | 8d216f0c43 | ||
|  | 7f5bb25542 | ||
|  | 5fcdf6adc2 | ||
|  | 6a565a849b | ||
|  | 66fc67e34c | ||
|  | 7cf140940e | ||
|  | 60e90bab23 | ||
|  | 4f58258186 | ||
|  | 03e2904ebf | ||
|  | bea90b256e | ||
|  | 8eb37ba956 | ||
|  | 8d20c1fb59 | ||
|  | 9a1abf0c49 | ||
|  | 5aae7a4000 | ||
|  | d9509a1750 | ||
|  | 978c448fb8 | ||
|  | 997c0fca10 | ||
|  | 3ae6e68492 | ||
|  | 851c93a1f7 | ||
|  | a5f7355e16 | ||
|  | 18ffdbaa65 | ||
|  | c089222bc6 | ||
|  | 37f9535d27 | ||
|  | 4650368bc2 | ||
|  | 88b14ed455 | ||
|  | 54a2a47bc0 | ||
|  | ffcc970140 | ||
|  | 7a811e39e0 | ||
|  | 11f158cbb3 | ||
|  | 5d5550c48b | ||
|  | fd570d906a | ||
|  | deab0662f9 | ||
|  | 7238f50a6b | ||
|  | 499fcd1f3f | ||
|  | dc0ddc82d6 | ||
|  | 436fc34cb9 | ||
|  | f072cd96e3 | ||
|  | 3441a001c7 | ||
|  | bc747844ea | ||
|  | a887f58bcc | ||
|  | f42afef6e0 | ||
|  | 18eaf22cb9 | ||
|  | d94f427e12 | ||
|  | b94eb42db6 | ||
|  | d2297f5516 | ||
|  | ef6f58b828 | ||
|  | eb0bf16cce | ||
|  | ca51415540 | ||
|  | 8ae32e1d47 | ||
|  | 0a6165c4d9 | ||
|  | cf8521a629 | ||
|  | b11c7f3dc0 | ||
|  | 01151aad5c | ||
|  | 6b283068a9 | ||
|  | ccd7d4d89d | ||
|  | 208ec3906f | ||
|  | 84d4fccb4d | ||
|  | 8d8ea959ee | ||
|  | 1c73db499f | ||
|  | 16a4b4947f | ||
|  | 4b2abb2064 | ||
|  | c581b6a5a7 | ||
|  | 4c66582f87 | ||
|  | 11388a5355 | ||
|  | 24ca98b1a3 | ||
|  | 90a293727d | ||
|  | e869f6c173 | ||
|  | 5b187d1f20 | ||
|  | 7b5d1c075d | ||
|  | 07173d2238 | ||
|  | 6b747f7d65 | ||
|  | aef19d72f9 | ||
|  | e1a661bffc | ||
|  | 560f9b15d7 | ||
|  | 452fc59d4f | ||
|  | 682cc2d82d | ||
|  | 29197736c7 | ||
|  | e1dbd68713 | ||
|  | 0ecb865797 | ||
|  | 1ced06483e | ||
|  | 861cee33d5 | ||
|  | 6b882438b0 | ||
|  | c570646c2d | ||
|  | 75f72578ad | ||
|  | 4dc566e13f | ||
|  | bcfdbe3616 | ||
|  | 314b7f134d | ||
|  | 87eb4577ea | ||
|  | 7563bf43e9 | ||
|  | ce8cfed7ff | ||
|  | 8742de9a88 | ||
|  | 9c0af2ea5b | ||
|  | 4c81c0d904 | ||
|  | 4dcdb0c79c | ||
|  | d459f7289e | ||
|  | d2c4104d30 | ||
|  | 89fabd9a89 | ||
|  | 3f7ce832ab | ||
|  | 3fdc904b18 | ||
|  | cf471af677 | ||
|  | 2d392581e2 | ||
|  | 79a428ab8d | ||
|  | 7ed1b9b0b1 | ||
|  | 58fd8a5d87 | ||
|  | 9f8c15ed6c | ||
|  | b94eda18ab | ||
|  | 849eb28b01 | ||
|  | b0073d461c | ||
|  | 25d160e850 | ||
|  | e688c865bc | ||
|  | 21e97cc65c | ||
|  | 06c1033952 | ||
|  | 8c54f68040 | ||
|  | 4c1f5c490f | ||
|  | 117735ffb9 | ||
|  | f98e6bdac7 | ||
|  | 19d76306d3 | ||
|  | a63a609ce1 | ||
|  | 95fce2024d | ||
|  | f3b65015f4 | ||
|  | 5431298b0d | ||
|  | 8f651bca03 | ||
|  | 6c45e5ec19 | ||
|  | 95d394642c | ||
|  | 6a185a3d3a | ||
|  | 6ae353706d | ||
|  | 77bc72be14 | ||
|  | 0585c880de | ||
|  | da5189e7fb | ||
|  | 5f456d8b22 | ||
|  | a351cdd486 | ||
|  | 6e71663fd6 | ||
|  | 0b2e43cdee | ||
|  | 9cbd280f79 | ||
|  | 947be9db0f | ||
|  | dd55f929d4 | ||
|  | 8b5399d568 | ||
|  | 1b8b0c6229 | ||
|  | ee3081fb4c | ||
|  | 119770a038 | ||
|  | 9d61487403 | ||
|  | 56dec47561 | ||
|  | 3e793ab5b7 | ||
|  | f6b50a67f9 | ||
|  | cd47798d13 | ||
|  | 3b54df2cde | ||
|  | 8bf1defdc1 | ||
|  | 8845b266de | ||
|  | 4757da73f0 | ||
|  | 468fd425fc | ||
|  | 5604d658b2 | ||
|  | 37222d5622 | ||
|  | ec38b54023 | ||
|  | 260e90401d | ||
|  | 8c66f0a5da | ||
|  | 78efc2d0de | ||
|  | 656c1e6ba6 | ||
|  | 65e932016b | ||
|  | fc602b1d42 | ||
|  | 0e882900d7 | ||
|  | 28103ee25b | ||
|  | 0a0d2ddb1a | ||
|  | 3bf4cb721e | ||
|  | ba1ab64b56 | ||
|  | 786d1e4cfc | ||
|  | eb82e022ba | ||
|  | 753bfd1dc5 | ||
|  | bc8d65e7d3 | ||
|  | 3180c5d554 | ||
|  | 6b11655db8 | ||
|  | d1ae098c08 | ||
|  | e1a8b5db1d | ||
|  | 302cfea295 | ||
|  | be122ca1a5 | ||
|  | b05f6f0018 | ||
|  | e811021806 | ||
|  | 656f4f440d | ||
|  | 7fb62de4d7 | ||
|  | 0946fecd82 | ||
|  | 26a5325dc3 | ||
|  | 9afdcddfc9 | ||
|  | 4881e0aa51 | ||
|  | 743f7c76de | ||
|  | f8ef01f557 | ||
|  | 402fa5c2cd | ||
|  | 5ac1e847a5 | ||
|  | 0737a21e38 | ||
|  | 4d162f88bd | ||
|  | 2806987f2f | ||
|  | f380aa2e5e | ||
|  | a2ce1972ec | ||
|  | aa8cf7e6bb | ||
|  | ec61a6974f | ||
|  | 21e249bd2c | ||
|  | 8e550f7093 | ||
|  | 53e53880bd | ||
|  | 671b5788ed | ||
|  | 76d10cd85c | ||
|  | 42c155d667 | ||
|  | d17222ec91 | ||
|  | a1ea55d006 | ||
|  | f32b7bb978 | ||
|  | 38aa7bae3f | ||
|  | 0021b9532b | ||
|  | 788fac7c43 | ||
|  | 71934152e4 | ||
|  | e20d6fc04a | ||
|  | a1e8fc4f97 | ||
|  | 9dc8a10e2a | ||
|  | 43a2da46f9 | ||
|  | f95ca13073 | ||
|  | b92b3af602 | ||
|  | 83b76cde34 | ||
|  | 5ff0d488d2 | ||
|  | f89adf6e53 | ||
|  | efd34d8cb0 | ||
|  | 3defb60fd7 | ||
|  | 869c9d2fdd | ||
|  | 912e465193 | ||
|  | e7c1419390 | ||
|  | b19cd037b7 | ||
|  | 42f7bc2160 | ||
|  | 542a0d79fd | ||
|  | 4b9b09f7bf | ||
|  | 57429f3194 | ||
|  | 9bdf890fd8 | ||
|  | 9240f30f28 | ||
|  | 6062d3b25c | ||
|  | 3878afa2e0 | ||
|  | fa8998c6b6 | ||
|  | 99dcd501aa | ||
|  | ed23c6ef75 | ||
|  | 90b59876d0 | ||
|  | da7d019df3 | ||
|  | 4fc0c90cff | ||
|  | 4ecb6425d2 | ||
|  | 6dfab80df7 | ||
|  | 1ebf1e77e5 | ||
|  | 0c810cc016 | ||
|  | 7e32b45aa8 | ||
|  | 4c1a84716a | ||
|  | fd4111cdbe | ||
|  | 2fac182a90 | ||
|  | 6d2aa601cd | ||
|  | f87c3c4996 | ||
|  | 1811465abb | ||
|  | 7631db2183 | ||
|  | da5bc18d64 | ||
|  | 0c2aeae00d | ||
|  | f2af2156fa | ||
|  | 5bf8cf50ae | ||
|  | dc22b0f869 | ||
|  | 5382c1b795 | ||
|  | dbe851726e | ||
|  | 3720e49618 | ||
|  | a4f187efd2 | ||
|  | b6ee02f313 | ||
|  | 380a51e4a4 | ||
|  | 459b1034a7 | ||
|  | c2f567770c | ||
|  | 03369b8a6c | ||
|  | c94c908d5d | ||
|  | 585d74ecc9 | ||
|  | d8422e63f6 | ||
|  | ca12a99970 | ||
|  | 1fdcafb1ae | ||
|  | 3b2ddb1a18 | ||
|  | 2eede37248 | ||
|  | 6489f7009d | ||
|  | bdfe2aa6e4 | ||
|  | 007de4691b | ||
|  | 141e495447 | ||
|  | 5e68714ae5 | ||
|  | 4ae6455e0e | ||
|  | f393ea307d | ||
|  | 1e20b12241 | ||
|  | 81c41df15c | ||
|  | 8b736189e0 | ||
|  | 188d2367df | ||
|  | 5aeac500da | ||
|  | 5730ab28ab | ||
|  | 1c56b03a28 | ||
|  | 828fc7a19b | ||
|  | fc1f8083ad | ||
|  | af5e799a45 | ||
|  | accf734a74 | ||
|  | 6bd86ad46b | ||
|  | d7207f3399 | ||
|  | e018b4322e | ||
|  | 415c7d32a2 | ||
|  | 164caa2755 | ||
|  | ec2f0cb82a | ||
|  | 604918b6ad | ||
|  | eb7e72a4a9 | ||
|  | e073e91d62 | ||
|  | da9bda0e27 | ||
|  | 0e996e4bb7 | ||
|  | 63fbbd6e0a | ||
|  | 1ac694f149 | ||
|  | ef49fe417f | ||
|  | d28828b7d7 | ||
|  | 8a42f76f03 | ||
|  | 745ce14d47 | ||
|  | dc41ca23c6 | ||
|  | 9da42fba5b | ||
|  | fac4633337 | ||
|  | 3ab0de831f | ||
|  | 599d146118 | ||
|  | 5cdbb2b113 | ||
|  | 611584a414 | ||
|  | 33478b2d23 | ||
|  | 46ca8e93c2 | ||
|  | da58febc3e | ||
|  | 7ca2384e03 | ||
|  | 6b2bb52dcd | ||
|  | 000a42ef3d | ||
|  | 03e40718ff | ||
|  | 4386fb7f28 | ||
|  | 0db4d05671 | ||
|  | d113e98915 | ||
|  | e9acecf71f | ||
|  | 76b84decfe | ||
|  | 80148ae4e4 | ||
|  | 4af679c27f | ||
|  | ba86d9fff0 | ||
|  | 3a07410569 | ||
|  | b43828db9b | ||
|  | 8251588088 | ||
|  | 22ff4898a5 | ||
|  | 9c4c6d908a | ||
|  | 3f9d98974c | ||
|  | 98a23c6a53 | ||
|  | 3086326d12 | ||
|  | ac4594e3b1 | ||
|  | 47dcca839e | ||
|  | 572078a708 | ||
|  | 0442f4bd06 | ||
|  | 2861a8f19c | ||
|  | 1d0028fd53 | ||
|  | c3288543af | ||
|  | 3c96f9eb53 | ||
|  | 6bd8d3a3b7 | ||
|  | 63e017fbaa | ||
|  | f993b7358b | ||
|  | 4239d5453c | ||
|  | b0e6f17612 | ||
|  | c97c10623b | ||
|  | d566ccd0be | ||
|  | 8b4daefbde | ||
|  | bbea29be55 | ||
|  | f016867e1a | ||
|  | 35f2699eb3 | ||
|  | 3ad66da2bf | ||
|  | 004f9b4710 | ||
|  | 3e06b95f98 | ||
|  | 8591dffcae | ||
|  | 3d69c047f0 | ||
|  | 78a1183c26 | ||
|  | 58ea517b32 | ||
|  | 0722b6855b | ||
|  | a6a745d99d | ||
|  | 7394e9400b | ||
|  | 15f0366e12 | ||
|  | 07e3d9d3b3 | ||
|  | 55eaf03afb | ||
|  | 7a6849b3ac | ||
|  | fa5496eef4 | ||
|  | 893bd7e204 | ||
|  | 8a54ce57a5 | ||
|  | 3851b7c016 | ||
|  | 3dbcfa8af8 | ||
|  | 9936a30879 | ||
|  | 59e935b05d | ||
|  | 53f93f68db | ||
|  | 66f9bd1ab4 | ||
|  | 78d4abe808 | ||
|  | cb97417af8 | ||
|  | d1c94c75ea | ||
|  | 0c8c6c9814 | ||
|  | 3270a8896d | ||
|  | 20f19bf049 | ||
|  | 0cc33fd560 | ||
|  | fa54fc2735 | ||
|  | 216e0457ff | ||
|  | 678f90acf7 | ||
|  | dd0d5c08bb | ||
|  | 3837fed59e | ||
|  | e4ce4edd5c | ||
|  | a0fb54fe70 | ||
|  | e946ceaa6f | ||
|  | 285af6512e | ||
|  | 5ae5108a69 | ||
|  | 02ae60f434 | ||
|  | 03dc4e1ff4 | ||
|  | c39b42abba | ||
|  | 661972f585 | ||
|  | 078aff6ee3 | ||
|  | 4fed108b2c | ||
|  | fc9beb58aa | ||
|  | 4623b4a83e | ||
|  | 2ba6ecefe5 | ||
|  | 91c2a4682d | ||
|  | 738be195ef | ||
|  | 5dcc4d74ec | ||
|  | 4213bec62a | ||
|  | babe733bf4 | ||
|  | ab5f60555e | ||
|  | b61e33a49e | ||
|  | a0d5a8338b | ||
|  | eec321f013 | ||
|  | e538f72b63 | ||
|  | bde843b67f | ||
|  | 44c3d47b30 | ||
|  | f1d3f396bb | ||
|  | 65ae444791 | ||
|  | e9916c644d | ||
|  | 1940a9ea92 | ||
|  | c9f8a2677a | ||
|  | 5b6b3f74b5 | ||
|  | f9ccac4240 | ||
|  | aa7aae7808 | ||
|  | 7c66301583 | ||
|  | a5b0b333b0 | ||
|  | 7df872eb7f | ||
|  | 6a4f4c724c | ||
|  | 76828c45c7 | ||
|  | 27215f148b | ||
|  | 77d52463ad | ||
|  | 0f6c2afbf6 | ||
|  | cbaa3ca6f4 | ||
|  | 63f54bdf06 | ||
|  | b302863a4d | ||
|  | ec46b1a92e | ||
|  | ed65040539 | ||
|  | cc1a420bc5 | ||
|  | 8555b20380 | ||
|  | 6462ba70f9 | ||
|  | 1ac43e0d7d | ||
|  | 6ac51968c6 | ||
|  | cbcadf8e45 | ||
|  | 74b111501d | ||
|  | 67e4212f64 | ||
|  | 55559a1020 | ||
|  | b103232e0e | ||
|  | b587379f4a | ||
|  | ba654b2a1d | ||
|  | ae39475133 | ||
|  | c641ea833f | ||
|  | ebf10c2cd6 | ||
|  | 29ef8beb3f | ||
|  | 2b5f38264b | ||
|  | 5850716eb3 | ||
|  | 3db6c4a5b6 | ||
|  | e79607372b | ||
|  | b5472ab753 | ||
|  | 013188dcd9 | ||
|  | 3cf7bfbee2 | ||
|  | 5f647f2236 | ||
|  | 3bb740fe9f | ||
|  | 50db5c012e | ||
|  | dcb14d0fc7 | ||
|  | 419cfe54e0 | ||
|  | ce1f51a34f | ||
|  | 5fd7992f98 | ||
|  | 3f5a96a15b | ||
|  | 840bdf95e3 | ||
|  | 01deb07ae9 | ||
|  | fda0f2a042 | ||
|  | 6af4ab6db1 | ||
|  | 6aab682728 | ||
|  | 6c37613bf0 | ||
|  | 188c7364f8 | ||
|  | 09ead55502 | ||
|  | a364e4a2dc | ||
|  | f7f9513fba | ||
|  | dd2d2389c8 | ||
|  | 1bb639617c | ||
|  | 03b43a85c8 | ||
|  | fb709e2e10 | ||
|  | dad653492a | ||
|  | 0db133ffb2 | ||
|  | 6d1682911b | ||
|  | d1de479c49 | ||
|  | ad7e231f39 | ||
|  | f36d239b85 | ||
|  | 540865d045 | ||
|  | 5ed0da7b08 | ||
|  | 068c8a341d | ||
|  | e61be66d4f | ||
|  | d263f0c91a | ||
|  | fee0cebcec | ||
|  | 3745308642 | ||
|  | 8843fa3ed4 | ||
|  | 464d6e9ec4 | ||
|  | 02ced24751 | ||
|  | 8b9ad131d1 | ||
|  | 5ef944e8b8 | ||
|  | ea0145fda5 | ||
|  | 53c3cb382c | ||
|  | 179c557e5b | ||
|  | 8da458e1a8 | ||
|  | b009c85b64 | ||
|  | 3eb3dd7d4b | ||
|  | c9a1159a2e | ||
|  | 17f75e64ba | ||
|  | 8664668524 | ||
|  | 3ba4cf699a | ||
|  | 8bc39ce44f | ||
|  | 2d03eae413 | ||
|  | 0157b9eb37 | ||
|  | 0d848b342f | ||
|  | ad6030b0e8 | ||
|  | bdb2a221a5 | ||
|  | 44f505e687 | ||
|  | d931dacd47 | ||
|  | 1da425ae2f | ||
|  | 9ceea4ac81 | ||
|  | a1010b8cf8 | ||
|  | 19a300a4ba | ||
|  | 1bc1803628 | ||
|  | 7fdead0100 | ||
|  | 3dcdc11c1b | ||
|  | e8326529b5 | ||
|  | 2d5476f6c8 | ||
|  | 781133d0d3 | ||
|  | c7b4cf636f | ||
|  | d81c796dc0 | ||
|  | 1a3680bba6 | ||
|  | 600bca149a | ||
|  | 3a56d632e1 | ||
|  | 7f3f0327c2 | ||
|  | cc0c71b277 | ||
|  | e5ce286c63 | ||
|  | 86a0cf9424 | ||
|  | eaea6ac837 | ||
|  | 4efc3ff822 | ||
|  | c22a6563d9 | ||
|  | f9683efb74 | ||
|  | 08945923e6 | ||
|  | 4745c62853 | ||
|  | 7c593899e7 | ||
|  | 9151e7066a | ||
|  | 730be65514 | ||
|  | b358a22d32 | ||
|  | 8a0ff14d22 | ||
|  | 7604a2d80b | ||
|  | 78b1c8a430 | ||
|  | 4ef925d8be | ||
|  | 7ba4f0c571 | ||
|  | 63fc9dd6a5 | ||
|  | b350f1572b | ||
|  | e24a9ba602 | ||
|  | a338228b57 | ||
|  | d6d232ec37 | ||
|  | b723405e9f | ||
|  | cecb125b0b | ||
|  | 2177ff1806 | ||
|  | 674eb31cfe | ||
|  | 9783710adf | ||
|  | 8888555f71 | ||
|  | 13a6180507 | ||
|  | 9a86b9ad75 | ||
|  | 65260e3aaa | ||
|  | 51af1bd162 | ||
|  | e093ac843f | ||
|  | 13eb7c796e | ||
|  | 1cdd3c55ab | ||
|  | 407dbbb7fb | ||
|  | 0bccf97d16 | ||
|  | c6e16ee6bd | ||
|  | 2b25bb6d1c | ||
|  | e791a71566 | ||
|  | 739b512cee | ||
|  | effcab4297 | ||
|  | 2e1161e061 | ||
|  | 649a5987e7 | ||
|  | 71e0e2bc8e | ||
|  | fd7633518f | ||
|  | 04252c28f2 | ||
|  | 94be1ab277 | ||
|  | 8561f2a6b0 | ||
|  | 2bd050657d | ||
|  | c7d8f39ad8 | ||
|  | ad4b5bdc16 | ||
|  | ef5eff45aa | ||
|  | d18c8614ba | ||
|  | 29192e8d5f | ||
|  | c2e894c48c | ||
|  | 2cc6e5bfe6 | ||
|  | 2d15ea54cb | ||
|  | 6b26386a81 | ||
|  | 525e886d79 | ||
|  | 05f73df064 | ||
|  | e592381a54 | ||
|  | fecf0cc137 | ||
|  | 507d191d7d | ||
|  | 8420e4b044 | ||
|  | 2ca5868610 | ||
|  | 6d8559eccb | ||
|  | 53d020f7b0 | ||
|  | ad9a2d231e | ||
|  | 7bbb3da010 | ||
|  | 76a85b7637 | ||
|  | 80f72a5093 | ||
|  | df552c241e | ||
|  | 9e020dd15d | ||
|  | c7c0c30ecf | ||
|  | 60deead669 | ||
|  | 6d843eca60 | ||
|  | 885b5aab41 | ||
|  | 12c22d0311 | ||
|  | d28f5e87c0 | ||
|  | 471fabfff5 | ||
|  | 2e1a6d9d43 | ||
|  | d2d22e849e | ||
|  | 6c41bfa44d | ||
|  | d54bcc85e7 | ||
|  | ef22eee4d9 | ||
|  | b609f24bbc | ||
|  | 83b03df98b | ||
|  | 6d94ddb114 | ||
|  | 7fd720bf39 | ||
|  | e10558e444 | ||
|  | 7c48d5ee1f | ||
|  | 10ffd870e2 | ||
|  | 3a4ab156b0 | ||
|  | 651d863069 | ||
|  | a3c595a4a9 | ||
|  | 7660714a9e | ||
|  | 71002dfb65 | ||
|  | 013cfdcdaf | ||
|  | 5ad6add91e | ||
|  | 2f5b49f4ae | ||
|  | 353479fe72 | ||
|  | 6f5c935837 | ||
|  | 1bf91d4281 | ||
|  | 8d2dd55c94 | ||
|  | 6a86e8ea97 | ||
|  | a817d95d6c | ||
|  | 7cdb5ccba8 | ||
|  | 22b8d462c2 | ||
|  | 066052ddd2 | ||
|  | d673010420 | ||
|  | fffd1b986d | ||
|  | dc852b6398 | ||
|  | 64471be009 | ||
|  | d43ffe09b3 | ||
|  | e0c1107a25 | ||
|  | 3475aefd04 | ||
|  | 4e4a18c71a | ||
|  | 9a2f2c1fb2 | ||
|  | b2ee2cc7b8 | ||
|  | ee0b4f96a8 | ||
|  | 665f9ee5b5 | ||
|  | 4eb8903bed | ||
|  | d11b2f05bb | ||
|  | 11f7e6e1b4 | ||
|  | 72acbc567b | ||
|  | 1170ac6105 | ||
|  | bdc724d548 | ||
|  | 74cd03de0b | ||
|  | 5e9bb67d10 | ||
|  | e969172543 | ||
|  | f570260dfe | ||
|  | 7ecf65551e | ||
|  | fb6ec8aaa7 | ||
|  | 0ba6a7adf0 | ||
|  | 0019abe5e7 | ||
|  | 30d2883436 | ||
|  | cc5881dca2 | ||
|  | d17f5dfd9e | ||
|  | 4c037c644f | ||
|  | a08f0da30d | ||
|  | 654cfd7a47 | ||
|  | 88e79cd3a8 | ||
|  | 4543c7a0b3 | ||
|  | f5bc9735af | ||
|  | 107a27aa25 | ||
|  | 5c29ce0695 | ||
|  | 41e1b7bd4e | ||
|  | 462a570d3c | ||
|  | 7f1af4215a | ||
|  | 7a141a923c | ||
|  | 0db1d1c8ca | ||
|  | 201b0ba53c | ||
|  | 3e54d6651c | ||
|  | 6d770ab68f | ||
|  | 6ca149de1d | ||
|  | 2e76ce740e | ||
|  | a664b9dd0c | ||
|  | d49701f470 | ||
|  | 67fae52b32 | ||
|  | bb9f6ff082 | ||
|  | ad7fc977df | ||
|  | 0479a89982 | ||
|  | d7b9791514 | ||
|  | 832d379ace | ||
|  | 96c2f86613 | ||
|  | eaa03e15ed | ||
|  | 9fe9bf617f | ||
|  | 3c34da8bd3 | ||
|  | 9fa7adaa61 | ||
|  | 54a2f5347a | ||
|  | a716d3ad49 | ||
|  | 8f70604466 | ||
|  | 2044e191a2 | ||
|  | 8fe9ec0521 | ||
|  | 034e510ba5 | ||
|  | aa8eb955e9 | ||
|  | 8e52c18200 | ||
|  | e468723abc | ||
|  | 99bfde32a8 | ||
|  | c6e8915627 | ||
|  | 496b3e5a78 | ||
|  | 01be9e68ee | ||
|  | 56c3b8c3fe | ||
|  | 3886c406ab | ||
|  | b56671c20d | ||
|  | f3cbad065f | ||
|  | 4b3b1a80f6 | ||
|  | f18ae4f99f | ||
|  | 5217f19faa | ||
|  | 296d170ba9 | ||
|  | a97fd74399 | ||
|  | 43ee45d9b6 | ||
|  | 02db72515f | ||
|  | af9b5f0e98 | ||
|  | a145bd92f7 | ||
|  | 20204cd9fc | ||
|  | 3445e55744 | ||
|  | 036b9c4094 | ||
|  | ce928d8b64 | ||
|  | edadca9085 | ||
|  | 08290ac49e | ||
|  | 42944660bd | ||
|  | ae5e1c5a85 | ||
|  | f4f5ccb3f5 | ||
|  | ab3f44cb6e | ||
|  | d7757033ab | ||
|  | 8bb9241e6e | ||
|  | 2c5e8c4308 | ||
|  | 506b75c5e8 | ||
|  | af4b64070f | ||
|  | 29d8e58d69 | 
							
								
								
									
										185
									
								
								.gitmodules
									
									
									
									
										vendored
									
									
								
							
							
						
						
									
										185
									
								
								.gitmodules
									
									
									
									
										vendored
									
									
								
							| @@ -96,7 +96,7 @@ | ||||
| 	url = https://github.com/bfad/Sublime-Lasso | ||||
| [submodule "vendor/grammars/chapel-tmbundle"] | ||||
| 	path = vendor/grammars/chapel-tmbundle | ||||
| 	url = https://github.com/bholt/chapel-tmbundle | ||||
| 	url = https://github.com/chapel-lang/chapel-tmbundle | ||||
| [submodule "vendor/grammars/sublime-nginx"] | ||||
| 	path = vendor/grammars/sublime-nginx | ||||
| 	url = https://github.com/brandonwamboldt/sublime-nginx | ||||
| @@ -118,9 +118,6 @@ | ||||
| [submodule "vendor/grammars/cucumber-tmbundle"] | ||||
| 	path = vendor/grammars/cucumber-tmbundle | ||||
| 	url = https://github.com/cucumber/cucumber-tmbundle | ||||
| [submodule "vendor/grammars/Handlebars"] | ||||
| 	path = vendor/grammars/Handlebars | ||||
| 	url = https://github.com/daaain/Handlebars | ||||
| [submodule "vendor/grammars/powershell"] | ||||
| 	path = vendor/grammars/powershell | ||||
| 	url = https://github.com/SublimeText/PowerShell | ||||
| @@ -136,9 +133,6 @@ | ||||
| [submodule "vendor/grammars/fancy-tmbundle"] | ||||
| 	path = vendor/grammars/fancy-tmbundle | ||||
| 	url = https://github.com/fancy-lang/fancy-tmbundle | ||||
| [submodule "vendor/grammars/fsharpbinding"] | ||||
| 	path = vendor/grammars/fsharpbinding | ||||
| 	url = https://github.com/fsharp/fsharpbinding | ||||
| [submodule "vendor/grammars/monkey.tmbundle"] | ||||
| 	path = vendor/grammars/monkey.tmbundle | ||||
| 	url = https://github.com/gingerbeardman/monkey.tmbundle | ||||
| @@ -169,18 +163,12 @@ | ||||
| [submodule "vendor/grammars/Textmate-Gosu-Bundle"] | ||||
| 	path = vendor/grammars/Textmate-Gosu-Bundle | ||||
| 	url = https://github.com/jpcamara/Textmate-Gosu-Bundle | ||||
| [submodule "vendor/grammars/jquery-tmbundle"] | ||||
| 	path = vendor/grammars/jquery-tmbundle | ||||
| 	url = https://github.com/kswedberg/jquery-tmbundle | ||||
| [submodule "vendor/grammars/fish-tmbundle"] | ||||
| 	path = vendor/grammars/fish-tmbundle | ||||
| 	url = https://github.com/l15n/fish-tmbundle | ||||
| [submodule "vendor/grammars/sublime-idris"] | ||||
| 	path = vendor/grammars/sublime-idris | ||||
| 	url = https://github.com/laughedelic/sublime-idris | ||||
| [submodule "vendor/grammars/sublime-better-typescript"] | ||||
| 	path = vendor/grammars/sublime-better-typescript | ||||
| 	url = https://github.com/lavrton/sublime-better-typescript | ||||
| [submodule "vendor/grammars/moonscript-tmbundle"] | ||||
| 	path = vendor/grammars/moonscript-tmbundle | ||||
| 	url = https://github.com/leafo/moonscript-tmbundle | ||||
| @@ -249,7 +237,7 @@ | ||||
| 	url = https://github.com/shellderp/sublime-robot-plugin | ||||
| [submodule "vendor/grammars/actionscript3-tmbundle"] | ||||
| 	path = vendor/grammars/actionscript3-tmbundle | ||||
| 	url = https://github.com/simongregory/actionscript3-tmbundle | ||||
| 	url = https://github.com/honzabrecka/actionscript3-tmbundle | ||||
| [submodule "vendor/grammars/Sublime-QML"] | ||||
| 	path = vendor/grammars/Sublime-QML | ||||
| 	url = https://github.com/skozlovf/Sublime-QML | ||||
| @@ -346,9 +334,6 @@ | ||||
| [submodule "vendor/grammars/java.tmbundle"] | ||||
| 	path = vendor/grammars/java.tmbundle | ||||
| 	url = https://github.com/textmate/java.tmbundle | ||||
| [submodule "vendor/grammars/javadoc.tmbundle"] | ||||
| 	path = vendor/grammars/javadoc.tmbundle | ||||
| 	url = https://github.com/textmate/javadoc.tmbundle | ||||
| [submodule "vendor/grammars/javascript-objective-j.tmbundle"] | ||||
| 	path = vendor/grammars/javascript-objective-j.tmbundle | ||||
| 	url = https://github.com/textmate/javascript-objective-j.tmbundle | ||||
| @@ -397,9 +382,6 @@ | ||||
| [submodule "vendor/grammars/pascal.tmbundle"] | ||||
| 	path = vendor/grammars/pascal.tmbundle | ||||
| 	url = https://github.com/textmate/pascal.tmbundle | ||||
| [submodule "vendor/grammars/perl.tmbundle"] | ||||
| 	path = vendor/grammars/perl.tmbundle | ||||
| 	url = https://github.com/textmate/perl.tmbundle | ||||
| [submodule "vendor/grammars/php-smarty.tmbundle"] | ||||
| 	path = vendor/grammars/php-smarty.tmbundle | ||||
| 	url = https://github.com/textmate/php-smarty.tmbundle | ||||
| @@ -412,9 +394,6 @@ | ||||
| [submodule "vendor/grammars/processing.tmbundle"] | ||||
| 	path = vendor/grammars/processing.tmbundle | ||||
| 	url = https://github.com/textmate/processing.tmbundle | ||||
| [submodule "vendor/grammars/prolog.tmbundle"] | ||||
| 	path = vendor/grammars/prolog.tmbundle | ||||
| 	url = https://github.com/textmate/prolog.tmbundle | ||||
| [submodule "vendor/grammars/python-django.tmbundle"] | ||||
| 	path = vendor/grammars/python-django.tmbundle | ||||
| 	url = https://github.com/textmate/python-django.tmbundle | ||||
| @@ -427,9 +406,6 @@ | ||||
| [submodule "vendor/grammars/ruby-haml.tmbundle"] | ||||
| 	path = vendor/grammars/ruby-haml.tmbundle | ||||
| 	url = https://github.com/textmate/ruby-haml.tmbundle | ||||
| [submodule "vendor/grammars/ruby-on-rails-tmbundle"] | ||||
| 	path = vendor/grammars/ruby-on-rails-tmbundle | ||||
| 	url = https://github.com/textmate/ruby-on-rails-tmbundle | ||||
| [submodule "vendor/grammars/scheme.tmbundle"] | ||||
| 	path = vendor/grammars/scheme.tmbundle | ||||
| 	url = https://github.com/textmate/scheme.tmbundle | ||||
| @@ -448,15 +424,6 @@ | ||||
| [submodule "vendor/grammars/tcl.tmbundle"] | ||||
| 	path = vendor/grammars/tcl.tmbundle | ||||
| 	url = https://github.com/textmate/tcl.tmbundle | ||||
| [submodule "vendor/grammars/text.tmbundle"] | ||||
| 	path = vendor/grammars/text.tmbundle | ||||
| 	url = https://github.com/textmate/text.tmbundle | ||||
| [submodule "vendor/grammars/textile.tmbundle"] | ||||
| 	path = vendor/grammars/textile.tmbundle | ||||
| 	url = https://github.com/textmate/textile.tmbundle | ||||
| [submodule "vendor/grammars/textmate.tmbundle"] | ||||
| 	path = vendor/grammars/textmate.tmbundle | ||||
| 	url = https://github.com/textmate/textmate.tmbundle | ||||
| [submodule "vendor/grammars/thrift.tmbundle"] | ||||
| 	path = vendor/grammars/thrift.tmbundle | ||||
| 	url = https://github.com/textmate/thrift.tmbundle | ||||
| @@ -490,10 +457,6 @@ | ||||
| [submodule "vendor/grammars/sublime-nix"] | ||||
| 	path = vendor/grammars/sublime-nix | ||||
| 	url = https://github.com/wmertens/sublime-nix | ||||
| [submodule "vendor/grammars/ada.tmbundle"] | ||||
| 	path = vendor/grammars/ada.tmbundle | ||||
| 	url = https://github.com/aroben/ada.tmbundle | ||||
| 	branch = better-with-highlighting | ||||
| [submodule "vendor/grammars/oz-tmbundle"] | ||||
| 	path = vendor/grammars/oz-tmbundle | ||||
| 	url = https://github.com/eregon/oz-tmbundle | ||||
| @@ -552,9 +515,6 @@ | ||||
| [submodule "vendor/grammars/liquid.tmbundle"] | ||||
| 	path = vendor/grammars/liquid.tmbundle | ||||
| 	url = https://github.com/bastilian/validcode-textmate-bundles | ||||
| [submodule "vendor/grammars/AutoHotkey"] | ||||
| 	path = vendor/grammars/AutoHotkey | ||||
| 	url = https://github.com/ahkscript/AutoHotkey | ||||
| [submodule "vendor/grammars/ats.sublime"] | ||||
| 	path = vendor/grammars/ats.sublime | ||||
| 	url = https://github.com/steinwaywhw/ats-mode-sublimetext | ||||
| @@ -579,3 +539,144 @@ | ||||
| [submodule "vendor/grammars/JSyntax"] | ||||
| 	path = vendor/grammars/JSyntax | ||||
| 	url = https://github.com/bcj/JSyntax | ||||
| [submodule "vendor/grammars/TXL"] | ||||
| 	path = vendor/grammars/TXL | ||||
| 	url = https://github.com/MikeHoffert/Sublime-Text-TXL-syntax | ||||
| [submodule "vendor/grammars/G-Code"] | ||||
| 	path = vendor/grammars/G-Code | ||||
| 	url = https://github.com/robotmaster/sublime-text-syntax-highlighting | ||||
| [submodule "vendor/grammars/grace-tmbundle"] | ||||
| 	path = vendor/grammars/grace-tmbundle | ||||
| 	url = https://github.com/zmthy/grace-tmbundle | ||||
| [submodule "vendor/grammars/sublime-text-ox"] | ||||
| 	path = vendor/grammars/sublime-text-ox | ||||
| 	url = https://github.com/andreashetland/sublime-text-ox | ||||
| [submodule "vendor/grammars/AutoHotkey"] | ||||
| 	path = vendor/grammars/AutoHotkey | ||||
| 	url = https://github.com/ahkscript/SublimeAutoHotkey | ||||
| [submodule "vendor/grammars/ec.tmbundle"] | ||||
| 	path = vendor/grammars/ec.tmbundle | ||||
| 	url = https://github.com/ecere/ec.tmbundle | ||||
| [submodule "vendor/grammars/InnoSetup"] | ||||
| 	path = vendor/grammars/InnoSetup | ||||
| 	url = https://github.com/idleberg/InnoSetup-Sublime-Text | ||||
| [submodule "vendor/grammars/gap-tmbundle"] | ||||
| 	path = vendor/grammars/gap-tmbundle | ||||
| 	url = https://github.com/dhowden/gap-tmbundle | ||||
| [submodule "vendor/grammars/SublimePapyrus"] | ||||
| 	path = vendor/grammars/SublimePapyrus | ||||
| 	url = https://github.com/Kapiainen/SublimePapyrus | ||||
| [submodule "vendor/grammars/sublime-spintools"] | ||||
| 	path = vendor/grammars/sublime-spintools | ||||
| 	url = https://github.com/bitbased/sublime-spintools | ||||
| [submodule "vendor/grammars/PogoScript.tmbundle"] | ||||
| 	path = vendor/grammars/PogoScript.tmbundle | ||||
| 	url = https://github.com/featurist/PogoScript.tmbundle | ||||
| [submodule "vendor/grammars/sublime-opal"] | ||||
| 	path = vendor/grammars/sublime-opal | ||||
| 	url = https://github.com/artifactz/sublime-opal | ||||
| [submodule "vendor/grammars/mediawiki.tmbundle"] | ||||
| 	path = vendor/grammars/mediawiki.tmbundle | ||||
| 	url = https://github.com/textmate/mediawiki.tmbundle | ||||
| [submodule "vendor/grammars/SublimeClarion"] | ||||
| 	path = vendor/grammars/SublimeClarion | ||||
| 	url = https://github.com/fushnisoft/SublimeClarion | ||||
| [submodule "vendor/grammars/oracle.tmbundle"] | ||||
| 	path = vendor/grammars/oracle.tmbundle | ||||
| 	url = https://github.com/mulander/oracle.tmbundle.git | ||||
| [submodule "vendor/grammars/BrightScript.tmbundle"] | ||||
| 	path = vendor/grammars/BrightScript.tmbundle | ||||
| 	url = https://github.com/cmink/BrightScript.tmbundle | ||||
| [submodule "vendor/grammars/Stylus"] | ||||
| 	path = vendor/grammars/Stylus | ||||
| 	url = https://github.com/billymoon/Stylus | ||||
| [submodule "vendor/grammars/asciidoc.tmbundle"] | ||||
| 	path = vendor/grammars/asciidoc.tmbundle | ||||
| 	url = https://github.com/zuckschwerdt/asciidoc.tmbundle | ||||
| [submodule "vendor/grammars/sublime-text-pig-latin"] | ||||
| 	path = vendor/grammars/sublime-text-pig-latin | ||||
| 	url = https://github.com/goblindegook/sublime-text-pig-latin | ||||
| [submodule "vendor/grammars/Lean.tmbundle"] | ||||
| 	path = vendor/grammars/Lean.tmbundle | ||||
| 	url = https://github.com/leanprover/Lean.tmbundle | ||||
| [submodule "vendor/grammars/ampl"] | ||||
| 	path = vendor/grammars/ampl | ||||
| 	url = https://github.com/ampl/sublime-ampl | ||||
| [submodule "vendor/grammars/openscad.tmbundle"] | ||||
| 	path = vendor/grammars/openscad.tmbundle | ||||
| 	url = https://github.com/tbuser/openscad.tmbundle | ||||
| [submodule "vendor/grammars/sublime-varnish"] | ||||
| 	path = vendor/grammars/sublime-varnish | ||||
| 	url = https://github.com/brandonwamboldt/sublime-varnish | ||||
| [submodule "vendor/grammars/xc.tmbundle"] | ||||
| 	path = vendor/grammars/xc.tmbundle | ||||
| 	url = https://github.com/graymalkin/xc.tmbundle | ||||
| [submodule "vendor/grammars/perl.tmbundle"] | ||||
| 	path = vendor/grammars/perl.tmbundle | ||||
| 	url = https://github.com/textmate/perl.tmbundle | ||||
| [submodule "vendor/grammars/sublime-netlinx"] | ||||
| 	path = vendor/grammars/sublime-netlinx | ||||
| 	url = https://github.com/amclain/sublime-netlinx | ||||
| [submodule "vendor/grammars/Sublime-Red"] | ||||
| 	path = vendor/grammars/Sublime-Red | ||||
| 	url = https://github.com/Oldes/Sublime-Red | ||||
| [submodule "vendor/grammars/jflex.tmbundle"] | ||||
| 	path = vendor/grammars/jflex.tmbundle | ||||
| 	url = https://github.com/jflex-de/jflex.tmbundle.git | ||||
| [submodule "vendor/grammars/Sublime-Modula-2"] | ||||
| 	path = vendor/grammars/Sublime-Modula-2 | ||||
| 	url = https://github.com/harogaston/Sublime-Modula-2 | ||||
| [submodule "vendor/grammars/ada.tmbundle"] | ||||
| 	path = vendor/grammars/ada.tmbundle | ||||
| 	url = https://github.com/textmate/ada.tmbundle | ||||
| [submodule "vendor/grammars/api-blueprint-sublime-plugin"] | ||||
| 	path = vendor/grammars/api-blueprint-sublime-plugin | ||||
| 	url = https://github.com/apiaryio/api-blueprint-sublime-plugin | ||||
| [submodule "vendor/grammars/Handlebars"] | ||||
| 	path = vendor/grammars/Handlebars | ||||
| 	url = https://github.com/daaain/Handlebars | ||||
| [submodule "vendor/grammars/smali-sublime"] | ||||
| 	path = vendor/grammars/smali-sublime | ||||
| 	url = https://github.com/ShaneWilton/sublime-smali | ||||
| [submodule "vendor/grammars/language-jsoniq"] | ||||
| 	path = vendor/grammars/language-jsoniq | ||||
| 	url = http://github.com/wcandillon/language-jsoniq | ||||
| [submodule "vendor/grammars/atom-fsharp"] | ||||
| 	path = vendor/grammars/atom-fsharp | ||||
| 	url = https://github.com/fsprojects/atom-fsharp | ||||
| [submodule "vendor/grammars/SMT.tmbundle"] | ||||
| 	path = vendor/grammars/SMT.tmbundle | ||||
| 	url = https://github.com/SRI-CSL/SMT.tmbundle.git | ||||
| [submodule "vendor/grammars/language-crystal"] | ||||
| 	path = vendor/grammars/language-crystal | ||||
| 	url = https://github.com/k2b6s9j/language-crystal | ||||
| [submodule "vendor/grammars/language-xbase"] | ||||
| 	path = vendor/grammars/language-xbase | ||||
| 	url = https://github.com/hernad/atom-language-harbour | ||||
| [submodule "vendor/grammars/language-ncl"] | ||||
| 	path = vendor/grammars/language-ncl | ||||
| 	url = https://github.com/rpavlick/language-ncl.git | ||||
| [submodule "vendor/grammars/atom-language-purescript"] | ||||
| 	path = vendor/grammars/atom-language-purescript | ||||
| 	url = https://github.com/freebroccolo/atom-language-purescript | ||||
| [submodule "vendor/grammars/vue-syntax-highlight"] | ||||
| 	path = vendor/grammars/vue-syntax-highlight | ||||
| 	url = https://github.com/vuejs/vue-syntax-highlight | ||||
| [submodule "vendor/grammars/st2-zonefile"] | ||||
| 	path = vendor/grammars/st2-zonefile | ||||
| 	url = https://github.com/sixty4k/st2-zonefile | ||||
| [submodule "vendor/grammars/sublimeprolog"] | ||||
| 	path = vendor/grammars/sublimeprolog | ||||
| 	url = https://github.com/alnkpa/sublimeprolog | ||||
| [submodule "vendor/grammars/sublime-aspectj"] | ||||
| 	path = vendor/grammars/sublime-aspectj | ||||
| 	url = https://github.com/pchaigno/sublime-aspectj | ||||
| [submodule "vendor/grammars/sublime-typescript"] | ||||
| 	path = vendor/grammars/sublime-typescript | ||||
| 	url = https://github.com/Microsoft/TypeScript-Sublime-Plugin | ||||
| [submodule "vendor/grammars/X10"] | ||||
| 	path = vendor/grammars/X10 | ||||
| 	url = git@github.com:x10-lang/x10-highlighting.git | ||||
| [submodule "vendor/grammars/language-babel"] | ||||
| 	path = vendor/grammars/language-babel | ||||
| 	url = https://github.com/gandm/language-babel | ||||
|   | ||||
| @@ -1,4 +1,3 @@ | ||||
| sudo: false | ||||
| before_install: script/travis/before_install | ||||
| rvm: | ||||
|   - 1.9.3 | ||||
|   | ||||
| @@ -1,41 +1,105 @@ | ||||
| ## Contributing | ||||
| # Contributing | ||||
|  | ||||
| The majority of contributions won't need to touch any Ruby code at all. The [master language list][languages] is just a YAML configuration file. | ||||
| [code-of-conduct]: http://todogroup.org/opencodeofconduct/#Linguist/opensource@github.com | ||||
|  | ||||
| Almost all bug fixes or new language additions should come with some additional code samples. Just drop them under [`samples/`][samples] in the correct subdirectory and our test suite will automatically test them. In most cases you shouldn't need to add any new assertions. | ||||
| Hi there! We're thrilled that you'd like to contribute to this project. Your help is essential for keeping it great. This project adheres to the [Open Code of Conduct][code-of-conduct]. By participating, you are expected to uphold this code. | ||||
|  | ||||
| ### My code is detected as the wrong language | ||||
| The majority of contributions won't need to touch any Ruby code at all. | ||||
|  | ||||
| This can usually be solved either by adding a new filename or file name extension to the language's entry in [`languages.yml`][languages] or adding more [samples][samples] for your language to the repository to make Linguist's classifier smarter. | ||||
| ## Adding an extension to a language | ||||
|  | ||||
| ### Syntax highlighting looks wrong | ||||
| We try only to add new extensions once they have some usage on GitHub. In most cases we prefer that extensions be in use in hundreds of repositories before supporting them in Linguist. | ||||
|  | ||||
| Assuming your code is being detected as the right language (see above), in most cases this is due to a bug in the language grammar rather than a bug in Linguist. [`grammars.yml`][grammars] lists all the grammars we use for syntax highlighting on github.com. Find the one corresponding to your code's programming language and submit a bug report upstream. If you can, try to reproduce the highlighting problem in the text editor that the grammar is designed for (TextMate, Sublime Text, or Atom) and include that information in your bug report. | ||||
| To add support for a new extension: | ||||
|  | ||||
| You can also try to fix the bug yourself and submit a Pull Request. [This piece from TextMate's documentation](http://manual.macromates.com/en/language_grammars) offers a good introduction on how to work with TextMate-compatible grammars. You can test grammars using [Lightshow](https://lightshow.githubapp.com). | ||||
| 0. Add your extension to the language entry in [`languages.yml`][languages]. | ||||
| 0. Add at least one sample for your extension to the [samples directory][samples] in the correct subdirectory. | ||||
| 0. Open a pull request, linking to a [GitHub search result](https://github.com/search?utf8=%E2%9C%93&q=extension%3Aboot+NOT+nothack&type=Code&ref=searchresults) showing in-the-wild usage. | ||||
|  | ||||
| Once the bug has been fixed upstream, please let us know and we'll pick it up for GitHub. | ||||
| In addition, if this extension is already listed in [`languages.yml`][languages] then sometimes a few more steps will need to be taken: | ||||
|  | ||||
| ### I want to add support for the `X` programming language | ||||
| 0. Make sure that example `.yourextension` files are present in the [samples directory][samples] for each language that uses `.yourextension`. | ||||
| 0. Test the performance of the Bayesian classifier with a relatively large number (1000s) of sample `.yourextension` files. (ping @arfon or @bkeepers to help with this) to ensure we're not misclassifying files. | ||||
| 0. If the Bayesian classifier does a bad job with the sample `.yourextension` files then a [heuristic](https://github.com/github/linguist/blob/master/lib/linguist/heuristics.rb) may need to be written to help. | ||||
|  | ||||
| Great! You'll need to: | ||||
|  | ||||
| ## Adding a language | ||||
|  | ||||
| We try only to add languages once they have some usage on GitHub. In most cases we prefer that each new file extension be in use in hundreds of repositories before supporting them in Linguist. | ||||
|  | ||||
| To add support for a new language: | ||||
|  | ||||
| 0. Add an entry for your language to [`languages.yml`][languages]. | ||||
| 0. Add a grammar for your language. Please only add grammars that have a license that permits redistribution. | ||||
|     0. Add your grammar as a submodule: `git submodule add https://github.com/JaneSmith/MyGrammar vendor/grammars/MyGrammar`. | ||||
|     0. Add your grammar to [`grammars.yml`][grammars] by running `script/convert-grammars --add vendor/grammars/MyGrammar`. | ||||
| 0. Add samples for your language to the [samples directory][samples]. | ||||
|   0. Add your grammar as a submodule: `git submodule add https://github.com/JaneSmith/MyGrammar vendor/grammars/MyGrammar`. | ||||
|   0. Add your grammar to [`grammars.yml`][grammars] by running `script/convert-grammars --add vendor/grammars/MyGrammar`. | ||||
| 0. Add samples for your language to the [samples directory][samples] in the correct subdirectory. | ||||
| 0. Open a pull request, linking to a [GitHub search result](https://github.com/search?utf8=%E2%9C%93&q=extension%3Aboot+NOT+nothack&type=Code&ref=searchresults) showing in-the-wild usage. | ||||
|  | ||||
| In addition, if your new language defines an extension that's already listed in [`languages.yml`][languages] (such as `.foo`) then sometimes a few more steps will need to be taken: | ||||
|  | ||||
| 0. Make sure that example `.foo` files are present in the [samples directory][samples] for each language that uses `.foo`.  | ||||
| 0. Make sure that example `.foo` files are present in the [samples directory][samples] for each language that uses `.foo`. | ||||
| 0. Test the performance of the Bayesian classifier with a relatively large number (1000s) of sample `.foo` files. (ping @arfon or @bkeepers to help with this) to ensure we're not misclassifying files. | ||||
| 0. If the Bayesian classifier does a bad job with the sample `.foo` files then a [heuristic](https://github.com/github/linguist/blob/master/lib/linguist/heuristics.rb) may need to be written to help. | ||||
|  | ||||
| Remember, the goal here is to try and avoid false positives! | ||||
|  | ||||
| We try only to add languages once they have some usage on GitHub, so please note in-the-wild usage examples in your pull request. In most cases we prefer that languages already be in use in hundreds of repositories before supporting them in Linguist. | ||||
|  | ||||
| ## Fixing a misclassified language | ||||
|  | ||||
| Most languages are detected by their file extension defined in [languages.yml][languages].  For disambiguating between files with common extensions, linguist applies some [heuristics](/lib/linguist/heuristics.rb) and a [statistical classifier](lib/linguist/classifier.rb). This process can help differentiate between, for example, `.h` files which could be either C, C++, or Obj-C. | ||||
|  | ||||
| Misclassifications can often be solved by either adding a new filename or extension for the language or adding more [samples][samples] to make the classifier smarter. | ||||
|  | ||||
|  | ||||
| ## Fixing syntax highlighting | ||||
|  | ||||
| Syntax highlighting in GitHub is performed using TextMate-compatible grammars. These are the same grammars that TextMate, Sublime Text and Atom use. Every language in [languages.yml][languages] is mapped to its corresponding TM `scope`. This scope will be used when picking up a grammar for highlighting. | ||||
|  | ||||
| Assuming your code is being detected as the right language, in most cases this is due to a bug in the language grammar rather than a bug in Linguist. [`grammars.yml`][grammars] lists all the grammars we use for syntax highlighting on github.com. Find the one corresponding to your code's programming language and submit a bug report upstream. If you can, try to reproduce the highlighting problem in the text editor that the grammar is designed for (TextMate, Sublime Text, or Atom) and include that information in your bug report. | ||||
|  | ||||
| You can also try to fix the bug yourself and submit a Pull Request. [TextMate's documentation](https://manual.macromates.com/en/language_grammars) offers a good introduction on how to work with TextMate-compatible grammars. You can test grammars using [Lightshow](https://github-lightshow.herokuapp.com). | ||||
|  | ||||
| Once the bug has been fixed upstream, we'll pick it up for GitHub in the next release of Linguist. | ||||
|  | ||||
| ## Testing | ||||
|  | ||||
| For development you are going to want to checkout out the source. To get it, clone the repo and run [Bundler](http://gembundler.com/) to install its dependencies. | ||||
|  | ||||
|     git clone https://github.com/github/linguist.git | ||||
|     cd linguist/ | ||||
|     script/bootstrap | ||||
|  | ||||
| To run the tests: | ||||
|  | ||||
|     bundle exec rake test | ||||
|  | ||||
| Sometimes getting the tests running can be too much work, especially if you don't have much Ruby experience. It's okay: be lazy and let our build bot [Travis](https://travis-ci.org/#!/github/linguist) run the tests for you. Just open a pull request and the bot will start cranking away. | ||||
|  | ||||
| Here's our current build status: [](https://travis-ci.org/github/linguist) | ||||
|  | ||||
|  | ||||
| ## Releasing | ||||
|  | ||||
| If you are the current maintainer of this gem: | ||||
|  | ||||
| 0. Create a branch for the release: `git checkout -b cut-release-vxx.xx.xx` | ||||
| 0. Make sure your local dependencies are up to date: `script/bootstrap` | ||||
| 0. If grammar submodules have not been updated recently, update them: `git submodule update --remote && git commit -a` | ||||
| 0. Ensure that samples are updated: `bundle exec rake samples` | ||||
| 0. Ensure that tests are green: `bundle exec rake test` | ||||
| 0. Bump gem version in `lib/linguist/version.rb`, [like this](https://github.com/github/linguist/commit/8d2ea90a5ba3b2fe6e1508b7155aa4632eea2985). | ||||
| 0. Make a PR to github/linguist, [like this](https://github.com/github/linguist/pull/1238). | ||||
| 0. Build a local gem: `bundle exec rake build_gem` | ||||
| 0. Test the gem: | ||||
|   0. Bump the Gemfile and Gemfile.lock versions for an app which relies on this gem | ||||
|   0. Install the new gem locally | ||||
|   0. Test behavior locally, branch deploy, whatever needs to happen | ||||
| 0. Merge github/linguist PR | ||||
| 0. Tag and push: `git tag vx.xx.xx; git push --tags` | ||||
| 0. Push to rubygems.org -- `gem push github-linguist-3.0.0.gem` | ||||
|  | ||||
| [grammars]: /grammars.yml | ||||
| [languages]: /lib/linguist/languages.yml | ||||
| [samples]: /samples | ||||
| [new-issue]: https://github.com/github/linguist/issues/new | ||||
|   | ||||
							
								
								
									
										227
									
								
								README.md
									
									
									
									
									
								
							
							
						
						
									
										227
									
								
								README.md
									
									
									
									
									
								
							| @@ -1,45 +1,82 @@ | ||||
| # Linguist | ||||
|  | ||||
| We use this library at GitHub to detect blob languages, ignore binary files, suppress generated files in diffs, and generate language breakdown graphs. | ||||
| [issues]: https://github.com/github/linguist/issues | ||||
| [new-issue]: https://github.com/github/linguist/issues/new | ||||
|  | ||||
| Tips for filing issues and creating pull requests can be found in [`CONTRIBUTING.md`](/CONTRIBUTING.md). | ||||
| This library is used on GitHub.com to detect blob languages, ignore binary or vendored files, suppress generated files in diffs, and generate language breakdown graphs. | ||||
|  | ||||
| ## Features | ||||
| See [Troubleshooting](#troubleshooting) and [`CONTRIBUTING.md`](/CONTRIBUTING.md) before filing an issue or creating a pull request. | ||||
|  | ||||
| ### Language detection | ||||
| ## Troubleshooting | ||||
|  | ||||
| Linguist defines a list of all languages known to GitHub in a [yaml file](https://github.com/github/linguist/blob/master/lib/linguist/languages.yml). | ||||
| ### My repository is detected as the wrong language | ||||
|  | ||||
| Most languages are detected by their file extension. For disambiguating between files with common extensions, we first apply some common-sense heuristics to pick out obvious languages. After that, we use a | ||||
| [statistical | ||||
| classifier](https://github.com/github/linguist/blob/master/lib/linguist/classifier.rb). | ||||
| This process can help us tell the difference between, for example, `.h` files which could be either C, C++, or Obj-C. | ||||
|  | ||||
|  | ||||
| ```ruby | ||||
| The Language stats bar displays languages percentages for the files in the repository. The percentages are calculated based on the bytes of code for each language as reported by the [List Languages](https://developer.github.com/v3/repos/#list-languages) API. If the bar is reporting a language that you don't expect: | ||||
|  | ||||
| Linguist::FileBlob.new("lib/linguist.rb").language.name #=> "Ruby" | ||||
| 0. Click on the name of the language in the stats bar to see a list of the files that are identified as that language. | ||||
| 0. If you see files that you didn't write, consider moving the files into one of the [paths for vendored  code](/lib/linguist/vendor.yml), or use the [manual overrides](#overrides) feature to ignore them. | ||||
| 0. If the files are being misclassified, search for [open issues][issues] to see if anyone else has already reported the issue. Any information you an add, especially links to public repositories, is helpful. | ||||
| 0. If there are no reported issues of this misclassification, [open an issue][new-issue] and include a link to the repository or a sample of the code that is being misclassified. | ||||
|  | ||||
| Linguist::FileBlob.new("bin/linguist").language.name #=> "Ruby" | ||||
| ## Overrides | ||||
|  | ||||
| Linguist supports a number of different custom overrides strategies for language definitions and vendored paths. | ||||
|  | ||||
| ### Using gitattributes | ||||
|  | ||||
| Add a `.gitattributes` file to your project and use standard git-style path matchers for the files you want to override to set `linguist-documentation`, `linguist-language`, and `linguist-vendored`. `.gitattributes` will be used to determine language statistics, but will not be used to syntax highlight files. To manually set syntax highlighting, use [Vim or Emacs modelines](#using-emacs-or-vim-modelines). | ||||
|  | ||||
| ``` | ||||
| $ cat .gitattributes | ||||
| *.rb linguist-language=Java | ||||
| ``` | ||||
|  | ||||
| See [lib/linguist/language.rb](https://github.com/github/linguist/blob/master/lib/linguist/language.rb) and [lib/linguist/languages.yml](https://github.com/github/linguist/blob/master/lib/linguist/languages.yml). | ||||
| Checking code you didn't write, such as JavaScript libraries, into your git repo is a common practice, but this often inflates your project's language stats and may even cause your project to be labeled as another language. By default, Linguist treats all of the paths defined in [lib/linguist/vendor.yml](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml) as vendored and therefore doesn't include them in the language statistics for a repository. Vendored files are also hidden by default in diffs on github.com. | ||||
|  | ||||
| ### Syntax Highlighting | ||||
| Use the `linguist-vendored` attribute to vendor or un-vendor paths. Please note, overriding the vendored (or un-vendored) status of a file only affects the language statistics for the repository and not the behavior in diffs on github.com. | ||||
|  | ||||
| Syntax highlighting in GitHub is performed using TextMate-compatible grammars. These are the same grammars that TextMate, Sublime Text and Atom use. | ||||
| ``` | ||||
| $ cat .gitattributes | ||||
| special-vendored-path/* linguist-vendored | ||||
| jquery.js linguist-vendored=false | ||||
| ``` | ||||
|  | ||||
| Every language in `languages.yml` is mapped to its corresponding TM `scope`. This scope will be used when picking up a grammar for highlighting. **When adding a new language to Linguist, please add its corresponding scope too (assuming there's an existing TextMate bundle, Sublime Text package, or Atom package) so syntax highlighting works for it**. | ||||
| Similar to vendored files, Linguist excludes documentation files from your project's language stats. (Unlike vendored files, documentation files are displayed in diffs on github.com.) [lib/linguist/documentation.yml](lib/linguist/documentation.yml) lists common documentation paths and excludes them from the language statistics for your repository. | ||||
|  | ||||
| ### Stats | ||||
| Use the `linguist-documentation` attribute to mark or unmark paths as documentation. | ||||
|  | ||||
| The Language stats bar that you see on every repository is built by aggregating the languages of each file in that repository. The top language in the graph determines the project's primary language. | ||||
| ``` | ||||
| $ cat .gitattributes | ||||
| project-docs/* linguist-documentation | ||||
| docs/formatter.rb linguist-documentation=false | ||||
| ``` | ||||
|  | ||||
| The repository stats API, accessed through `#languages`, can be used on a directory: | ||||
| ### Using Emacs or Vim modelines | ||||
|  | ||||
| ***API UPDATE*** | ||||
| Alternatively, you can use Vim or Emacs style modelines to set the language for a single file. Modelines can be placed anywhere within a file and are respected when determining how to syntax-highlight a file on GitHub.com | ||||
|  | ||||
| Since [Version 3.0.0](https://github.com/github/linguist/releases/tag/v3.0.0) Linguist expects a git repository (in the form of a [Rugged::Repository](https://github.com/libgit2/rugged#repositories)) to be passed when initializing `Linguist::Repository`. | ||||
| ##### Vim | ||||
| ``` | ||||
| vim: set filetype=prolog: | ||||
| vim: set ft=cpp: | ||||
| ``` | ||||
|  | ||||
| ##### Emacs | ||||
| ``` | ||||
| -*- mode: php;-*- | ||||
| ``` | ||||
|  | ||||
| ## Usage | ||||
|  | ||||
| Install the gem: | ||||
|  | ||||
| ``` | ||||
| $ gem install github-linguist | ||||
| ``` | ||||
|  | ||||
| Then use it in your application: | ||||
|  | ||||
| ```ruby | ||||
| require 'rugged' | ||||
| @@ -51,147 +88,27 @@ project.language       #=> "Ruby" | ||||
| project.languages      #=> { "Ruby" => 119387 } | ||||
| ``` | ||||
|  | ||||
| These stats are also printed out by the `linguist` binary. You can use the | ||||
| These stats are also printed out by the `linguist` executable. You can use the | ||||
| `--breakdown` flag, and the binary will also output the breakdown of files by language. | ||||
|  | ||||
| You can try running `linguist` on the root directory in this repository itself: | ||||
|  | ||||
|     $ bundle exec linguist --breakdown | ||||
| ``` | ||||
| $ bundle exec linguist --breakdown | ||||
|  | ||||
|     100.00% Ruby | ||||
| 100.00% Ruby | ||||
|  | ||||
|     Ruby: | ||||
|     Gemfile | ||||
|     Rakefile | ||||
|     bin/linguist | ||||
|     github-linguist.gemspec | ||||
|     lib/linguist.rb | ||||
|     lib/linguist/blob_helper.rb | ||||
|     lib/linguist/classifier.rb | ||||
|     lib/linguist/file_blob.rb | ||||
|     lib/linguist/generated.rb | ||||
|     lib/linguist/heuristics.rb | ||||
|     lib/linguist/language.rb | ||||
|     lib/linguist/lazy_blob.rb | ||||
|     lib/linguist/md5.rb | ||||
|     lib/linguist/repository.rb | ||||
|     lib/linguist/samples.rb | ||||
|     lib/linguist/tokenizer.rb | ||||
|     lib/linguist/version.rb | ||||
|     test/test_blob.rb | ||||
|     test/test_classifier.rb | ||||
|     test/test_heuristics.rb | ||||
|     test/test_language.rb | ||||
|     test/test_md5.rb | ||||
|     test/test_pedantic.rb | ||||
|     test/test_repository.rb | ||||
|     test/test_samples.rb | ||||
|     test/test_tokenizer.rb | ||||
|  | ||||
| #### Ignore vendored files | ||||
|  | ||||
| Checking other code into your git repo is a common practice. But this often inflates your project's language stats and may even cause your project to be labeled as another language. We are able to identify some of these files and directories and exclude them. | ||||
|  | ||||
| ```ruby | ||||
| Linguist::FileBlob.new("vendor/plugins/foo.rb").vendored? # => true | ||||
| Ruby: | ||||
| Gemfile | ||||
| Rakefile | ||||
| bin/linguist | ||||
| github-linguist.gemspec | ||||
| lib/linguist.rb | ||||
| … | ||||
| ``` | ||||
|  | ||||
| See [Linguist::BlobHelper#vendored?](https://github.com/github/linguist/blob/master/lib/linguist/blob_helper.rb) and [lib/linguist/vendor.yml](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml). | ||||
| ## Contributing | ||||
|  | ||||
| #### Generated file detection | ||||
| Please check out our [contributing guidelines](CONTRIBUTING.md). | ||||
|  | ||||
| Not all plain text files are true source files. Generated files like minified js and compiled CoffeeScript can be detected and excluded from language stats. As an extra bonus, these files are suppressed in diffs. | ||||
|  | ||||
| ```ruby | ||||
| Linguist::FileBlob.new("underscore.min.js").generated? # => true | ||||
| ``` | ||||
|  | ||||
| See [Linguist::Generated#generated?](https://github.com/github/linguist/blob/master/lib/linguist/generated.rb). | ||||
|  | ||||
| ## Overrides | ||||
|  | ||||
| Linguist supports custom overrides for language definitions and vendored paths. Add a `.gitattributes` file to your project using the keys `linguist-language` and `linguist-vendored` with the standard git-style path matchers for the files you want to override. | ||||
|  | ||||
| Please note that the overrides currently only affect the language statistics for a repository and not the syntax-highlighting of files. | ||||
|  | ||||
| ``` | ||||
| $ cat .gitattributes | ||||
| *.rb linguist-language=Java | ||||
|  | ||||
| $ linguist --breakdown | ||||
| 100.00% Java | ||||
|  | ||||
| Java: | ||||
| ruby_file.rb | ||||
| ``` | ||||
|  | ||||
| By default, Linguist treats all of the paths defined in [lib/linguist/vendor.yml](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml) as vendored and therefore doesn't include them in the language statistics for a repository. Use the `linguist-vendored` attribute to vendor or un-vendor paths. | ||||
|  | ||||
| ``` | ||||
| $ cat .gitattributes | ||||
| special-vendored-path/* linguist-vendored | ||||
| jquery.js linguist-vendored=false | ||||
| ``` | ||||
|  | ||||
| ## Installation | ||||
|  | ||||
| Github.com is usually running the latest version of the `github-linguist` gem that is released on [RubyGems.org](http://rubygems.org/gems/github-linguist). | ||||
|  | ||||
| But for development you are going to want to checkout out the source. To get it, clone the repo and run [Bundler](http://gembundler.com/) to install its dependencies. | ||||
|  | ||||
|     git clone https://github.com/github/linguist.git | ||||
|     cd linguist/ | ||||
|     script/bootstrap | ||||
|  | ||||
| To run the tests: | ||||
|  | ||||
|     bundle exec rake test | ||||
|  | ||||
| ### A note on language extensions | ||||
|  | ||||
| Linguist has a number of methods available to it for identifying the language of a particular file. The initial lookup is based upon the extension of the file, possible file extensions are defined in an array called `extensions`. Take a look at this example for example for `Perl`: | ||||
|  | ||||
| ``` | ||||
| Perl: | ||||
|   type: programming | ||||
|   ace_mode: perl | ||||
|   color: "#0298c3" | ||||
|   extensions: | ||||
|   - .pl | ||||
|   - .PL | ||||
|   - .perl | ||||
|   - .ph | ||||
|   - .plx | ||||
|   - .pm | ||||
|   - .pod | ||||
|   - .psgi | ||||
|   interpreters: | ||||
|   - perl | ||||
| ``` | ||||
| Any of the extensions defined are valid but the first in this array should be the most popular. | ||||
|  | ||||
| ### Testing | ||||
|  | ||||
| Sometimes getting the tests running can be too much work, especially if you don't have much Ruby experience. It's okay: be lazy and let our build bot [Travis](http://travis-ci.org/#!/github/linguist) run the tests for you. Just open a pull request and the bot will start cranking away. | ||||
|  | ||||
| Here's our current build status, which is hopefully green: [](http://travis-ci.org/github/linguist) | ||||
|  | ||||
| ### Releasing | ||||
|  | ||||
| If you are the current maintainer of this gem: | ||||
|  | ||||
|  0. Create a branch for the release: `git checkout -b cut-release-vxx.xx.xx` | ||||
|  0. Make sure your local dependencies are up to date: `script/bootstrap` | ||||
|  0. If grammar submodules have not been updated recently, update them: `git submodule update --remote && git commit -a` | ||||
|  0. Ensure that samples are updated: `bundle exec rake samples` | ||||
|  0. Ensure that tests are green: `bundle exec rake test` | ||||
|  0. Bump gem version in `lib/linguist/version.rb`.  For example, [like this](https://github.com/github/linguist/commit/8d2ea90a5ba3b2fe6e1508b7155aa4632eea2985). | ||||
|  0. Make a PR to github/linguist.  For example, [#1238](https://github.com/github/linguist/pull/1238). | ||||
|  0. Build a local gem: `bundle exec rake build_gem` | ||||
|  0. Testing: | ||||
|    0. Bump the Gemfile and Gemfile.lock versions for an app which relies on this gem | ||||
|    0. Install the new gem locally | ||||
|    0. Test behavior locally, branch deploy, whatever needs to happen | ||||
|  0. Merge github/linguist PR | ||||
|  0. Tag and push: `git tag vx.xx.xx; git push --tags` | ||||
|  0. Push to rubygems.org -- `gem push github-linguist-3.0.0.gem` | ||||
| ## | ||||
|   | ||||
							
								
								
									
										2
									
								
								Rakefile
									
									
									
									
									
								
							
							
						
						
									
										2
									
								
								Rakefile
									
									
									
									
									
								
							| @@ -62,7 +62,7 @@ namespace :benchmark do | ||||
|  | ||||
|     corpus = File.expand_path(ENV["CORPUS"] || "samples") | ||||
|  | ||||
|     require 'linguist/language' | ||||
|     require 'linguist' | ||||
|  | ||||
|     results = Hash.new | ||||
|     Dir.glob("#{corpus}/**/*").each do |file| | ||||
|   | ||||
							
								
								
									
										141
									
								
								bin/git-linguist
									
									
									
									
									
										Executable file
									
								
							
							
						
						
									
										141
									
								
								bin/git-linguist
									
									
									
									
									
										Executable file
									
								
							| @@ -0,0 +1,141 @@ | ||||
| #!/usr/bin/env ruby | ||||
|  | ||||
| require 'linguist' | ||||
| require 'rugged' | ||||
| require 'optparse' | ||||
| require 'json' | ||||
| require 'tmpdir' | ||||
| require 'zlib' | ||||
|  | ||||
| class GitLinguist | ||||
|   attr_reader :repo_path | ||||
|   attr_reader :commit_oid | ||||
|   attr_reader :incremental | ||||
|  | ||||
|   def initialize(path, commit_oid, incremental = true) | ||||
|     @repo_path = path | ||||
|     @commit_oid = commit_oid || rugged.head.target_id | ||||
|     @incremental = incremental | ||||
|   end | ||||
|  | ||||
|   def linguist | ||||
|     repo = Linguist::Repository.new(rugged, commit_oid) | ||||
|  | ||||
|     if incremental && stats = load_language_stats | ||||
|       old_commit_oid, old_stats = stats | ||||
|  | ||||
|       # A cache with NULL oid means that we want to froze | ||||
|       # these language stats in place and stop computing | ||||
|       # them (for performance reasons) | ||||
|       return old_stats if old_commit_oid == NULL_OID | ||||
|       repo.load_existing_stats(old_commit_oid, old_stats) | ||||
|     end | ||||
|  | ||||
|     result = yield repo | ||||
|  | ||||
|     save_language_stats(commit_oid, repo.cache) | ||||
|     result | ||||
|   end | ||||
|  | ||||
|   def load_language_stats | ||||
|     version, commit_oid, stats = load_cache | ||||
|     if version == LANGUAGE_STATS_CACHE_VERSION && commit_oid && stats | ||||
|       [commit_oid, stats] | ||||
|     end | ||||
|   end | ||||
|  | ||||
|   def save_language_stats(commit_oid, stats) | ||||
|     cache = [LANGUAGE_STATS_CACHE_VERSION, commit_oid, stats] | ||||
|     write_cache(cache) | ||||
|   end | ||||
|  | ||||
|   def clear_language_stats | ||||
|     File.unlink(cache_file) | ||||
|   end | ||||
|  | ||||
|   def disable_language_stats | ||||
|     save_language_stats(NULL_OID, {}) | ||||
|   end | ||||
|  | ||||
|   protected | ||||
|   NULL_OID = ("0" * 40).freeze | ||||
|  | ||||
|   LANGUAGE_STATS_CACHE = 'language-stats.cache' | ||||
|   LANGUAGE_STATS_CACHE_VERSION = "v3:#{Linguist::VERSION}" | ||||
|  | ||||
|   def rugged | ||||
|     @rugged ||= Rugged::Repository.bare(repo_path) | ||||
|   end | ||||
|  | ||||
|   def cache_file | ||||
|     File.join(repo_path, LANGUAGE_STATS_CACHE) | ||||
|   end | ||||
|  | ||||
|   def write_cache(object) | ||||
|     tmp_path = Dir::Tmpname.make_tmpname(cache_file, nil) | ||||
|  | ||||
|     File.open(tmp_path, "wb") do |f| | ||||
|       marshal = Marshal.dump(object) | ||||
|       f.write(Zlib::Deflate.deflate(marshal)) | ||||
|     end | ||||
|  | ||||
|     File.rename(tmp_path, cache_file) | ||||
|     tmp_path = nil | ||||
|   ensure | ||||
|     (File.unlink(tmp_path) rescue nil) if tmp_path | ||||
|   end | ||||
|  | ||||
|   def load_cache | ||||
|     marshal = File.open(cache_file, "rb") { |f| Zlib::Inflate.inflate(f.read) } | ||||
|     Marshal.load(marshal) | ||||
|   rescue SystemCallError, ::Zlib::DataError, ::Zlib::BufError, TypeError | ||||
|     nil | ||||
|   end | ||||
| end | ||||
|  | ||||
|  | ||||
| def git_linguist(args) | ||||
|   incremental = true | ||||
|   commit = nil | ||||
|   git_dir = nil | ||||
|  | ||||
|   parser = OptionParser.new do |opts| | ||||
|     opts.banner = "Usage: git-linguist [OPTIONS] stats|breakdown|dump-cache|clear|disable" | ||||
|  | ||||
|     opts.on("-f", "--force", "Force a full rescan") { incremental = false } | ||||
|     opts.on("--git-dir=DIR", "Path to the git repository") { |v| git_dir = v } | ||||
|     opts.on("--commit=COMMIT", "Commit to index") { |v| commit = v} | ||||
|   end | ||||
|  | ||||
|   parser.parse!(args) | ||||
|  | ||||
|   git_dir ||= begin | ||||
|     pwd = Dir.pwd | ||||
|     dotgit = File.join(pwd, ".git") | ||||
|     File.directory?(dotgit) ? dotgit : pwd | ||||
|   end | ||||
|  | ||||
|   wrapper = GitLinguist.new(git_dir, commit, incremental) | ||||
|  | ||||
|   case args.pop | ||||
|   when "stats" | ||||
|     wrapper.linguist do |linguist| | ||||
|       puts JSON.dump(linguist.languages) | ||||
|     end | ||||
|   when "breakdown" | ||||
|     wrapper.linguist do |linguist| | ||||
|       puts JSON.dump(linguist.breakdown_by_file) | ||||
|     end | ||||
|   when "dump-cache" | ||||
|     puts JSON.dump(wrapper.load_language_stats) | ||||
|   when "clear" | ||||
|     wrapper.clear_language_stats | ||||
|   when "disable" | ||||
|     wrapper.disable_language_stats | ||||
|   else | ||||
|     $stderr.print(parser.help) | ||||
|     exit 1 | ||||
|   end | ||||
| end | ||||
|  | ||||
| git_linguist(ARGV) | ||||
| @@ -2,10 +2,8 @@ | ||||
|  | ||||
| # linguist — detect language type for a file, or, given a directory, determine language breakdown | ||||
| #     usage: linguist <path> [<--breakdown>] | ||||
|  | ||||
| require 'linguist/file_blob' | ||||
| require 'linguist/language' | ||||
| require 'linguist/repository' | ||||
| # | ||||
| require 'linguist' | ||||
| require 'rugged' | ||||
|  | ||||
| path = ARGV[0] || Dir.pwd | ||||
|   | ||||
| @@ -11,16 +11,19 @@ Gem::Specification.new do |s| | ||||
|   s.license  = "MIT" | ||||
|  | ||||
|   s.files = Dir['lib/**/*'] - ['lib/linguist/grammars.rb'] | ||||
|   s.executables << 'linguist' | ||||
|   s.executables = ['linguist', 'git-linguist'] | ||||
|  | ||||
|   s.add_dependency 'charlock_holmes', '~> 0.7.3' | ||||
|   s.add_dependency 'escape_utils',    '~> 1.0.1' | ||||
|   s.add_dependency 'escape_utils',    '~> 1.1.0' | ||||
|   s.add_dependency 'mime-types',      '>= 1.19' | ||||
|   s.add_dependency 'rugged',          '~> 0.22.0b4' | ||||
|   s.add_dependency 'rugged',          '>= 0.23.0b' | ||||
|  | ||||
|   s.add_development_dependency 'minitest', '>= 5.0' | ||||
|   s.add_development_dependency 'mocha' | ||||
|   s.add_development_dependency 'pry' | ||||
|   s.add_development_dependency 'rake' | ||||
|   s.add_development_dependency 'yajl-ruby' | ||||
|   s.add_development_dependency 'color-proximity', '~> 0.2.1' | ||||
|   s.add_development_dependency 'licensee', '~> 4.7.4' | ||||
|  | ||||
| end | ||||
|   | ||||
							
								
								
									
										138
									
								
								grammars.yml
									
									
									
									
									
								
							
							
						
						
									
										138
									
								
								grammars.yml
									
									
									
									
									
								
							| @@ -24,8 +24,11 @@ vendor/grammars/Agda.tmbundle: | ||||
| - source.agda | ||||
| vendor/grammars/Alloy.tmbundle: | ||||
| - source.alloy | ||||
| vendor/grammars/AutoHotkey: | ||||
| vendor/grammars/AutoHotkey/: | ||||
| - source.ahk | ||||
| vendor/grammars/BrightScript.tmbundle/: | ||||
| - source.brightauthorproject | ||||
| - source.brightscript | ||||
| vendor/grammars/CLIPS-sublime: | ||||
| - source.clips | ||||
| vendor/grammars/ColdFusion: | ||||
| @@ -39,12 +42,20 @@ vendor/grammars/Docker.tmbundle: | ||||
| - source.dockerfile | ||||
| vendor/grammars/Elm.tmLanguage: | ||||
| - source.elm | ||||
| vendor/grammars/G-Code/: | ||||
| - source.LS | ||||
| - source.MCPOST | ||||
| - source.MOD | ||||
| - source.apt | ||||
| - source.gcode | ||||
| vendor/grammars/GDScript-sublime/: | ||||
| - source.gdscript | ||||
| vendor/grammars/Handlebars: | ||||
| - text.html.handlebars | ||||
| vendor/grammars/IDL-Syntax: | ||||
| - source.webidl | ||||
| vendor/grammars/InnoSetup/: | ||||
| - source.inno | ||||
| vendor/grammars/Isabelle.tmbundle: | ||||
| - source.isabelle.root | ||||
| - source.isabelle.theory | ||||
| @@ -52,6 +63,8 @@ vendor/grammars/JSyntax/: | ||||
| - source.j | ||||
| vendor/grammars/Julia.tmbundle: | ||||
| - source.julia | ||||
| vendor/grammars/Lean.tmbundle: | ||||
| - source.lean | ||||
| vendor/grammars/LiveScript.tmbundle: | ||||
| - source.livescript | ||||
| vendor/grammars/Modelica/: | ||||
| @@ -64,12 +77,16 @@ vendor/grammars/NimLime: | ||||
| - source.nimcfg | ||||
| vendor/grammars/PHP-Twig.tmbundle: | ||||
| - text.html.twig | ||||
| vendor/grammars/PogoScript.tmbundle/: | ||||
| - source.pogoscript | ||||
| vendor/grammars/RDoc.tmbundle: | ||||
| - text.rdoc | ||||
| vendor/grammars/Racket: | ||||
| - source.racket | ||||
| vendor/grammars/SCSS.tmbundle: | ||||
| - source.scss | ||||
| vendor/grammars/SMT.tmbundle: | ||||
| - source.smt | ||||
| vendor/grammars/Scalate.tmbundle: | ||||
| - source.scaml | ||||
| - text.html.ssp | ||||
| @@ -78,6 +95,8 @@ vendor/grammars/Slash.tmbundle: | ||||
| vendor/grammars/Stata.tmbundle: | ||||
| - source.mata | ||||
| - source.stata | ||||
| vendor/grammars/Stylus/: | ||||
| - source.stylus | ||||
| vendor/grammars/Sublime-Coq: | ||||
| - source.coq | ||||
| vendor/grammars/Sublime-HTTP: | ||||
| @@ -90,28 +109,43 @@ vendor/grammars/Sublime-Logos: | ||||
| - source.logos | ||||
| vendor/grammars/Sublime-Loom: | ||||
| - source.loomscript | ||||
| vendor/grammars/Sublime-Modula-2/: | ||||
| - source.modula2 | ||||
| vendor/grammars/Sublime-Nit: | ||||
| - source.nit | ||||
| vendor/grammars/Sublime-QML: | ||||
| - source.qml | ||||
| vendor/grammars/Sublime-REBOL: | ||||
| - source.rebol | ||||
| vendor/grammars/Sublime-Red: | ||||
| - source.red | ||||
| vendor/grammars/Sublime-SQF-Language: | ||||
| - source.sqf | ||||
| vendor/grammars/Sublime-Text-2-OpenEdge-ABL: | ||||
| - source.abl | ||||
| - text.html.abl | ||||
| vendor/grammars/Sublime-VimL: | ||||
| - source.viml | ||||
| vendor/grammars/SublimeBrainfuck: | ||||
| - source.bf | ||||
| vendor/grammars/SublimeClarion/: | ||||
| - source.clarion | ||||
| vendor/grammars/SublimePapyrus/: | ||||
| - source.compiled-papyrus | ||||
| - source.papyrus | ||||
| - source.papyrus-assembly | ||||
| vendor/grammars/SublimeXtend: | ||||
| - source.xtend | ||||
| vendor/grammars/TXL/: | ||||
| - source.txl | ||||
| vendor/grammars/Textmate-Gosu-Bundle: | ||||
| - source.gosu.2 | ||||
| vendor/grammars/VBDotNetSyntax: | ||||
| - source.vbnet | ||||
| vendor/grammars/Vala-TMBundle: | ||||
| - source.vala | ||||
| vendor/grammars/X10: | ||||
| - source.x10 | ||||
| vendor/grammars/abap.tmbundle: | ||||
| - source.abap | ||||
| vendor/grammars/actionscript3-tmbundle: | ||||
| @@ -120,6 +154,8 @@ vendor/grammars/actionscript3-tmbundle: | ||||
| - text.xml.flex-config | ||||
| vendor/grammars/ada.tmbundle: | ||||
| - source.ada | ||||
| vendor/grammars/ampl: | ||||
| - source.ampl | ||||
| vendor/grammars/ant.tmbundle: | ||||
| - text.xml.ant | ||||
| vendor/grammars/antlr.tmbundle: | ||||
| @@ -127,14 +163,23 @@ vendor/grammars/antlr.tmbundle: | ||||
| vendor/grammars/apache.tmbundle: | ||||
| - source.apache-config | ||||
| - source.apache-config.mod_perl | ||||
| vendor/grammars/api-blueprint-sublime-plugin/: | ||||
| - text.html.markdown.source.gfm.apib | ||||
| - text.html.markdown.source.gfm.mson | ||||
| vendor/grammars/applescript.tmbundle: | ||||
| - source.applescript | ||||
| vendor/grammars/asciidoc.tmbundle/: | ||||
| - text.html.asciidoc | ||||
| vendor/grammars/asp.tmbundle: | ||||
| - source.asp | ||||
| - text.html.asp | ||||
| vendor/grammars/assembly.tmbundle: | ||||
| - objdump.x86asm | ||||
| - source.x86asm | ||||
| vendor/grammars/atom-fsharp/: | ||||
| - source.fsharp | ||||
| vendor/grammars/atom-language-purescript/: | ||||
| - source.purescript | ||||
| vendor/grammars/atom-salt: | ||||
| - source.python.salt | ||||
| - source.yaml.salt | ||||
| @@ -181,6 +226,7 @@ vendor/grammars/d.tmbundle: | ||||
| vendor/grammars/dart-sublime-bundle: | ||||
| - source.dart | ||||
| - source.pubspec | ||||
| - text.dart-analysis-output | ||||
| - text.dart-doccomments | ||||
| vendor/grammars/desktop.tmbundle: | ||||
| - source.desktop | ||||
| @@ -192,6 +238,8 @@ vendor/grammars/dylan.tmbundle: | ||||
| - source.makegen | ||||
| vendor/grammars/ebundles/Bundles/MSDOS batch file.tmbundle: | ||||
| - source.dosbatch | ||||
| vendor/grammars/ec.tmbundle/: | ||||
| - source.c.ec | ||||
| vendor/grammars/eiffel.tmbundle: | ||||
| - source.eiffel | ||||
| vendor/grammars/elixir-tmbundle: | ||||
| @@ -211,14 +259,16 @@ vendor/grammars/fish-tmbundle: | ||||
| vendor/grammars/fortran.tmbundle: | ||||
| - source.fortran | ||||
| - source.fortran.modern | ||||
| vendor/grammars/fsharpbinding: | ||||
| - source.fsharp | ||||
| vendor/grammars/gap-tmbundle/: | ||||
| - source.gap | ||||
| vendor/grammars/gettext.tmbundle: | ||||
| - source.po | ||||
| vendor/grammars/gnuplot-tmbundle: | ||||
| - source.gnuplot | ||||
| vendor/grammars/go-tmbundle: | ||||
| - source.go | ||||
| vendor/grammars/grace-tmbundle/: | ||||
| - source.grace | ||||
| vendor/grammars/gradle.tmbundle: | ||||
| - source.groovy.gradle | ||||
| vendor/grammars/graphviz.tmbundle: | ||||
| @@ -256,22 +306,26 @@ vendor/grammars/java.tmbundle: | ||||
| - source.java-properties | ||||
| - text.html.jsp | ||||
| - text.junit-test-report | ||||
| vendor/grammars/javadoc.tmbundle: | ||||
| - text.html.javadoc | ||||
| vendor/grammars/javascript-objective-j.tmbundle: | ||||
| - source.js.objj | ||||
| vendor/grammars/jquery-tmbundle: | ||||
| - source.js.jquery | ||||
| vendor/grammars/jflex.tmbundle: | ||||
| - source.jflex | ||||
| vendor/grammars/json.tmbundle: | ||||
| - source.json | ||||
| vendor/grammars/kotlin-sublime-package: | ||||
| - source.Kotlin | ||||
| vendor/grammars/language-babel/: | ||||
| - source.js.jsx | ||||
| - source.regexp.babel | ||||
| vendor/grammars/language-clojure: | ||||
| - source.clojure | ||||
| vendor/grammars/language-coffee-script: | ||||
| - source.coffee | ||||
| - source.litcoffee | ||||
| vendor/grammars/language-crystal: | ||||
| - source.crystal | ||||
| vendor/grammars/language-csharp: | ||||
| - source.cake | ||||
| - source.cs | ||||
| - source.csx | ||||
| - source.nant-build | ||||
| @@ -282,6 +336,12 @@ vendor/grammars/language-hy: | ||||
| vendor/grammars/language-javascript: | ||||
| - source.js | ||||
| - source.js.regexp | ||||
| - source.js.regexp.replacement | ||||
| vendor/grammars/language-jsoniq/: | ||||
| - source.jq | ||||
| - source.xq | ||||
| vendor/grammars/language-ncl: | ||||
| - source.ncl | ||||
| vendor/grammars/language-python: | ||||
| - source.python | ||||
| - source.regexp.python | ||||
| @@ -290,6 +350,8 @@ vendor/grammars/language-python: | ||||
| vendor/grammars/language-shellscript: | ||||
| - source.shell | ||||
| - text.shell-session | ||||
| vendor/grammars/language-xbase: | ||||
| - source.harbour | ||||
| vendor/grammars/language-yaml: | ||||
| - source.yaml | ||||
| vendor/grammars/latex.tmbundle: | ||||
| @@ -324,6 +386,8 @@ vendor/grammars/matlab.tmbundle: | ||||
| - source.octave | ||||
| vendor/grammars/maven.tmbundle: | ||||
| - text.xml.pom | ||||
| vendor/grammars/mediawiki.tmbundle/: | ||||
| - text.html.mediawiki | ||||
| vendor/grammars/mercury-tmlanguage: | ||||
| - source.mercury | ||||
| vendor/grammars/monkey.tmbundle: | ||||
| @@ -350,14 +414,19 @@ vendor/grammars/ooc.tmbundle: | ||||
| - source.ooc | ||||
| vendor/grammars/opa.tmbundle: | ||||
| - source.opa | ||||
| vendor/grammars/openscad.tmbundle/: | ||||
| - source.scad | ||||
| vendor/grammars/oracle.tmbundle: | ||||
| - source.plsql.oracle | ||||
| vendor/grammars/oz-tmbundle/Syntaxes/Oz.tmLanguage: | ||||
| - source.oz | ||||
| vendor/grammars/pascal.tmbundle: | ||||
| - source.pascal | ||||
| vendor/grammars/perl.tmbundle: | ||||
| vendor/grammars/perl.tmbundle/: | ||||
| - source.perl | ||||
| - source.perl.6 | ||||
| vendor/grammars/php-smarty.tmbundle: | ||||
| - source.smarty | ||||
| - text.html.smarty | ||||
| vendor/grammars/php.tmbundle: | ||||
| - text.html.php | ||||
| vendor/grammars/pike-textmate: | ||||
| @@ -368,8 +437,6 @@ vendor/grammars/powershell: | ||||
| - source.powershell | ||||
| vendor/grammars/processing.tmbundle: | ||||
| - source.processing | ||||
| vendor/grammars/prolog.tmbundle: | ||||
| - source.prolog | ||||
| vendor/grammars/protobuf-tmbundle: | ||||
| - source.protobuf | ||||
| vendor/grammars/puppet-textmate-bundle: | ||||
| @@ -384,20 +451,14 @@ vendor/grammars/restructuredtext.tmbundle: | ||||
| - text.restructuredtext | ||||
| vendor/grammars/ruby-haml.tmbundle: | ||||
| - text.haml | ||||
| vendor/grammars/ruby-on-rails-tmbundle: | ||||
| - source.js.erb.rails | ||||
| - source.ruby.rails | ||||
| - source.ruby.rails.rjs | ||||
| - source.sql.ruby | ||||
| - text.html.erb.rails | ||||
| vendor/grammars/ruby-slim.tmbundle: | ||||
| - text.slim | ||||
| vendor/grammars/ruby.tmbundle: | ||||
| - source.ruby | ||||
| - text.html.erb | ||||
| vendor/grammars/sas.tmbundle: | ||||
| - source.SASLog | ||||
| - source.sas | ||||
| - source.sas_log | ||||
| vendor/grammars/sass-textmate-bundle: | ||||
| - source.sass | ||||
| vendor/grammars/scala.tmbundle: | ||||
| @@ -407,10 +468,14 @@ vendor/grammars/scheme.tmbundle: | ||||
| - source.scheme | ||||
| vendor/grammars/scilab.tmbundle: | ||||
| - source.scilab | ||||
| vendor/grammars/smali-sublime/smali.tmLanguage: | ||||
| - source.smali | ||||
| vendor/grammars/smalltalk-tmbundle: | ||||
| - source.smalltalk | ||||
| vendor/grammars/sql.tmbundle: | ||||
| - source.sql | ||||
| vendor/grammars/st2-zonefile: | ||||
| - text.zone_file | ||||
| vendor/grammars/standard-ml.tmbundle: | ||||
| - source.cm | ||||
| - source.ml | ||||
| @@ -418,10 +483,10 @@ vendor/grammars/sublime-MuPAD: | ||||
| - source.mupad | ||||
| vendor/grammars/sublime-apl/: | ||||
| - source.apl | ||||
| vendor/grammars/sublime-aspectj/: | ||||
| - source.aspectj | ||||
| vendor/grammars/sublime-befunge: | ||||
| - source.befunge | ||||
| vendor/grammars/sublime-better-typescript: | ||||
| - source.ts | ||||
| vendor/grammars/sublime-bsv: | ||||
| - source.bsv | ||||
| vendor/grammars/sublime-cirru: | ||||
| @@ -435,25 +500,47 @@ vendor/grammars/sublime-idris: | ||||
| - source.idris | ||||
| vendor/grammars/sublime-mask: | ||||
| - source.mask | ||||
| vendor/grammars/sublime-netlinx: | ||||
| - source.netlinx | ||||
| - source.netlinx.erb | ||||
| vendor/grammars/sublime-nginx: | ||||
| - source.nginx | ||||
| vendor/grammars/sublime-nix: | ||||
| - source.nix | ||||
| vendor/grammars/sublime-opal/: | ||||
| - source.opal | ||||
| - source.opalsysdefs | ||||
| vendor/grammars/sublime-robot-plugin: | ||||
| - text.robot | ||||
| vendor/grammars/sublime-rust: | ||||
| - source.rust | ||||
| vendor/grammars/sublime-sourcepawn: | ||||
| - source.sp | ||||
| vendor/grammars/sublime-spintools/: | ||||
| - source.regexp.spin | ||||
| - source.spin | ||||
| vendor/grammars/sublime-tea: | ||||
| - source.tea | ||||
| vendor/grammars/sublime-text-ox/: | ||||
| - source.ox | ||||
| vendor/grammars/sublime-text-pig-latin/: | ||||
| - source.pig_latin | ||||
| vendor/grammars/sublime-typescript/: | ||||
| - source.ts | ||||
| - source.tsx | ||||
| vendor/grammars/sublime-varnish: | ||||
| - source.varnish.vcl | ||||
| vendor/grammars/sublime_cobol: | ||||
| - source.acucobol | ||||
| - source.cobol | ||||
| - source.jcl | ||||
| - source.opencobol | ||||
| vendor/grammars/sublime_man_page_support: | ||||
| - source.man | ||||
| - text.groff | ||||
| vendor/grammars/sublimeprolog/: | ||||
| - source.prolog | ||||
| - source.prolog.eclipse | ||||
| vendor/grammars/sublimetext-cuda-cpp: | ||||
| - source.cuda-c++ | ||||
| vendor/grammars/swift.tmbundle: | ||||
| @@ -461,13 +548,6 @@ vendor/grammars/swift.tmbundle: | ||||
| vendor/grammars/tcl.tmbundle: | ||||
| - source.tcl | ||||
| - text.html.tcl | ||||
| vendor/grammars/text.tmbundle: | ||||
| - text.plain | ||||
| vendor/grammars/textile.tmbundle: | ||||
| - text.html.textile | ||||
| vendor/grammars/textmate.tmbundle: | ||||
| - source.regexp.oniguruma | ||||
| - source.tm-properties | ||||
| vendor/grammars/thrift.tmbundle: | ||||
| - source.thrift | ||||
| vendor/grammars/toml.tmbundle: | ||||
| @@ -477,8 +557,12 @@ vendor/grammars/turtle.tmbundle: | ||||
| - source.turtle | ||||
| vendor/grammars/verilog.tmbundle: | ||||
| - source.verilog | ||||
| vendor/grammars/vue-syntax-highlight: | ||||
| - text.html.vue | ||||
| vendor/grammars/x86-assembly-textmate-bundle: | ||||
| - source.asm.x86 | ||||
| vendor/grammars/xc.tmbundle/: | ||||
| - source.xc | ||||
| vendor/grammars/xml.tmbundle: | ||||
| - text.xml | ||||
| - text.xml.xsl | ||||
|   | ||||
| @@ -6,3 +6,15 @@ require 'linguist/repository' | ||||
| require 'linguist/samples' | ||||
| require 'linguist/shebang' | ||||
| require 'linguist/version' | ||||
|  | ||||
| class << Linguist | ||||
|   attr_accessor :instrumenter | ||||
|  | ||||
|   def instrument(*args, &bk) | ||||
|     if instrumenter | ||||
|       instrumenter.instrument(*args, &bk) | ||||
|     else | ||||
|       yield if block_given? | ||||
|     end | ||||
|   end | ||||
| end | ||||
|   | ||||
| @@ -99,7 +99,7 @@ module Linguist | ||||
|       elsif name.nil? | ||||
|         "attachment" | ||||
|       else | ||||
|         "attachment; filename=#{EscapeUtils.escape_url(File.basename(name))}" | ||||
|         "attachment; filename=#{EscapeUtils.escape_url(name)}" | ||||
|       end | ||||
|     end | ||||
|  | ||||
| @@ -233,7 +233,22 @@ module Linguist | ||||
|     # | ||||
|     # Return true or false | ||||
|     def vendored? | ||||
|       name =~ VendoredRegexp ? true : false | ||||
|       path =~ VendoredRegexp ? true : false | ||||
|     end | ||||
|  | ||||
|     documentation_paths = YAML.load_file(File.expand_path("../documentation.yml", __FILE__)) | ||||
|     DocumentationRegexp = Regexp.new(documentation_paths.join('|')) | ||||
|  | ||||
|     # Public: Is the blob in a documentation directory? | ||||
|     # | ||||
|     # Documentation files are ignored by language statistics. | ||||
|     # | ||||
|     # See "documentation.yml" for a list of documentation conventions that match | ||||
|     # this pattern. | ||||
|     # | ||||
|     # Return true or false | ||||
|     def documentation? | ||||
|       path =~ DocumentationRegexp ? true : false | ||||
|     end | ||||
|  | ||||
|     # Public: Get each line of data | ||||
| @@ -301,7 +316,7 @@ module Linguist | ||||
|     # | ||||
|     # Return true or false | ||||
|     def generated? | ||||
|       @_generated ||= Generated.generated?(name, lambda { data }) | ||||
|       @_generated ||= Generated.generated?(path, lambda { data }) | ||||
|     end | ||||
|  | ||||
|     # Public: Detects the Language of the blob. | ||||
| @@ -317,5 +332,15 @@ module Linguist | ||||
|     def tm_scope | ||||
|       language && language.tm_scope | ||||
|     end | ||||
|  | ||||
|     DETECTABLE_TYPES = [:programming, :markup].freeze | ||||
|  | ||||
|     # Internal: Should this blob be included in repository language statistics? | ||||
|     def include_in_language_stats? | ||||
|       !vendored? && | ||||
|       !documentation? && | ||||
|       !generated? && | ||||
|       language && DETECTABLE_TYPES.include?(language.type) | ||||
|     end | ||||
|   end | ||||
| end | ||||
|   | ||||
							
								
								
									
										30
									
								
								lib/linguist/documentation.yml
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										30
									
								
								lib/linguist/documentation.yml
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,30 @@ | ||||
| # Documentation files and directories are excluded from language | ||||
| # statistics. | ||||
| # | ||||
| # Lines in this file are Regexps that are matched against the file | ||||
| # pathname. | ||||
| # | ||||
| # Please add additional test coverage to | ||||
| # `test/test_blob.rb#test_documentation` if you make any changes. | ||||
|  | ||||
| ## Documentation directories ## | ||||
|  | ||||
| - ^docs?/ | ||||
| - (^|/)[Dd]ocumentation/ | ||||
| - (^|/)javadoc/ | ||||
| - ^man/ | ||||
| - ^[Ee]xamples/ | ||||
|  | ||||
| ## Documentation files ## | ||||
|  | ||||
| - (^|/)CHANGE(S|LOG)?(\.|$) | ||||
| - (^|/)CONTRIBUTING(\.|$) | ||||
| - (^|/)COPYING(\.|$) | ||||
| - (^|/)INSTALL(\.|$) | ||||
| - (^|/)LICEN[CS]E(\.|$) | ||||
| - (^|/)[Ll]icen[cs]e(\.|$) | ||||
| - (^|/)README(\.|$) | ||||
| - (^|/)[Rr]eadme(\.|$) | ||||
|  | ||||
| # Samples folders | ||||
| - ^[Ss]amples/ | ||||
| @@ -3,7 +3,7 @@ require 'linguist/blob_helper' | ||||
| module Linguist | ||||
|   # A FileBlob is a wrapper around a File object to make it quack | ||||
|   # like a Grit::Blob. It provides the basic interface: `name`, | ||||
|   # `data`, and `size`. | ||||
|   # `data`, `path` and `size`. | ||||
|   class FileBlob | ||||
|     include BlobHelper | ||||
|  | ||||
| @@ -14,43 +14,50 @@ module Linguist | ||||
|     # | ||||
|     # Returns a FileBlob. | ||||
|     def initialize(path, base_path = nil) | ||||
|       @path = path | ||||
|       @name = base_path ? path.sub("#{base_path}/", '') : path | ||||
|       @fullpath = path | ||||
|       @path = base_path ? path.sub("#{base_path}/", '') : path | ||||
|     end | ||||
|  | ||||
|     # Public: Filename | ||||
|     # | ||||
|     # Examples | ||||
|     # | ||||
|     #   FileBlob.new("/path/to/linguist/lib/linguist.rb").name | ||||
|     #   FileBlob.new("/path/to/linguist/lib/linguist.rb").path | ||||
|     #   # =>  "/path/to/linguist/lib/linguist.rb" | ||||
|     # | ||||
|     #   FileBlob.new("/path/to/linguist/lib/linguist.rb", | ||||
|     #                "/path/to/linguist").name | ||||
|     #                "/path/to/linguist").path | ||||
|     #   # =>  "lib/linguist.rb" | ||||
|     # | ||||
|     # Returns a String | ||||
|     attr_reader :name | ||||
|     attr_reader :path | ||||
|  | ||||
|     # Public: Read file permissions | ||||
|     # | ||||
|     # Returns a String like '100644' | ||||
|     def mode | ||||
|       File.stat(@path).mode.to_s(8) | ||||
|       File.stat(@fullpath).mode.to_s(8) | ||||
|     end | ||||
|  | ||||
|     # Public: File name | ||||
|     # | ||||
|     # Returns a String | ||||
|     def name | ||||
|       File.basename(@fullpath) | ||||
|     end | ||||
|  | ||||
|     # Public: Read file contents. | ||||
|     # | ||||
|     # Returns a String. | ||||
|     def data | ||||
|       File.read(@path) | ||||
|       File.read(@fullpath) | ||||
|     end | ||||
|  | ||||
|     # Public: Get byte size | ||||
|     # | ||||
|     # Returns an Integer. | ||||
|     def size | ||||
|       File.size(@path) | ||||
|       File.size(@fullpath) | ||||
|     end | ||||
|  | ||||
|     # Public: Get file extension. | ||||
| @@ -67,7 +74,7 @@ module Linguist | ||||
|     # | ||||
|     # Returns an Array | ||||
|     def extensions | ||||
|       basename, *segments = File.basename(name).split(".") | ||||
|       basename, *segments = name.downcase.split(".") | ||||
|  | ||||
|       segments.map.with_index do |segment, index| | ||||
|         "." + segments[index..-1].join(".") | ||||
|   | ||||
| @@ -53,18 +53,25 @@ module Linguist | ||||
|     def generated? | ||||
|       xcode_file? || | ||||
|       generated_net_designer_file? || | ||||
|       generated_net_specflow_feature_file? || | ||||
|       composer_lock? || | ||||
|       node_modules? || | ||||
|       godeps? || | ||||
|       generated_by_zephir? || | ||||
|       minified_files? || | ||||
|       source_map? || | ||||
|       compiled_coffeescript? || | ||||
|       generated_parser? || | ||||
|       generated_net_docfile? || | ||||
|       generated_postscript? || | ||||
|       compiled_cython_file? || | ||||
|       generated_go? || | ||||
|       generated_protocol_buffer? || | ||||
|       generated_apache_thrift? || | ||||
|       generated_jni_header? || | ||||
|       vcr_cassette? | ||||
|       vcr_cassette? || | ||||
|       generated_module? || | ||||
|       generated_unity3d_meta? | ||||
|     end | ||||
|  | ||||
|     # Internal: Is the blob an Xcode file? | ||||
| @@ -94,6 +101,20 @@ module Linguist | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     # Internal: Is the blob a generated source map? | ||||
|     # | ||||
|     # Source Maps usually have .css.map or .js.map extensions. In case they | ||||
|     # are not following the name convention, detect them based on the content. | ||||
|     # | ||||
|     # Returns true or false. | ||||
|     def source_map? | ||||
|       return false unless extname.downcase == '.map' | ||||
|  | ||||
|       name =~ /(\.css|\.js)\.map$/i ||                 # Name convention | ||||
|       lines[0] =~ /^{"version":\d+,/ ||                # Revision 2 and later begin with the version number | ||||
|       lines[0] =~ /^\/\*\* Begin line maps\. \*\*\/{/  # Revision 1 begins with a magic comment | ||||
|     end | ||||
|  | ||||
|     # Internal: Is the blob of JS generated by CoffeeScript? | ||||
|     # | ||||
|     # CoffeeScript is meant to output JS that would be difficult to | ||||
| @@ -162,6 +183,17 @@ module Linguist | ||||
|       name.downcase =~ /\.designer\.cs$/ | ||||
|     end | ||||
|  | ||||
|     # Internal: Is this a codegen file for Specflow feature file? | ||||
|     # | ||||
|     # Visual Studio's SpecFlow extension generates *.feature.cs files | ||||
|     # from *.feature files, they are not meant to be consumed by humans. | ||||
|     # Let's hide them. | ||||
|     # | ||||
|     # Returns true or false | ||||
|     def generated_net_specflow_feature_file? | ||||
|       name.downcase =~ /\.feature\.cs$/ | ||||
|     end | ||||
|  | ||||
|     # Internal: Is the blob of JS a parser generated by PEG.js? | ||||
|     # | ||||
|     # PEG.js-generated parsers are not meant to be consumed by humans. | ||||
| @@ -202,17 +234,38 @@ module Linguist | ||||
|         creator.include?("ImageMagick") | ||||
|     end | ||||
|  | ||||
|     def generated_go? | ||||
|       return false unless extname == '.go' | ||||
|       return false unless lines.count > 1 | ||||
|  | ||||
|       return lines[0].include?("Code generated by") | ||||
|     end | ||||
|  | ||||
|     PROTOBUF_EXTENSIONS = ['.py', '.java', '.h', '.cc', '.cpp'] | ||||
|  | ||||
|     # Internal: Is the blob a C++, Java or Python source file generated by the | ||||
|     # Protocol Buffer compiler? | ||||
|     # | ||||
|     # Returns true of false. | ||||
|     def generated_protocol_buffer? | ||||
|       return false unless ['.py', '.java', '.h', '.cc', '.cpp'].include?(extname) | ||||
|       return false unless PROTOBUF_EXTENSIONS.include?(extname) | ||||
|       return false unless lines.count > 1 | ||||
|  | ||||
|       return lines[0].include?("Generated by the protocol buffer compiler.  DO NOT EDIT!") | ||||
|     end | ||||
|  | ||||
|     APACHE_THRIFT_EXTENSIONS = ['.rb', '.py', '.go', '.js', '.m', '.java', '.h', '.cc', '.cpp'] | ||||
|  | ||||
|     # Internal: Is the blob generated by Apache Thrift compiler? | ||||
|     # | ||||
|     # Returns true or false | ||||
|     def generated_apache_thrift? | ||||
|       return false unless APACHE_THRIFT_EXTENSIONS.include?(extname) | ||||
|       return false unless lines.count > 1 | ||||
|  | ||||
|       return lines[0].include?("Autogenerated by Thrift Compiler") || lines[1].include?("Autogenerated by Thrift Compiler") | ||||
|     end | ||||
|  | ||||
|     # Internal: Is the blob a C/C++ header generated by the Java JNI tool javah? | ||||
|     # | ||||
|     # Returns true of false. | ||||
| @@ -262,5 +315,49 @@ module Linguist | ||||
|       # VCR Cassettes have "recorded_with: VCR" in the second last line. | ||||
|       return lines[-2].include?("recorded_with: VCR") | ||||
|     end | ||||
|  | ||||
|     # Internal: Is this a compiled C/C++ file from Cython? | ||||
|     # | ||||
|     # Cython-compiled C/C++ files typically contain: | ||||
|     # /* Generated by Cython x.x.x on ... */ | ||||
|     # on the first line. | ||||
|     # | ||||
|     # Return true or false | ||||
|     def compiled_cython_file? | ||||
|       return false unless ['.c', '.cpp'].include? extname | ||||
|       return false unless lines.count > 1 | ||||
|       return lines[0].include?("Generated by Cython") | ||||
|     end | ||||
|  | ||||
|     # Internal: Is it a KiCAD or GFortran module file? | ||||
|     # | ||||
|     # KiCAD module files contain: | ||||
|     # PCBNEW-LibModule-V1  yyyy-mm-dd h:mm:ss XM | ||||
|     # on the first line. | ||||
|     # | ||||
|     # GFortran module files contain: | ||||
|     # GFORTRAN module version 'x' created from  | ||||
|     # on the first line. | ||||
|     # | ||||
|     # Return true of false | ||||
|     def generated_module? | ||||
|       return false unless extname == '.mod' | ||||
|       return false unless lines.count > 1 | ||||
|       return lines[0].include?("PCBNEW-LibModule-V") ||  | ||||
|               lines[0].include?("GFORTRAN module version '") | ||||
|     end | ||||
|  | ||||
|     # Internal: Is this a metadata file from Unity3D? | ||||
|     # | ||||
|     # Unity3D Meta files start with: | ||||
|     #   fileFormatVersion: X | ||||
|     #   guid: XXXXXXXXXXXXXXX | ||||
|     # | ||||
|     # Return true or false | ||||
|     def generated_unity3d_meta? | ||||
|       return false unless extname == '.meta' | ||||
|       return false unless lines.count > 1 | ||||
|       return lines[0].include?("fileFormatVersion: ") | ||||
|     end | ||||
|   end | ||||
| end | ||||
|   | ||||
| @@ -13,11 +13,14 @@ module Linguist | ||||
|     #   ]) | ||||
|     # | ||||
|     # Returns an Array of languages, or empty if none matched or were inconclusive. | ||||
|     def self.call(blob, languages) | ||||
|     def self.call(blob, candidates) | ||||
|       data = blob.data | ||||
|  | ||||
|       @heuristics.each do |heuristic| | ||||
|         return Array(heuristic.call(data)) if heuristic.matches?(languages) | ||||
|         if heuristic.matches?(blob.name) | ||||
|           languages = Array(heuristic.call(data)) | ||||
|           return languages if languages.any? || languages.all? { |l| candidates.include?(l) } | ||||
|         end | ||||
|       end | ||||
|  | ||||
|       [] # No heuristics matched | ||||
| @@ -30,30 +33,31 @@ module Linguist | ||||
|     # | ||||
|     # Examples | ||||
|     # | ||||
|     #     disambiguate "Perl", "Prolog" do |data| | ||||
|     #     disambiguate ".pm" do |data| | ||||
|     #       if data.include?("use strict") | ||||
|     #         Language["Perl"] | ||||
|     #       elsif data.include?(":-") | ||||
|     #       elsif /^[^#]+:-/.match(data) | ||||
|     #         Language["Prolog"] | ||||
|     #       end | ||||
|     #     end | ||||
|     # | ||||
|     def self.disambiguate(*languages, &heuristic) | ||||
|       @heuristics << new(languages, &heuristic) | ||||
|     def self.disambiguate(*extensions, &heuristic) | ||||
|       @heuristics << new(extensions, &heuristic) | ||||
|     end | ||||
|  | ||||
|     # Internal: Array of defined heuristics | ||||
|     @heuristics = [] | ||||
|  | ||||
|     # Internal | ||||
|     def initialize(languages, &heuristic) | ||||
|       @languages = languages | ||||
|     def initialize(extensions, &heuristic) | ||||
|       @extensions = extensions | ||||
|       @heuristic = heuristic | ||||
|     end | ||||
|  | ||||
|     # Internal: Check if this heuristic matches the candidate languages. | ||||
|     def matches?(candidates) | ||||
|       candidates.any? && candidates.all? { |l| @languages.include?(l.name) } | ||||
|     def matches?(filename) | ||||
|       filename = filename.downcase | ||||
|       @extensions.any? { |ext| filename.end_with?(ext) } | ||||
|     end | ||||
|  | ||||
|     # Internal: Perform the heuristic | ||||
| @@ -62,9 +66,19 @@ module Linguist | ||||
|     end | ||||
|  | ||||
|     # Common heuristics | ||||
|     ObjectiveCRegex = /^[ \t]*@(interface|class|protocol|property|end|synchronised|selector|implementation)\b/ | ||||
|     ObjectiveCRegex = /^\s*(@(interface|class|protocol|property|end|synchronised|selector|implementation)\b|#import\s+.+\.h[">])/ | ||||
|  | ||||
|     disambiguate "BitBake", "BlitzBasic" do |data| | ||||
|     disambiguate ".asc" do |data| | ||||
|       if /^(----[- ]BEGIN|ssh-(rsa|dss)) /.match(data) | ||||
|         Language["Public Key"] | ||||
|       elsif /^[=-]+(\s|\n)|{{[A-Za-z]/.match(data) | ||||
|         Language["AsciiDoc"] | ||||
|       elsif /^(\/\/.+|((import|export)\s+)?(function|int|float|char)\s+((room|repeatedly|on|game)_)?([A-Za-z]+[A-Za-z_0-9]+)\s*[;\(])/.match(data) | ||||
|         Language["AGS Script"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".bb" do |data| | ||||
|       if /^\s*; /.match(data) || data.include?("End Function") | ||||
|         Language["BlitzBasic"] | ||||
|       elsif /^\s*(# |include|require)\b/.match(data) | ||||
| @@ -72,60 +86,14 @@ module Linguist | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "C#", "Smalltalk" do |data| | ||||
|       if /![\w\s]+methodsFor: /.match(data) | ||||
|         Language["Smalltalk"] | ||||
|       elsif /^\s*namespace\s*[\w\.]+\s*{/.match(data) || /^\s*\/\//.match(data) | ||||
|         Language["C#"] | ||||
|     disambiguate ".ch" do |data| | ||||
|       if /^\s*#\s*(if|ifdef|ifndef|define|command|xcommand|translate|xtranslate|include|pragma|undef)\b/i.match(data) | ||||
|         Language["xBase"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "Objective-C", "C++", "C" do |data| | ||||
|       if ObjectiveCRegex.match(data) | ||||
|         Language["Objective-C"] | ||||
|       elsif (/^\s*#\s*include <(cstdint|string|vector|map|list|array|bitset|queue|stack|forward_list|unordered_map|unordered_set|(i|o|io)stream)>/.match(data) || | ||||
|         /^\s*template\s*</.match(data) || /^[ \t]*try/.match(data) || /^[ \t]*catch\s*\(/.match(data) || /^[ \t]*(class|(using[ \t]+)?namespace)\s+\w+/.match(data) || /^[ \t]*(private|public|protected):$/.match(data) || /std::\w+/.match(data)) | ||||
|         Language["C++"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "Perl", "Perl6", "Prolog" do |data| | ||||
|       if data.include?("use v6") | ||||
|         Language["Perl6"] | ||||
|       elsif data.include?("use strict") | ||||
|         Language["Perl"] | ||||
|       elsif data.include?(":-") | ||||
|         Language["Prolog"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "ECL", "Prolog" do |data| | ||||
|       if data.include?(":-") | ||||
|         Language["Prolog"] | ||||
|       elsif data.include?(":=") | ||||
|         Language["ECL"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "IDL", "Prolog" do |data| | ||||
|       if data.include?(":-") | ||||
|         Language["Prolog"] | ||||
|       else | ||||
|         Language["IDL"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "GAP", "Scilab" do |data| | ||||
|       if (data.include?("gap> ")) | ||||
|         Language["GAP"] | ||||
|       # Heads up - we don't usually write heuristics like this (with no regex match) | ||||
|       else | ||||
|         Language["Scilab"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "Common Lisp", "OpenCL", "Cool" do |data| | ||||
|       if data.include?("(defun ") | ||||
|     disambiguate ".cl" do |data| | ||||
|       if /^\s*\((defun|in-package|defpackage) /i.match(data) | ||||
|         Language["Common Lisp"] | ||||
|       elsif /^class/x.match(data) | ||||
|         Language["Cool"] | ||||
| @@ -134,87 +102,41 @@ module Linguist | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "Hack", "PHP" do |data| | ||||
|       if data.include?("<?hh") | ||||
|         Language["Hack"] | ||||
|       elsif /<?[^h]/.match(data) | ||||
|         Language["PHP"] | ||||
|     disambiguate ".cs" do |data| | ||||
|       if /![\w\s]+methodsFor: /.match(data) | ||||
|         Language["Smalltalk"] | ||||
|       elsif /^\s*namespace\s*[\w\.]+\s*{/.match(data) || /^\s*\/\//.match(data) | ||||
|         Language["C#"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "Scala", "SuperCollider" do |data| | ||||
|       if /\^(this|super)\./.match(data) || /^\s*(\+|\*)\s*\w+\s*{/.match(data) || /^\s*~\w+\s*=\./.match(data) | ||||
|         Language["SuperCollider"] | ||||
|       elsif /^\s*import (scala|java)\./.match(data) || /^\s*val\s+\w+\s*=/.match(data) || /^\s*class\b/.match(data) | ||||
|         Language["Scala"] | ||||
|     disambiguate ".d" do |data| | ||||
|       if /^module /.match(data) | ||||
|         Language["D"] | ||||
|       elsif /^((dtrace:::)?BEGIN|provider |#pragma (D (option|attributes)|ident)\s)/.match(data) | ||||
|         Language["DTrace"] | ||||
|       elsif /(\/.*:( .* \\)$| : \\$|^ : |: \\$)/.match(data) | ||||
|         Language["Makefile"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "AsciiDoc", "AGS Script" do |data| | ||||
|       Language["AsciiDoc"] if /^=+(\s|\n)/.match(data) | ||||
|     disambiguate ".ecl" do |data| | ||||
|       if /^[^#]+:-/.match(data) | ||||
|         Language["ECLiPSe"] | ||||
|       elsif data.include?(":=") | ||||
|         Language["ECL"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "FORTRAN", "Forth" do |data| | ||||
|     disambiguate ".for", ".f" do |data| | ||||
|       if /^: /.match(data) | ||||
|         Language["Forth"] | ||||
|       elsif /^([c*][^a-z]|      (subroutine|program)\s|!)/i.match(data) | ||||
|       elsif /^([c*][^a-z]|      (subroutine|program)\s|\s*!)/i.match(data) | ||||
|         Language["FORTRAN"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "F#", "Forth", "GLSL" do |data| | ||||
|       if /^(: |new-device)/.match(data) | ||||
|         Language["Forth"] | ||||
|       elsif /^\s*(#light|import|let|module|namespace|open|type)/.match(data) | ||||
|         Language["F#"] | ||||
|       elsif /^\s*(#include|#pragma|precision|uniform|varying|void)/.match(data) | ||||
|         Language["GLSL"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "M", "Mathematica", "Matlab", "Mercury", "Objective-C" do |data| | ||||
|       if ObjectiveCRegex.match(data) | ||||
|         Language["Objective-C"] | ||||
|       elsif data.include?(":- module") | ||||
|         Language["Mercury"] | ||||
|       elsif /^\s*;/.match(data) | ||||
|         Language["M"] | ||||
|       elsif /^\s*\(\*/.match(data) | ||||
|         Language["Mathematica"] | ||||
|       elsif /^\s*%/.match(data) | ||||
|         Language["Matlab"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "Gosu", "JavaScript" do |data| | ||||
|       Language["Gosu"] if /^uses java\./.match(data) | ||||
|     end | ||||
|  | ||||
|     disambiguate "LoomScript", "LiveScript" do |data| | ||||
|       if /^\s*package\s*[\w\.\/\*\s]*\s*{/.match(data) | ||||
|         Language["LoomScript"] | ||||
|       else | ||||
|         Language["LiveScript"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "Common Lisp", "NewLisp" do |data| | ||||
|       if /^\s*\((defun|in-package|defpackage) /.match(data) | ||||
|         Language["Common Lisp"] | ||||
|       elsif /^\s*\(define /.match(data) | ||||
|         Language["NewLisp"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "TypeScript", "XML" do |data| | ||||
|       if data.include?("<TS ") | ||||
|         Language["XML"] | ||||
|       else | ||||
|         Language["TypeScript"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate "Frege", "Forth", "Text" do |data| | ||||
|     disambiguate ".fr" do |data| | ||||
|       if /^(: |also |new-device|previous )/.match(data) | ||||
|         Language["Forth"] | ||||
|       elsif /^\s*(import|module|package|data|type) /.match(data) | ||||
| @@ -223,5 +145,219 @@ module Linguist | ||||
|         Language["Text"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".fs" do |data| | ||||
|       if /^(: |new-device)/.match(data) | ||||
|         Language["Forth"] | ||||
|       elsif /^\s*(#light|import|let|module|namespace|open|type)/.match(data) | ||||
|         Language["F#"] | ||||
|       elsif /^\s*(#version|precision|uniform|varying|vec[234])/.match(data) | ||||
|         Language["GLSL"] | ||||
|       elsif /#include|#pragma\s+(rs|version)|__attribute__/.match(data) | ||||
|         Language["Filterscript"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".gs" do |data| | ||||
|       Language["Gosu"] if /^uses java\./.match(data) | ||||
|     end | ||||
|  | ||||
|     disambiguate ".h" do |data| | ||||
|       if ObjectiveCRegex.match(data) | ||||
|         Language["Objective-C"] | ||||
|       elsif (/^\s*#\s*include <(cstdint|string|vector|map|list|array|bitset|queue|stack|forward_list|unordered_map|unordered_set|(i|o|io)stream)>/.match(data) || | ||||
|         /^\s*template\s*</.match(data) || /^[ \t]*try/.match(data) || /^[ \t]*catch\s*\(/.match(data) || /^[ \t]*(class|(using[ \t]+)?namespace)\s+\w+/.match(data) || /^[ \t]*(private|public|protected):$/.match(data) || /std::\w+/.match(data)) | ||||
|         Language["C++"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".l" do |data| | ||||
|       if /\(def(un|macro)\s/.match(data) | ||||
|         Language["Common Lisp"] | ||||
|       elsif /^(%[%{}]xs|<.*>)/.match(data) | ||||
|         Language["Lex"] | ||||
|       elsif /^\.[a-z][a-z](\s|$)/i.match(data) | ||||
|         Language["Groff"] | ||||
|       elsif /^\((de|class|rel|code|data|must)\s/.match(data) | ||||
|         Language["PicoLisp"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".ls" do |data| | ||||
|       if /^\s*package\s*[\w\.\/\*\s]*\s*{/.match(data) | ||||
|         Language["LoomScript"] | ||||
|       else | ||||
|         Language["LiveScript"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".lsp", ".lisp" do |data| | ||||
|       if /^\s*\((defun|in-package|defpackage) /i.match(data) | ||||
|         Language["Common Lisp"] | ||||
|       elsif /^\s*\(define /.match(data) | ||||
|         Language["NewLisp"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".m" do |data| | ||||
|       if ObjectiveCRegex.match(data) | ||||
|         Language["Objective-C"] | ||||
|       elsif data.include?(":- module") | ||||
|         Language["Mercury"] | ||||
|       elsif /^: /.match(data) | ||||
|         Language["MUF"] | ||||
|       elsif /^\s*;/.match(data) | ||||
|         Language["M"] | ||||
|       elsif /^\s*\(\*/.match(data) | ||||
|         Language["Mathematica"] | ||||
|       elsif /^\s*%/.match(data) | ||||
|         Language["Matlab"] | ||||
|       elsif /^\w+\s*:\s*module\s*{/.match(data) | ||||
|         Language["Limbo"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".ml" do |data| | ||||
|       if /(^\s*module)|let rec |match\s+(\S+\s)+with/.match(data) | ||||
|         Language["OCaml"] | ||||
|       elsif /=> |case\s+(\S+\s)+of/.match(data) | ||||
|         Language["Standard ML"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".mod" do |data| | ||||
|       if data.include?('<!ENTITY ') | ||||
|         Language["XML"] | ||||
|       elsif /MODULE\s\w+\s*;/i.match(data) || /^\s*END \w+;$/i.match(data) | ||||
|         Language["Modula-2"] | ||||
|       else | ||||
|         [Language["Linux Kernel Module"], Language["AMPL"]] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".ms" do |data| | ||||
|       if /^[.'][a-z][a-z](\s|$)/i.match(data) | ||||
|         Language["Groff"] | ||||
|       elsif /((^|\s)move?[. ])|\.(include|globa?l)\s/.match(data) | ||||
|         Language["GAS"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".n" do |data| | ||||
|       if /^[.']/.match(data) | ||||
|         Language["Groff"] | ||||
|       elsif /^(module|namespace|using)\s/.match(data) | ||||
|         Language["Nemerle"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".ncl" do |data| | ||||
|       if data.include?("THE_TITLE") | ||||
|         Language["Text"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".nl" do |data| | ||||
|       if /^(b|g)[0-9]+ /.match(data) | ||||
|         Language["NL"] | ||||
|       else | ||||
|         Language["NewLisp"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".php" do |data| | ||||
|       if data.include?("<?hh") | ||||
|         Language["Hack"] | ||||
|       elsif /<?[^h]/.match(data) | ||||
|         Language["PHP"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".pl" do |data| | ||||
|       if /^(use v6|(my )?class|module)/.match(data) | ||||
|         Language["Perl6"] | ||||
|       elsif /use strict|use\s+v?5\./.match(data) | ||||
|         Language["Perl"] | ||||
|       elsif /^[^#]+:-/.match(data) | ||||
|         Language["Prolog"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".pm", ".t" do |data| | ||||
|       if /^(use v6|(my )?class|module)/.match(data) | ||||
|         Language["Perl6"] | ||||
|       elsif /use strict|use\s+v?5\./.match(data) | ||||
|         Language["Perl"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".pro" do |data| | ||||
|       if /^[^#]+:-/.match(data) | ||||
|         Language["Prolog"] | ||||
|       elsif data.include?("last_client=") | ||||
|         Language["INI"] | ||||
|       elsif data.include?("HEADERS") && data.include?("SOURCES") | ||||
|         Language["QMake"] | ||||
|       elsif /^\s*function[ \w,]+$/.match(data) | ||||
|         Language["IDL"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".r" do |data| | ||||
|       if /\bRebol\b/i.match(data) | ||||
|         Language["Rebol"] | ||||
|       elsif data.include?("<-") | ||||
|         Language["R"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".rs" do |data| | ||||
|       if /^(use |fn |mod |pub |macro_rules|impl|#!?\[)/.match(data) | ||||
|         Language["Rust"] | ||||
|       elsif /#include|#pragma\s+(rs|version)|__attribute__/.match(data) | ||||
|         Language["RenderScript"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".sc" do |data| | ||||
|       if /\^(this|super)\./.match(data) || /^\s*(\+|\*)\s*\w+\s*{/.match(data) || /^\s*~\w+\s*=\./.match(data) | ||||
|         Language["SuperCollider"] | ||||
|       elsif /^\s*import (scala|java)\./.match(data) || /^\s*val\s+\w+\s*=/.match(data) || /^\s*class\b/.match(data) | ||||
|         Language["Scala"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".sql" do |data| | ||||
|       if /^\\i\b|AS \$\$|LANGUAGE '+plpgsql'+/i.match(data) || /SECURITY (DEFINER|INVOKER)/i.match(data) || /BEGIN( WORK| TRANSACTION)?;/i.match(data) | ||||
|         #Postgres | ||||
|         Language["PLpgSQL"] | ||||
|       elsif /(alter module)|(language sql)|(begin( NOT)+ atomic)/i.match(data)  || /signal SQLSTATE '[0-9]+'/i.match(data) | ||||
|         #IBM db2 | ||||
|         Language["SQLPL"] | ||||
|       elsif /pragma|\$\$PLSQL_|XMLTYPE|sysdate|systimestamp|\.nextval|connect by|AUTHID (DEFINER|CURRENT_USER)/i.match(data) || /constructor\W+function/i.match(data) | ||||
|         #Oracle | ||||
|         Language["PLSQL"] | ||||
|       elsif ! /begin|boolean|package|exception/i.match(data) | ||||
|         #Generic SQL | ||||
|         Language["SQL"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".ts" do |data| | ||||
|       if data.include?("<TS ") | ||||
|         Language["XML"] | ||||
|       else | ||||
|         Language["TypeScript"] | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     disambiguate ".tst" do |data| | ||||
|       if (data.include?("gap> ")) | ||||
|         Language["GAP"] | ||||
|       # Heads up - we don't usually write heuristics like this (with no regex match) | ||||
|       else | ||||
|         Language["Scilab"] | ||||
|       end | ||||
|     end | ||||
|   end | ||||
| end | ||||
|   | ||||
| @@ -32,13 +32,6 @@ module Linguist | ||||
|     # Valid Languages types | ||||
|     TYPES = [:data, :markup, :programming, :prose] | ||||
|  | ||||
|     # Names of non-programming languages that we will still detect | ||||
|     # | ||||
|     # Returns an array | ||||
|     def self.detectable_markup | ||||
|       ["CSS", "Less", "Sass", "SCSS", "Stylus", "TeX"] | ||||
|     end | ||||
|  | ||||
|     # Detect languages by a specific type | ||||
|     # | ||||
|     # type - A symbol that exists within TYPES | ||||
| @@ -80,7 +73,7 @@ module Linguist | ||||
|           raise ArgumentError, "Extension is missing a '.': #{extension.inspect}" | ||||
|         end | ||||
|  | ||||
|         @extension_index[extension] << language | ||||
|         @extension_index[extension.downcase] << language | ||||
|       end | ||||
|  | ||||
|       language.interpreters.each do |interpreter| | ||||
| @@ -96,8 +89,8 @@ module Linguist | ||||
|  | ||||
|     STRATEGIES = [ | ||||
|       Linguist::Strategy::Modeline, | ||||
|       Linguist::Strategy::Filename, | ||||
|       Linguist::Shebang, | ||||
|       Linguist::Strategy::Filename, | ||||
|       Linguist::Heuristics, | ||||
|       Linguist::Classifier | ||||
|     ] | ||||
| @@ -112,19 +105,31 @@ module Linguist | ||||
|       # Bail early if the blob is binary or empty. | ||||
|       return nil if blob.likely_binary? || blob.binary? || blob.empty? | ||||
|  | ||||
|       # Call each strategy until one candidate is returned. | ||||
|       STRATEGIES.reduce([]) do |languages, strategy| | ||||
|         candidates = strategy.call(blob, languages) | ||||
|         if candidates.size == 1 | ||||
|           return candidates.first | ||||
|         elsif candidates.size > 1 | ||||
|           # More than one candidate was found, pass them to the next strategy. | ||||
|           candidates | ||||
|         else | ||||
|           # No candiates were found, pass on languages from the previous strategy. | ||||
|           languages | ||||
|       Linguist.instrument("linguist.detection", :blob => blob) do | ||||
|         # Call each strategy until one candidate is returned. | ||||
|         languages = [] | ||||
|         returning_strategy = nil | ||||
|  | ||||
|         STRATEGIES.each do |strategy| | ||||
|           returning_strategy = strategy | ||||
|           candidates = Linguist.instrument("linguist.strategy", :blob => blob, :strategy => strategy, :candidates => languages) do | ||||
|             strategy.call(blob, languages) | ||||
|           end | ||||
|           if candidates.size == 1 | ||||
|             languages = candidates | ||||
|             break | ||||
|           elsif candidates.size > 1 | ||||
|             # More than one candidate was found, pass them to the next strategy. | ||||
|             languages = candidates | ||||
|           else | ||||
|             # No candidates, try the next strategy | ||||
|           end | ||||
|         end | ||||
|       end.first | ||||
|  | ||||
|         Linguist.instrument("linguist.detected", :blob => blob, :strategy => returning_strategy, :language => languages.first) | ||||
|  | ||||
|         languages.first | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     # Public: Get all Languages | ||||
| @@ -145,7 +150,8 @@ module Linguist | ||||
|     # | ||||
|     # Returns the Language or nil if none was found. | ||||
|     def self.find_by_name(name) | ||||
|       name && @name_index[name.downcase] | ||||
|       return nil if name.to_s.empty? | ||||
|       name && (@name_index[name.downcase] || @name_index[name.split(',').first.downcase]) | ||||
|     end | ||||
|  | ||||
|     # Public: Look up Language by one of its aliases. | ||||
| @@ -159,7 +165,8 @@ module Linguist | ||||
|     # | ||||
|     # Returns the Language or nil if none was found. | ||||
|     def self.find_by_alias(name) | ||||
|       name && @alias_index[name.downcase] | ||||
|       return nil if name.to_s.empty? | ||||
|       name && (@alias_index[name.downcase] || @alias_index[name.split(',').first.downcase]) | ||||
|     end | ||||
|  | ||||
|     # Public: Look up Languages by filename. | ||||
| @@ -198,7 +205,7 @@ module Linguist | ||||
|     # Returns all matching Languages or [] if none were found. | ||||
|     def self.find_by_extension(extname) | ||||
|       extname = ".#{extname}" unless extname.start_with?(".") | ||||
|       @extension_index[extname] | ||||
|       @extension_index[extname.downcase] | ||||
|     end | ||||
|  | ||||
|     # DEPRECATED | ||||
| @@ -235,7 +242,8 @@ module Linguist | ||||
|     # | ||||
|     # Returns the Language or nil if none was found. | ||||
|     def self.[](name) | ||||
|       name && @index[name.downcase] | ||||
|       return nil if name.to_s.empty? | ||||
|       name && (@index[name.downcase] || @index[name.split(',').first.downcase]) | ||||
|     end | ||||
|  | ||||
|     # Public: A List of popular languages | ||||
| @@ -535,8 +543,8 @@ module Linguist | ||||
|  | ||||
|     if extnames = extensions[name] | ||||
|       extnames.each do |extname| | ||||
|         if !options['extensions'].index { |x| x.end_with? extname } | ||||
|           warn "#{name} has a sample with extension (#{extname}) that isn't explicitly defined in languages.yml" unless extname == '.script!' | ||||
|         if !options['extensions'].index { |x| x.downcase.end_with? extname.downcase } | ||||
|           warn "#{name} has a sample with extension (#{extname.downcase}) that isn't explicitly defined in languages.yml" | ||||
|           options['extensions'] << extname | ||||
|         end | ||||
|       end | ||||
|   | ||||
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							| @@ -4,7 +4,11 @@ require 'rugged' | ||||
|  | ||||
| module Linguist | ||||
|   class LazyBlob | ||||
|     GIT_ATTR = ['linguist-language', 'linguist-vendored'] | ||||
|     GIT_ATTR = ['linguist-documentation', | ||||
|                 'linguist-language', | ||||
|                 'linguist-vendored', | ||||
|                 'linguist-generated'] | ||||
|  | ||||
|     GIT_ATTR_OPTS = { :priority => [:index], :skip_system => true } | ||||
|     GIT_ATTR_FLAGS = Rugged::Repository::Attributes.parse_opts(GIT_ATTR_OPTS) | ||||
|  | ||||
| @@ -14,13 +18,15 @@ module Linguist | ||||
|  | ||||
|     attr_reader :repository | ||||
|     attr_reader :oid | ||||
|     attr_reader :name | ||||
|     attr_reader :path | ||||
|     attr_reader :mode | ||||
|  | ||||
|     def initialize(repo, oid, name, mode = nil) | ||||
|     alias :name :path | ||||
|  | ||||
|     def initialize(repo, oid, path, mode = nil) | ||||
|       @repository = repo | ||||
|       @oid = oid | ||||
|       @name = name | ||||
|       @path = path | ||||
|       @mode = mode | ||||
|     end | ||||
|  | ||||
| @@ -29,11 +35,27 @@ module Linguist | ||||
|         name, GIT_ATTR, GIT_ATTR_FLAGS) | ||||
|     end | ||||
|  | ||||
|     def documentation? | ||||
|       if attr = git_attributes['linguist-documentation'] | ||||
|         boolean_attribute(attr) | ||||
|       else | ||||
|         super | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     def generated? | ||||
|       if attr = git_attributes['linguist-generated'] | ||||
|         boolean_attribute(attr) | ||||
|       else | ||||
|         super | ||||
|       end | ||||
|     end | ||||
|  | ||||
|     def vendored? | ||||
|       if attr = git_attributes['linguist-vendored'] | ||||
|         return boolean_attribute(attr) | ||||
|       else | ||||
|         return super | ||||
|         super | ||||
|       end | ||||
|     end | ||||
|  | ||||
| @@ -41,7 +63,7 @@ module Linguist | ||||
|       return @language if defined?(@language) | ||||
|  | ||||
|       @language = if lang = git_attributes['linguist-language'] | ||||
|         Language.find_by_name(lang) | ||||
|         Language.find_by_alias(lang) | ||||
|       else | ||||
|         super | ||||
|       end | ||||
| @@ -57,6 +79,10 @@ module Linguist | ||||
|       @size | ||||
|     end | ||||
|  | ||||
|     def cleanup! | ||||
|       @data.clear if @data | ||||
|     end | ||||
|  | ||||
|     protected | ||||
|  | ||||
|     # Returns true if the attribute is present and not the string "false". | ||||
|   | ||||
| @@ -9,21 +9,21 @@ | ||||
| - CSS | ||||
| - Clojure | ||||
| - CoffeeScript | ||||
| - Common Lisp | ||||
| - Diff | ||||
| - Emacs Lisp | ||||
| - Erlang | ||||
| - Go | ||||
| - HTML | ||||
| - Haskell | ||||
| - Java | ||||
| - JavaScript | ||||
| - Lua | ||||
| - Matlab | ||||
| - Objective-C | ||||
| - PHP | ||||
| - Perl | ||||
| - Python | ||||
| - R | ||||
| - Ruby | ||||
| - SQL | ||||
| - Scala | ||||
| - Scheme | ||||
| - Shell | ||||
| - Swift | ||||
| - TeX | ||||
| - VimL | ||||
|   | ||||
| @@ -150,19 +150,18 @@ module Linguist | ||||
|         next if delta.binary | ||||
|  | ||||
|         if [:added, :modified].include? delta.status | ||||
|           # Skip submodules | ||||
|           # Skip submodules and symlinks | ||||
|           mode = delta.new_file[:mode] | ||||
|           next if (mode & 040000) != 0 | ||||
|           mode_format = (mode & 0170000) | ||||
|           next if mode_format == 0120000 || mode_format == 040000 || mode_format == 0160000 | ||||
|  | ||||
|           blob = Linguist::LazyBlob.new(repository, delta.new_file[:oid], new, mode.to_s(8)) | ||||
|  | ||||
|           # Skip vendored or generated blobs | ||||
|           next if blob.vendored? || blob.generated? || blob.language.nil? | ||||
|  | ||||
|           # Only include programming languages and acceptable markup languages | ||||
|           if blob.language.type == :programming || Language.detectable_markup.include?(blob.language.name) | ||||
|           if blob.include_in_language_stats? | ||||
|             file_map[new] = [blob.language.group.name, blob.size] | ||||
|           end | ||||
|  | ||||
|           blob.cleanup! | ||||
|         end | ||||
|       end | ||||
|  | ||||
|   | ||||
| @@ -50,16 +50,13 @@ module Linguist | ||||
|             end | ||||
|           else | ||||
|             path = File.join(dirname, filename) | ||||
|  | ||||
|             if File.extname(filename) == "" | ||||
|               raise "#{path} is missing an extension, maybe it belongs in filenames/ subdir" | ||||
|             end | ||||
|             extname = File.extname(filename) | ||||
|  | ||||
|             yield({ | ||||
|               :path     => path, | ||||
|               :language => category, | ||||
|               :interpreter => Shebang.interpreter(File.read(path)), | ||||
|               :extname  => File.extname(filename) | ||||
|               :extname  => extname.empty? ? nil : extname | ||||
|             }) | ||||
|           end | ||||
|         end | ||||
|   | ||||
| @@ -23,17 +23,20 @@ module Linguist | ||||
|       # First line must start with #! | ||||
|       return unless shebang && shebang.start_with?("#!") | ||||
|  | ||||
|       # Get the parts of the shebang without the #! | ||||
|       tokens = shebang.sub(/^#!\s*/, '').strip.split(' ') | ||||
|       s = StringScanner.new(shebang) | ||||
|  | ||||
|       # There was nothing after the #! | ||||
|       return if tokens.empty? | ||||
|       return unless path = s.scan(/^#!\s*\S+/) | ||||
|  | ||||
|       # Get the name of the interpreter | ||||
|       script = File.basename(tokens.first) | ||||
|       # Keep going | ||||
|       script = path.split('/').last | ||||
|  | ||||
|       # Get next argument if interpreter was /usr/bin/env | ||||
|       script = tokens[1] if script == 'env' | ||||
|       # if /usr/bin/env type shebang then walk the string | ||||
|       if script == 'env' | ||||
|         s.scan(/\s+/) | ||||
|         s.scan(/.*=[^\s]+\s+/) # skip over variable arguments e.g. foo=bar | ||||
|         script = s.scan(/\S+/) | ||||
|       end | ||||
|  | ||||
|       # Interpreter was /usr/bin/env with no arguments | ||||
|       return unless script | ||||
| @@ -41,6 +44,9 @@ module Linguist | ||||
|       # "python2.6" -> "python2" | ||||
|       script.sub! /(\.\d+)$/, '' | ||||
|  | ||||
|       # #! perl -> perl | ||||
|       script.sub! /^#!\s*/, '' | ||||
|  | ||||
|       # Check for multiline shebang hacks that call `exec` | ||||
|       if script == 'sh' && | ||||
|         data.lines.first(5).any? { |l| l.match(/exec (\w+).+\$0.+\$@/) } | ||||
|   | ||||
| @@ -3,17 +3,7 @@ module Linguist | ||||
|     # Detects language based on filename and/or extension | ||||
|     class Filename | ||||
|       def self.call(blob, _) | ||||
|         name = blob.name.to_s | ||||
|  | ||||
|         # A bit of an elegant hack. If the file is executable but extensionless, | ||||
|         # append a "magic" extension so it can be classified with other | ||||
|         # languages that have shebang scripts. | ||||
|         extensions = FileBlob.new(name).extensions | ||||
|         if extensions.empty? && blob.mode && (blob.mode.to_i(8) & 05) == 05 | ||||
|           name += ".script!" | ||||
|         end | ||||
|  | ||||
|         Language.find_by_filename(name) | ||||
|         Language.find_by_filename(blob.name.to_s) | ||||
|       end | ||||
|     end | ||||
|   end | ||||
|   | ||||
| @@ -1,8 +1,8 @@ | ||||
| module Linguist | ||||
|   module Strategy | ||||
|     class Modeline | ||||
|       EmacsModeline = /-\*-\s*mode:\s*(\w+);?\s*-\*-/ | ||||
|       VimModeline = /\/\*\s*vim:\s*set\s*(?:ft|filetype)=(\w+):\s*\*\// | ||||
|       EmacsModeline = /-\*-\s*(?:(?!mode)[\w-]+\s*:\s*(?:[\w+-]+)\s*;?\s*)*(?:mode\s*:)?\s*([\w+-]+)\s*(?:;\s*(?!mode)[\w-]+\s*:\s*[\w+-]+\s*)*;?\s*-\*-/i | ||||
|       VimModeline = /vim:\s*set.*\s(?:ft|filetype)=(\w+)\s?.*:/i | ||||
|  | ||||
|       # Public: Detects language based on Vim and Emacs modelines | ||||
|       # | ||||
|   | ||||
| @@ -22,8 +22,10 @@ module Linguist | ||||
|     # Start state on token, ignore anything till the next newline | ||||
|     SINGLE_LINE_COMMENTS = [ | ||||
|       '//', # C | ||||
|       '--', # Ada, Haskell, AppleScript | ||||
|       '#',  # Ruby | ||||
|       '%',  # Tex | ||||
|       '"',  # Vim | ||||
|     ] | ||||
|  | ||||
|     # Start state on opening token, ignore anything until the closing | ||||
| @@ -94,7 +96,7 @@ module Linguist | ||||
|           end | ||||
|  | ||||
|         # Skip number literals | ||||
|         elsif s.scan(/(0x)?\d(\d|\.)*/) | ||||
|         elsif s.scan(/(0x\h(\h|\.)*|\d(\d|\.)*)([uU][lL]{0,2}|([eE][-+]\d*)?[fFlL]*)/) | ||||
|  | ||||
|         # SGML style brackets | ||||
|         elsif token = s.scan(/<[^\s<>][^<>]*>/) | ||||
| @@ -130,6 +132,9 @@ module Linguist | ||||
|     #   extract_shebang("#!/usr/bin/env node") | ||||
|     #   # => "node" | ||||
|     # | ||||
|     #   extract_shebang("#!/usr/bin/env A=B foo=bar awk -f") | ||||
|     #   # => "awk" | ||||
|     # | ||||
|     # Returns String token or nil it couldn't be parsed. | ||||
|     def extract_shebang(data) | ||||
|       s = StringScanner.new(data) | ||||
| @@ -138,6 +143,7 @@ module Linguist | ||||
|         script = path.split('/').last | ||||
|         if script == 'env' | ||||
|           s.scan(/\s+/) | ||||
|           s.scan(/.*=[^\s]+\s+/) | ||||
|           script = s.scan(/\S+/) | ||||
|         end | ||||
|         script = script[/[^\d]+/, 0] if script | ||||
|   | ||||
| @@ -24,6 +24,9 @@ | ||||
| - (^|/)config.guess$ | ||||
| - (^|/)config.sub$ | ||||
|  | ||||
| # Linters | ||||
| - cpplint.py | ||||
|  | ||||
| # Node dependencies | ||||
| - node_modules/ | ||||
|  | ||||
| @@ -40,7 +43,7 @@ | ||||
| # Minified JavaScript and CSS | ||||
| - (\.|-)min\.(js|css)$ | ||||
|  | ||||
| #Stylesheets imported from packages | ||||
| # Stylesheets imported from packages | ||||
| - ([^\s]*)import\.(css|less|scss|styl)$ | ||||
|  | ||||
| # Bootstrap css and js | ||||
| @@ -67,6 +70,7 @@ | ||||
| - 3rd[-_]?party/ | ||||
| - vendors?/ | ||||
| - extern(al)?/ | ||||
| - (^|/)[Vv]+endor/ | ||||
|  | ||||
| # Debian packaging | ||||
| - ^debian/ | ||||
| @@ -74,6 +78,9 @@ | ||||
| # Haxelib projects often contain a neko bytecode file named run.n | ||||
| - run.n$ | ||||
|  | ||||
| # Bootstrap Datepicker | ||||
| - bootstrap-datepicker/ | ||||
|  | ||||
| ## Commonly Bundled JavaScript frameworks ## | ||||
|  | ||||
| # jQuery | ||||
| @@ -84,6 +91,34 @@ | ||||
| - (^|/)jquery\-ui(\-\d\.\d+(\.\d+)?)?(\.\w+)?\.(js|css)$ | ||||
| - (^|/)jquery\.(ui|effects)\.([^.]*)\.(js|css)$ | ||||
|  | ||||
| # jQuery Gantt | ||||
| - jquery.fn.gantt.js | ||||
|  | ||||
| # jQuery fancyBox | ||||
| - jquery.fancybox.js | ||||
|  | ||||
| # Fuel UX | ||||
| - fuelux.js | ||||
|  | ||||
| # jQuery File Upload | ||||
| - (^|/)jquery\.fileupload(-\w+)?\.js$ | ||||
|  | ||||
| # Slick | ||||
| - (^|/)slick\.\w+.js$ | ||||
|  | ||||
| # Leaflet plugins | ||||
| - (^|/)Leaflet\.Coordinates-\d+\.\d+\.\d+\.src\.js$ | ||||
| - leaflet.draw-src.js | ||||
| - leaflet.draw.css | ||||
| - Control.FullScreen.css | ||||
| - Control.FullScreen.js | ||||
| - leaflet.spin.js | ||||
| - wicket-leaflet.js | ||||
|  | ||||
| # Sublime Text workspace files | ||||
| - .sublime-project | ||||
| - .sublime-workspace | ||||
|  | ||||
| # Prototype | ||||
| - (^|/)prototype(.*)\.js$ | ||||
| - (^|/)effects\.js$ | ||||
| @@ -118,7 +153,7 @@ | ||||
| - (^|/)Chart\.js$ | ||||
|  | ||||
| # Codemirror | ||||
| - (^|/)[Cc]ode[Mm]irror/(lib|mode|theme|addon|keymap) | ||||
| - (^|/)[Cc]ode[Mm]irror/(\d+\.\d+/)?(lib|mode|theme|addon|keymap|demo) | ||||
|  | ||||
| # SyntaxHighlighter - http://alexgorbatchev.com/ | ||||
| - (^|/)shBrush([^.]*)\.js$ | ||||
| @@ -143,6 +178,9 @@ | ||||
|  | ||||
| ## Python ## | ||||
|  | ||||
| # Sphinx | ||||
| - (^|/)docs?/_?(build|themes?|templates?|static)/ | ||||
|  | ||||
| # django | ||||
| - (^|/)admin_media/ | ||||
|  | ||||
| @@ -157,12 +195,31 @@ | ||||
|  | ||||
| ## Obj-C ## | ||||
|  | ||||
| # Xcode | ||||
|  | ||||
| - \.xctemplate/ | ||||
| - \.imageset/ | ||||
|  | ||||
| # Carthage | ||||
| - ^Carthage/ | ||||
|  | ||||
| # Cocoapods | ||||
| - ^Pods/ | ||||
|  | ||||
| # Sparkle | ||||
| - (^|/)Sparkle/ | ||||
|  | ||||
| # Crashlytics | ||||
| - Crashlytics.framework/ | ||||
|  | ||||
| # Fabric | ||||
| - Fabric.framework/ | ||||
|  | ||||
| # git config files | ||||
| - gitattributes$ | ||||
| - gitignore$ | ||||
| - gitmodules$ | ||||
|  | ||||
| ## Groovy ## | ||||
|  | ||||
| # Gradle | ||||
| @@ -207,21 +264,9 @@ | ||||
| # Html5shiv | ||||
| - (^|/)html5shiv\.js$ | ||||
|  | ||||
| # Samples folders | ||||
| - ^[Ss]amples/ | ||||
|  | ||||
| # LICENSE, README, git config files | ||||
| - ^COPYING$ | ||||
| - LICENSE$ | ||||
| - License$ | ||||
| - gitattributes$ | ||||
| - gitignore$ | ||||
| - gitmodules$ | ||||
| - ^README$ | ||||
| - ^readme$ | ||||
|  | ||||
| # Test fixtures | ||||
| - ^[Tt]est/fixtures/ | ||||
| - ^[Tt]ests?/fixtures/ | ||||
| - ^[Ss]pecs?/fixtures/ | ||||
|  | ||||
| # PhoneGap/Cordova | ||||
| - (^|/)cordova([^.]*)\.js$ | ||||
| @@ -233,7 +278,7 @@ | ||||
| # Vagrant | ||||
| - ^Vagrantfile$ | ||||
|  | ||||
| # .DS_Store's | ||||
| # .DS_Stores | ||||
| - .[Dd][Ss]_[Ss]tore$ | ||||
|  | ||||
| # R packages | ||||
| @@ -251,3 +296,9 @@ | ||||
| # ProGuard | ||||
| - proguard.pro | ||||
| - proguard-rules.pro | ||||
|  | ||||
| # PuPHPet | ||||
| - ^puphpet/ | ||||
|  | ||||
| # Android Google APIs | ||||
| - (^|/)\.google_apis/ | ||||
|   | ||||
| @@ -1,3 +1,3 @@ | ||||
| module Linguist | ||||
|   VERSION = "4.3.1" | ||||
|   VERSION = "4.6.0" | ||||
| end | ||||
|   | ||||
| @@ -1,6 +1,6 @@ | ||||
| { | ||||
|   "repository": "https://github.com/github/linguist", | ||||
|   "dependencies": { | ||||
|     "season": "~>3.0" | ||||
|     "season": "~>5.0" | ||||
|   } | ||||
| } | ||||
|   | ||||
							
								
								
									
										58
									
								
								samples/AMPL/CT2.mod
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										58
									
								
								samples/AMPL/CT2.mod
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,58 @@ | ||||
| param num_beams;                  # number of beams | ||||
|  | ||||
| param num_rows >= 1, integer;     # number of rows | ||||
| param num_cols >= 1, integer;     # number of columns  | ||||
|  | ||||
| set BEAMS   := 1 .. num_beams;    # set of beams | ||||
|  | ||||
| set ROWS    := 1 .. num_rows;	  # set of rows | ||||
| set COLUMNS := 1 .. num_cols;	  # set of columns | ||||
|  | ||||
| # values for entries of each beam | ||||
| param beam_values {BEAMS, ROWS, COLUMNS} >= 0;  | ||||
|  | ||||
| # values of tumor | ||||
| param tumor_values {ROWS, COLUMNS} >= 0;  | ||||
|  | ||||
| # values of critical area | ||||
| param critical_values {ROWS, COLUMNS} >= 0;  | ||||
|  | ||||
| # critical maximum dosage requirement | ||||
| param critical_max; | ||||
|  | ||||
| # tumor minimum dosage requirement | ||||
| param tumor_min; | ||||
|  | ||||
| # dosage scalar of each beam | ||||
| var X {i in BEAMS} >= 0; | ||||
|  | ||||
|  | ||||
| # define the tumor area which includes the locations where tumor exists | ||||
| set tumor_area := {k in ROWS, h in COLUMNS: tumor_values[k,h] > 0}; | ||||
|  | ||||
| # define critical area  | ||||
| set critical_area := {k in ROWS, h in COLUMNS: critical_values[k,h] > 0}; | ||||
|  | ||||
| var S {(k,h) in tumor_area} >= 0; | ||||
| var T {(k,h) in critical_area} >= 0; | ||||
|  | ||||
| # maximize total dosage in tumor area | ||||
| maximize total_tumor_dosage: sum {i in BEAMS} sum {(k,h) in tumor_area} X[i] * beam_values[i,k,h]; | ||||
|  | ||||
| # minimize total dosage in critical area | ||||
| minimize total_critical_dosage: sum {i in BEAMS} sum {(k,h) in critical_area} X[i] * beam_values[i,k,h]; | ||||
|  | ||||
| # minimize total tumor slack | ||||
| minimize total_tumor_slack: sum {(k,h) in tumor_area} S[k,h]; | ||||
|  | ||||
| # minimize total critical area slack | ||||
| minimize total_critical_slack: sum {(k,h) in critical_area} T[k,h]; | ||||
|  | ||||
| # total dosage at each tumor location [k,h] should be >= min tumor dosage with slack variable | ||||
| subject to tumor_limit {(k,h) in tumor_area} : sum {i in BEAMS} X[i] * beam_values[i,k,h] == tumor_min - S[k,h]; | ||||
|  | ||||
| # total dosage at each critical location [k,h] should be = max critical dosage with slack variable | ||||
| subject to critical_limit {(k,h) in critical_area} : sum {i in BEAMS} X[i] * beam_values[i,k,h] == critical_max + T[k,h]; | ||||
|  | ||||
|  | ||||
|  | ||||
							
								
								
									
										25
									
								
								samples/AMPL/toy.ampl
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										25
									
								
								samples/AMPL/toy.ampl
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,25 @@ | ||||
| # A toy knapsack problem from the LocalSolver docs written in AMPL. | ||||
|  | ||||
| set I; | ||||
| param Value{I}; | ||||
| param Weight{I}; | ||||
| param KnapsackBound; | ||||
| var Take{I} binary; | ||||
|  | ||||
| maximize TotalValue: sum{i in I} Take[i] * Value[i]; | ||||
| s.t. WeightLimit: sum{i in I} Take[i] * Weight[i] <= KnapsackBound; | ||||
|  | ||||
| data; | ||||
|  | ||||
| param: | ||||
| I: Weight Value := | ||||
| 0    10     1 | ||||
| 1    60    10 | ||||
| 2    30    15 | ||||
| 3    40    40 | ||||
| 4    30    60 | ||||
| 5    20    90 | ||||
| 6    20   100 | ||||
| 7     2    15; | ||||
|  | ||||
| param KnapsackBound := 102; | ||||
							
								
								
									
										55
									
								
								samples/API Blueprint/actions.apib
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										55
									
								
								samples/API Blueprint/actions.apib
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,55 @@ | ||||
| FORMAT: 1A | ||||
|  | ||||
| # Advanced Action API | ||||
| A resource action is – in fact – a state transition. This API example demonstrates an action - state transition - to another resource. | ||||
|  | ||||
| ## API Blueprint | ||||
| + [Previous: Resource Model](11.%20Resource%20Model.md) | ||||
| + [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/11.%20Advanced%20Action.md) | ||||
|  | ||||
| # Tasks [/tasks/tasks{?status,priority}] | ||||
|  | ||||
| + Parameters | ||||
|     + status (string) | ||||
|     + priority (number) | ||||
|  | ||||
| ## List All Tasks [GET] | ||||
|  | ||||
| + Response 200 (application/json) | ||||
|  | ||||
|         [ | ||||
|             { | ||||
|                 "id": 123, | ||||
|                 "name": "Exercise in gym", | ||||
|                 "done": false, | ||||
|                 "type": "task" | ||||
|             }, | ||||
|             { | ||||
|                 "id": 124, | ||||
|                 "name": "Shop for groceries", | ||||
|                 "done": true, | ||||
|                 "type": "task" | ||||
|             } | ||||
|         ] | ||||
|  | ||||
| ## Retrieve Task [GET /task/{id}] | ||||
| This is a state transition to another resource | ||||
|  | ||||
| + Parameters | ||||
|     + id (string) | ||||
|  | ||||
| + Response 200 (application/json) | ||||
|  | ||||
|         { | ||||
|             "id": 123, | ||||
|             "name": "Go to gym", | ||||
|             "done": false, | ||||
|             "type": "task" | ||||
|         } | ||||
|  | ||||
| ## Delete Task [DELETE /task/{id}] | ||||
|  | ||||
| + Parameters | ||||
|     + id (string) | ||||
|  | ||||
| + Response 204 | ||||
							
								
								
									
										39
									
								
								samples/API Blueprint/attributes.apib
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										39
									
								
								samples/API Blueprint/attributes.apib
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,39 @@ | ||||
| FORMAT: 1A | ||||
|  | ||||
| # Attributes API | ||||
| This API example demonstrates how to describe body attributes of a request or response message. | ||||
|  | ||||
| In this case, the description is complementary (and duplicate!) to the provided JSON example in the body section. The [Advanced Attributes](09.%20Advanced%20Attributes.md) API example will demonstrate how to avoid duplicates and how to reuse attributes descriptions. | ||||
|  | ||||
| ## API Blueprint | ||||
| + [Previous: Parameters](07.%20Parameters.md) | ||||
| + [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/08.%20Attributes.md) | ||||
| + [Next: Advanced Attributes](09.%20Advanced%20Attributes.md) | ||||
|  | ||||
| # Group Coupons | ||||
|  | ||||
| ## Coupon [/coupons/{id}] | ||||
| A coupon contains information about a percent-off or amount-off discount you might want to apply to a customer. | ||||
|  | ||||
| ### Retrieve a Coupon [GET] | ||||
| Retrieves the coupon with the given ID. | ||||
|  | ||||
| + Response 200 (application/json) | ||||
|  | ||||
|     + Attributes (object) | ||||
|         + id: 250FF (string) | ||||
|         + created: 1415203908 (number) - Time stamp | ||||
|         + percent_off: 25 (number) | ||||
|  | ||||
|             A positive integer between 1 and 100 that represents the discount the coupon will apply. | ||||
|  | ||||
|         + redeem_by (number) - Date after which the coupon can no longer be redeemed | ||||
|  | ||||
|     + Body | ||||
|  | ||||
|             { | ||||
|                 "id": "250FF", | ||||
|                 "created": 1415203908, | ||||
|                 "percent_off": 25, | ||||
|                 "redeem_by:" null | ||||
|             } | ||||
							
								
								
									
										18
									
								
								samples/API Blueprint/simple.apib
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										18
									
								
								samples/API Blueprint/simple.apib
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,18 @@ | ||||
| FORMAT: 1A | ||||
|  | ||||
| # The Simplest API | ||||
| This is one of the simplest APIs written in the **API Blueprint**. | ||||
| One plain resource combined with a method and that's it! We will explain what is going on in the next installment - [Resource and Actions](02.%20Resource%20and%20Actions.md). | ||||
|  | ||||
| **Note:** As we progress through the examples, do not also forget to view the [Raw](https://raw.github.com/apiaryio/api-blueprint/master/examples/01.%20Simplest%20API.md) code to see what is really going on in the API Blueprint, as opposed to just seeing the output of the Github Markdown parser. | ||||
|  | ||||
| Also please keep in mind that every single example in this course is a **real API Blueprint** and as such you can **parse** it with the [API Blueprint parser](https://github.com/apiaryio/drafter) or one of its [bindings](https://github.com/apiaryio/drafter#bindings). | ||||
|  | ||||
| ## API Blueprint | ||||
| + [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/01.%20Simplest%20API.md) | ||||
| + [Next: Resource and Actions](02.%20Resource%20and%20Actions.md) | ||||
|  | ||||
| # GET /message | ||||
| + Response 200 (text/plain) | ||||
|  | ||||
|         Hello World! | ||||
							
								
								
									
										17
									
								
								samples/ApacheConf/apache.vhost
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										17
									
								
								samples/ApacheConf/apache.vhost
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,17 @@ | ||||
| ####################### | ||||
| # HOSTNAME | ||||
| ###################### | ||||
|  | ||||
| <VirtualHost 127.0.0.1:PORT> | ||||
|     ServerAdmin patrick@heysparkbox.com | ||||
|     DocumentRoot "/var/www/HOSTNAME" | ||||
|     ServerName HOSTNAME | ||||
|  | ||||
|     <Directory "/var/www/HOSTNAME"> | ||||
|        Options Indexes MultiViews FollowSymLinks | ||||
|        AllowOverride All | ||||
|        Order allow,deny | ||||
|        Allow from all | ||||
|        DirectoryIndex index.php | ||||
|    </Directory> | ||||
| </VirtualHost> | ||||
| @@ -1,6 +1,9 @@ | ||||
| AsciiDoc Home Page | ||||
| ================== | ||||
|  | ||||
| Title | ||||
| ----- | ||||
|  | ||||
| Example Articles | ||||
| ~~~~~~~~~~~~~~~~ | ||||
| - Item 1 | ||||
|   | ||||
							
								
								
									
										2841
									
								
								samples/Assembly/forth.nasm
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										2841
									
								
								samples/Assembly/forth.nasm
									
									
									
									
									
										Normal file
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										245
									
								
								samples/Assembly/fp_sqr32_160_comba.inc
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										245
									
								
								samples/Assembly/fp_sqr32_160_comba.inc
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,245 @@ | ||||
|  | ||||
|     push r2 | ||||
|     dint | ||||
|     nop | ||||
|     bis #MPYDLYWRTEN,&MPY32CTL0 | ||||
|     bic #MPYDLY32,&MPY32CTL0 | ||||
|     mov #SUMEXT,r13 | ||||
|     clr r12 | ||||
|  | ||||
|     mov @r15+,r4 | ||||
|     mov @r15+,r5 | ||||
|  | ||||
|     mov @r15+,r6 | ||||
|     mov @r15+,r7 | ||||
|  | ||||
|     mov @r15+,r8 | ||||
|     mov @r15+,r9 | ||||
|  | ||||
|     mov @r15+,r10 | ||||
|     mov @r15+,r11 | ||||
|  | ||||
|     sub #2*8,r15 | ||||
|  | ||||
|     /* SELF_STEP_FIRST */ | ||||
|     mov r4,&MPY32L | ||||
|     mov r5,&MPY32H | ||||
|     mov r4,&OP2L | ||||
|     mov r5,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*0(r14) | ||||
|     mov &RES1,2*(0+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|  | ||||
|     /* STEP_1 */ | ||||
|     mov r4,&MAC32L | ||||
|     mov r5,&MAC32H | ||||
|     mov r6,&OP2L | ||||
|     mov r7,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r6,&OP2L | ||||
|     mov r7,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*2(r14) | ||||
|     add @r13,r12 | ||||
|     mov &RES1,2*(2+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|     clr r12 | ||||
|  | ||||
|     /* STEP_1 */ | ||||
|     mov r4,&MAC32L | ||||
|     mov r5,&MAC32H | ||||
|     mov r8,&OP2L | ||||
|     mov r9,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r8,&OP2L | ||||
|     mov r9,&OP2H | ||||
|  | ||||
|     /* SELF_STEP */ | ||||
|     mov r6,&MAC32L | ||||
|     mov r7,&MAC32H | ||||
|     add @r13,r12 | ||||
|     mov r6,&OP2L | ||||
|     mov r7,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*4(r14) | ||||
|     add @r13,r12 | ||||
|     mov &RES1,2*(4+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|     clr r12 | ||||
|  | ||||
|     /* STEP_1 */ | ||||
|     mov r4,&MAC32L | ||||
|     mov r5,&MAC32H | ||||
|     mov r10,&OP2L | ||||
|     mov r11,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r10,&OP2L | ||||
|     mov r11,&OP2H | ||||
|  | ||||
|     /* STEP_2MORE */ | ||||
|     mov r6,&MAC32L | ||||
|     mov r7,&MAC32H | ||||
|     add @r13,r12 | ||||
|     mov r8,&OP2L | ||||
|     mov r9,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r8,&OP2L | ||||
|     mov r9,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*6(r14) | ||||
|     add @r13,r12 | ||||
|     mov &RES1,2*(6+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|     clr r12 | ||||
|  | ||||
|     /* STEP_1 */ | ||||
|     mov r4,&MAC32L | ||||
|     mov r5,&MAC32H | ||||
|     mov 2*8(r15),&OP2L | ||||
|     mov 2*9(r15),&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov 2*8(r15),&OP2L | ||||
|     mov 2*9(r15),&OP2H | ||||
|  | ||||
|     /* STEP_2MORE */ | ||||
|     mov r6,&MAC32L | ||||
|     mov r7,&MAC32H | ||||
|     add @r13,r12 | ||||
|     mov r10,&OP2L | ||||
|     mov r11,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r10,&OP2L | ||||
|     mov r11,&OP2H | ||||
|  | ||||
|     /* SELF_STEP */ | ||||
|     mov r8,&MAC32L | ||||
|     mov r9,&MAC32H | ||||
|     add @r13,r12 | ||||
|     mov r8,&OP2L | ||||
|     mov r9,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*8(r14) | ||||
|     add @r13,r12 | ||||
|     mov &RES1,2*(8+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|     clr r12 | ||||
|  | ||||
|     mov 2*8(r15),r4 | ||||
|     mov 2*(8+1)(r15),r5 | ||||
|  | ||||
|     /* STEP_1 */ | ||||
|     mov r6,&MAC32L | ||||
|     mov r7,&MAC32H | ||||
|     mov r4,&OP2L | ||||
|     mov r5,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r4,&OP2L | ||||
|     mov r5,&OP2H | ||||
|  | ||||
|     /* STEP_2MORE */ | ||||
|     mov r8,&MAC32L | ||||
|     mov r9,&MAC32H | ||||
|     add @r13,r12 | ||||
|     mov r10,&OP2L | ||||
|     mov r11,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r10,&OP2L | ||||
|     mov r11,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*10(r14) | ||||
|     add @r13,r12 | ||||
|     mov &RES1,2*(10+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|     clr r12 | ||||
|  | ||||
|     /* STEP_1 */ | ||||
|     mov r8,&MAC32L | ||||
|     mov r9,&MAC32H | ||||
|     mov r4,&OP2L | ||||
|     mov r5,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r4,&OP2L | ||||
|     mov r5,&OP2H | ||||
|  | ||||
|     /* SELF_STEP */ | ||||
|     mov r10,&MAC32L | ||||
|     mov r11,&MAC32H | ||||
|     add @r13,r12 | ||||
|     mov r10,&OP2L | ||||
|     mov r11,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*12(r14) | ||||
|     add @r13,r12 | ||||
|     mov &RES1,2*(12+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|     clr r12 | ||||
|  | ||||
|     /* STEP_1 */ | ||||
|     mov r10,&MAC32L | ||||
|     mov r11,&MAC32H | ||||
|     mov r4,&OP2L | ||||
|     mov r5,&OP2H | ||||
|     add &SUMEXT,r12 | ||||
|     mov r4,&OP2L | ||||
|     mov r5,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*14(r14) | ||||
|     add @r13,r12 | ||||
|     mov &RES1,2*(14+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|     clr r12 | ||||
|  | ||||
|     /* SELF_STEP_1 */ | ||||
|     mov r4,&MAC32L | ||||
|     mov r5,&MAC32H | ||||
|     mov r4,&OP2L | ||||
|     mov r5,&OP2H | ||||
|  | ||||
|     /* COLUMN_END */ | ||||
|     mov &RES0,2*16(r14) | ||||
|     add @r13,r12 | ||||
|     mov &RES1,2*(16+1)(r14) | ||||
|     mov &RES2,&RES0 | ||||
|     mov &RES3,&RES1 | ||||
|     mov r12,&RES2 | ||||
|     clr &RES3 | ||||
|     clr r12 | ||||
|  | ||||
|     /* END */ | ||||
|     mov &RES0,2*18(r14) | ||||
|     mov &RES1,2*(18+1)(r14) | ||||
|     pop r2 | ||||
|     eint | ||||
							
								
								
									
										170
									
								
								samples/Assembly/lib.inc
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										170
									
								
								samples/Assembly/lib.inc
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,170 @@ | ||||
|  | ||||
| ; ------------------------------------------------------------------------ | ||||
| ; 显示 AL 中的数字 | ||||
| ; ------------------------------------------------------------------------ | ||||
| DispAL: | ||||
| 	push	ecx | ||||
| 	push	edx | ||||
| 	push	edi | ||||
|  | ||||
| 	mov	edi, [dwDispPos] | ||||
|  | ||||
| 	mov	ah, 0Fh			; 0000b: 黑底    1111b: 白字 | ||||
| 	mov	dl, al | ||||
| 	shr	al, 4 | ||||
| 	mov	ecx, 2 | ||||
| .begin: | ||||
| 	and	al, 01111b | ||||
| 	cmp	al, 9 | ||||
| 	ja	.1 | ||||
| 	add	al, '0' | ||||
| 	jmp	.2 | ||||
| .1: | ||||
| 	sub	al, 0Ah | ||||
| 	add	al, 'A' | ||||
| .2: | ||||
| 	mov	[gs:edi], ax | ||||
| 	add	edi, 2 | ||||
|  | ||||
| 	mov	al, dl | ||||
| 	loop	.begin | ||||
| 	;add	edi, 2 | ||||
|  | ||||
| 	mov	[dwDispPos], edi | ||||
|  | ||||
| 	pop	edi | ||||
| 	pop	edx | ||||
| 	pop	ecx | ||||
|  | ||||
| 	ret | ||||
| ; DispAL 结束------------------------------------------------------------- | ||||
|  | ||||
|  | ||||
| ; ------------------------------------------------------------------------ | ||||
| ; 显示一个整形数 | ||||
| ; ------------------------------------------------------------------------ | ||||
| DispInt: | ||||
| 	mov	eax, [esp + 4] | ||||
| 	shr	eax, 24 | ||||
| 	call	DispAL | ||||
|  | ||||
| 	mov	eax, [esp + 4] | ||||
| 	shr	eax, 16 | ||||
| 	call	DispAL | ||||
|  | ||||
| 	mov	eax, [esp + 4] | ||||
| 	shr	eax, 8 | ||||
| 	call	DispAL | ||||
|  | ||||
| 	mov	eax, [esp + 4] | ||||
| 	call	DispAL | ||||
|  | ||||
| 	mov	ah, 07h			; 0000b: 黑底    0111b: 灰字 | ||||
| 	mov	al, 'h' | ||||
| 	push	edi | ||||
| 	mov	edi, [dwDispPos] | ||||
| 	mov	[gs:edi], ax | ||||
| 	add	edi, 4 | ||||
| 	mov	[dwDispPos], edi | ||||
| 	pop	edi | ||||
|  | ||||
| 	ret | ||||
| ; DispInt 结束------------------------------------------------------------ | ||||
|  | ||||
| ; ------------------------------------------------------------------------ | ||||
| ; 显示一个字符串 | ||||
| ; ------------------------------------------------------------------------ | ||||
| DispStr: | ||||
| 	push	ebp | ||||
| 	mov	ebp, esp | ||||
| 	push	ebx | ||||
| 	push	esi | ||||
| 	push	edi | ||||
|  | ||||
| 	mov	esi, [ebp + 8]	; pszInfo | ||||
| 	mov	edi, [dwDispPos] | ||||
| 	mov	ah, 0Fh | ||||
| .1: | ||||
| 	lodsb | ||||
| 	test	al, al | ||||
| 	jz	.2 | ||||
| 	cmp	al, 0Ah	; 是回车吗? | ||||
| 	jnz	.3 | ||||
| 	push	eax | ||||
| 	mov	eax, edi | ||||
| 	mov	bl, 160 | ||||
| 	div	bl | ||||
| 	and	eax, 0FFh | ||||
| 	inc	eax | ||||
| 	mov	bl, 160 | ||||
| 	mul	bl | ||||
| 	mov	edi, eax | ||||
| 	pop	eax | ||||
| 	jmp	.1 | ||||
| .3: | ||||
| 	mov	[gs:edi], ax | ||||
| 	add	edi, 2 | ||||
| 	jmp	.1 | ||||
|  | ||||
| .2: | ||||
| 	mov	[dwDispPos], edi | ||||
|  | ||||
| 	pop	edi | ||||
| 	pop	esi | ||||
| 	pop	ebx | ||||
| 	pop	ebp | ||||
| 	ret | ||||
| ; DispStr 结束------------------------------------------------------------ | ||||
|  | ||||
| ; ------------------------------------------------------------------------ | ||||
| ; 换行 | ||||
| ; ------------------------------------------------------------------------ | ||||
| DispReturn: | ||||
| 	push	szReturn | ||||
| 	call	DispStr			;printf("\n"); | ||||
| 	add	esp, 4 | ||||
|  | ||||
| 	ret | ||||
| ; DispReturn 结束--------------------------------------------------------- | ||||
|  | ||||
|  | ||||
| ; ------------------------------------------------------------------------ | ||||
| ; 内存拷贝,仿 memcpy | ||||
| ; ------------------------------------------------------------------------ | ||||
| ; void* MemCpy(void* es:pDest, void* ds:pSrc, int iSize); | ||||
| ; ------------------------------------------------------------------------ | ||||
| MemCpy: | ||||
| 	push	ebp | ||||
| 	mov	ebp, esp | ||||
|  | ||||
| 	push	esi | ||||
| 	push	edi | ||||
| 	push	ecx | ||||
|  | ||||
| 	mov	edi, [ebp + 8]	; Destination | ||||
| 	mov	esi, [ebp + 12]	; Source | ||||
| 	mov	ecx, [ebp + 16]	; Counter | ||||
| .1: | ||||
| 	cmp	ecx, 0		; 判断计数器 | ||||
| 	jz	.2		; 计数器为零时跳出 | ||||
|  | ||||
| 	mov	al, [ds:esi]		; ┓ | ||||
| 	inc	esi			; ┃ | ||||
| 					; ┣ 逐字节移动 | ||||
| 	mov	byte [es:edi], al	; ┃ | ||||
| 	inc	edi			; ┛ | ||||
|  | ||||
| 	dec	ecx		; 计数器减一 | ||||
| 	jmp	.1		; 循环 | ||||
| .2: | ||||
| 	mov	eax, [ebp + 8]	; 返回值 | ||||
|  | ||||
| 	pop	ecx | ||||
| 	pop	edi | ||||
| 	pop	esi | ||||
| 	mov	esp, ebp | ||||
| 	pop	ebp | ||||
|  | ||||
| 	ret			; 函数结束,返回 | ||||
| ; MemCpy 结束------------------------------------------------------------- | ||||
|  | ||||
							
								
								
									
										321
									
								
								samples/Assembly/macros.inc
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										321
									
								
								samples/Assembly/macros.inc
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,321 @@ | ||||
| BLARGG_MACROS_INCLUDED = 1 | ||||
|  | ||||
| ; Allows extra error checking with modified version | ||||
| ; of ca65. Otherwise acts like a constant of 0. | ||||
| ADDR = 0 | ||||
|  | ||||
| ; Switches to Segment and places Line there. | ||||
| ; Line can be an .align directive, .res, .byte, etc. | ||||
| ; Examples: | ||||
| ; seg_data BSS, .align 256 | ||||
| ; seg_data RODATA, {message: .byte "Test",0} | ||||
| .macro seg_data Segment, Line | ||||
| 	.pushseg | ||||
| 	.segment .string(Segment) | ||||
| 		Line | ||||
| 	.popseg | ||||
| .endmacro | ||||
|  | ||||
| ; Reserves Size bytes in Segment for Name. | ||||
| ; If Size is omitted, reserves one byte. | ||||
| .macro seg_res Segment, Name, Size | ||||
| 	.ifblank Size | ||||
| 		seg_data Segment, Name: .res 1 | ||||
| 	.else | ||||
| 		seg_data Segment, Name: .res Size | ||||
| 	.endif | ||||
| .endmacro | ||||
|  | ||||
| ; Shortcuts for zeropage, bss, and stack | ||||
| .define zp_res  seg_res ZEROPAGE, | ||||
| .define nv_res  seg_res NVRAM, | ||||
| .define bss_res seg_res BSS, | ||||
| .define sp_res  seg_res STACK, | ||||
| .define zp_byte zp_res | ||||
|  | ||||
| ; Copies byte from Src to Addr. If Src begins with #, | ||||
| ; it sets Addr to the immediate value. | ||||
| ; Out: A = byte copied | ||||
| ; Preserved: X, Y | ||||
| .macro mov Addr, Src | ||||
| 	lda Src | ||||
| 	sta Addr | ||||
| .endmacro | ||||
|  | ||||
| ; Copies word from Src to Addr. If Src begins with #, | ||||
| ; it sets Addr the immediate value. | ||||
| ; Out: A = high byte of word | ||||
| ; Preserved: X, Y | ||||
| .macro movw Addr, Src | ||||
| 	.if .match( .left( 1, {Src} ), # ) | ||||
| 		lda #<(.right( .tcount( {Src} )-1, {Src} )) | ||||
| 		sta Addr | ||||
| 		lda #>(.right( .tcount( {Src} )-1, {Src} )) | ||||
| 		sta 1+(Addr) | ||||
| 	.else | ||||
| 		lda Src | ||||
| 		sta Addr | ||||
| 		lda 1+(Src) | ||||
| 		sta 1+(Addr) | ||||
| 	.endif | ||||
| .endmacro | ||||
|  | ||||
| ; Increments 16-bit value at Addr. | ||||
| ; Out: EQ/NE based on resulting 16-bit value | ||||
| ; Preserved: A, X, Y | ||||
| .macro incw Addr | ||||
| 	.local @Skip | ||||
| 	inc Addr | ||||
| 	bne @Skip | ||||
| 	inc 1+(Addr) | ||||
| @Skip: | ||||
| .endmacro | ||||
|  | ||||
| ; Adds Src to word at Addr. | ||||
| ; Out: A = high byte of result, carry set appropriately | ||||
| ; Preserved: X, Y | ||||
| .macro addw Addr, Src | ||||
| 	.if .match( .left( 1, {Src} ), # ) | ||||
| 		addw_ Addr,(.right( .tcount( {Src} )-1, {Src} )) | ||||
| 	.else | ||||
| 		lda Addr | ||||
| 		clc | ||||
| 		adc Src | ||||
| 		sta Addr | ||||
| 		 | ||||
| 		lda 1+(Addr) | ||||
| 		adc 1+(Src) | ||||
| 		sta 1+(Addr) | ||||
| 	.endif | ||||
| .endmacro | ||||
| .macro addw_ Addr, Imm | ||||
| 	lda Addr | ||||
| 	clc | ||||
| 	adc #<Imm | ||||
| 	sta Addr | ||||
| 	 | ||||
| 	;.if (Imm >> 8) <> 0 | ||||
| 		lda 1+(Addr) | ||||
| 		adc #>Imm | ||||
| 		sta 1+(Addr) | ||||
| 	;.else | ||||
| 	;   .local @Skip | ||||
| 	;   bcc @Skip | ||||
| 	;   inc 1+(Addr) | ||||
| 	;@Skip: | ||||
| 	;.endif | ||||
| .endmacro | ||||
|  | ||||
| ; Splits list of words into tables of low and high bytes | ||||
| ; Example: split_words foo, {$1234, $5678} | ||||
| ; expands to: | ||||
| ; foo_l: $34, $78 | ||||
| ; foo_h: $12, $56 | ||||
| ; foo_count = 2 | ||||
| .macro split_words Label, Words | ||||
| 	.ident (.concat (.string(Label), "_l")): .lobytes Words | ||||
| 	.ident (.concat (.string(Label), "_h")): .hibytes Words | ||||
| 	.ident (.concat (.string(Label), "_count")) = * - .ident (.concat (.string(Label), "_h")) | ||||
| .endmacro | ||||
|  | ||||
| .macro SELECT Bool, True, False, Extra | ||||
| 	.ifndef Bool | ||||
| 		False Extra | ||||
| 	.elseif Bool <> 0 | ||||
| 		True Extra | ||||
| 	.else | ||||
| 		False Extra | ||||
| 	.endif | ||||
| .endmacro | ||||
|  | ||||
| .macro DEFAULT Name, Value | ||||
| 	.ifndef Name | ||||
| 		Name = Value | ||||
| 	.endif | ||||
| .endmacro | ||||
|  | ||||
| .ifp02 | ||||
| 	; 6502 doesn't define these alternate names | ||||
| 	.define blt bcc | ||||
| 	.define bge bcs | ||||
| .endif | ||||
| .define jlt jcc | ||||
| .define jge jcs | ||||
|  | ||||
| ; Jxx Target = Bxx Target, except it can go farther than | ||||
| ; 128 bytes. Implemented via branch around a JMP. | ||||
|  | ||||
| ; Don't use ca65's longbranch, because they fail for @labels | ||||
| ;.macpack longbranch | ||||
|  | ||||
| .macro jeq Target | ||||
| 	bne *+5 | ||||
| 	jmp Target | ||||
| .endmacro | ||||
|  | ||||
| .macro jne Target | ||||
| 	beq *+5 | ||||
| 	jmp Target | ||||
| .endmacro | ||||
|  | ||||
| .macro jmi Target | ||||
| 	bpl *+5 | ||||
| 	jmp Target | ||||
| .endmacro | ||||
|  | ||||
| .macro jpl Target | ||||
| 	bmi *+5 | ||||
| 	jmp Target | ||||
| .endmacro | ||||
|  | ||||
| .macro jcs Target | ||||
| 	bcc *+5 | ||||
| 	jmp Target | ||||
| .endmacro | ||||
|  | ||||
| .macro jcc Target | ||||
| 	bcs *+5 | ||||
| 	jmp Target | ||||
| .endmacro | ||||
|  | ||||
| .macro jvs Target | ||||
| 	bvc *+5 | ||||
| 	jmp Target | ||||
| .endmacro | ||||
|  | ||||
| .macro jvc Target | ||||
| 	bvs *+5 | ||||
| 	jmp Target | ||||
| .endmacro | ||||
|  | ||||
|  | ||||
| ; Passes constant data to routine in addr | ||||
| ; Preserved: A, X, Y | ||||
| .macro jsr_with_addr routine,data | ||||
| 	.local Addr | ||||
| 	pha | ||||
| 	lda #<Addr | ||||
| 	sta addr | ||||
| 	lda #>Addr | ||||
| 	sta addr+1 | ||||
| 	pla | ||||
| 	jsr routine | ||||
| 	seg_data RODATA,{Addr: data} | ||||
| .endmacro | ||||
|  | ||||
| ; Calls routine multiple times, with A having the | ||||
| ; value 'start' the first time, 'start+step' the | ||||
| ; second time, up to 'end' for the last time. | ||||
| .macro for_loop routine,start,end,step | ||||
| 	.local @for_loop | ||||
| 	lda #start | ||||
| @for_loop: | ||||
| 	pha | ||||
| 	jsr routine | ||||
| 	pla | ||||
| 	clc | ||||
| 	adc #step | ||||
| 	cmp #<((end)+(step)) | ||||
| 	bne @for_loop | ||||
| .endmacro | ||||
|  | ||||
| ; Calls routine n times. The value of A in the routine | ||||
| ; counts from 0 to n-1. | ||||
| .macro loop_n_times routine,n | ||||
| 	for_loop routine,0,n-1,+1 | ||||
| .endmacro | ||||
|  | ||||
| ; Same as for_loop, except uses 16-bit value in YX. | ||||
| ; -256 <= step <= 255 | ||||
| .macro for_loop16 routine,start,end,step | ||||
| .if (step) < -256 || (step) > 255 | ||||
| 	.error "Step must be within -256 to 255" | ||||
| .endif | ||||
| 	.local @for_loop_skip | ||||
| 	.local @for_loop | ||||
| 	ldy #>(start) | ||||
| 	lda #<(start) | ||||
| @for_loop: | ||||
| 	tax | ||||
| 	pha | ||||
| 	tya | ||||
| 	pha | ||||
| 	jsr routine | ||||
| 	pla | ||||
| 	tay | ||||
| 	pla | ||||
| 	clc | ||||
| 	adc #step | ||||
| .if (step) > 0 | ||||
| 	bcc @for_loop_skip | ||||
| 	iny | ||||
| .else | ||||
| 	bcs @for_loop_skip | ||||
| 	dey | ||||
| .endif | ||||
| @for_loop_skip: | ||||
| 	cmp #<((end)+(step)) | ||||
| 	bne @for_loop | ||||
| 	cpy #>((end)+(step)) | ||||
| 	bne @for_loop | ||||
| .endmacro | ||||
|  | ||||
| ; Stores byte at addr | ||||
| ; Preserved: X, Y | ||||
| .macro setb addr, byte | ||||
| 	lda #byte | ||||
| 	sta addr | ||||
| .endmacro | ||||
|  | ||||
| ; Stores word at addr | ||||
| ; Preserved: X, Y | ||||
| .macro setw addr, word | ||||
| 	lda #<(word) | ||||
| 	sta addr | ||||
| 	lda #>(word) | ||||
| 	sta addr+1 | ||||
| .endmacro | ||||
|  | ||||
| ; Loads XY with 16-bit immediate or value at address | ||||
| .macro ldxy Arg | ||||
| 	.if .match( .left( 1, {Arg} ), # ) | ||||
| 		ldy #<(.right( .tcount( {Arg} )-1, {Arg} )) | ||||
| 		ldx #>(.right( .tcount( {Arg} )-1, {Arg} )) | ||||
| 	.else | ||||
| 		ldy (Arg) | ||||
| 		ldx (Arg)+1 | ||||
| 	.endif | ||||
| .endmacro | ||||
|  | ||||
| ; Increments XY as 16-bit register, in CONSTANT time. | ||||
| ; Z flag set based on entire result. | ||||
| ; Preserved: A | ||||
| ; Time: 7 clocks | ||||
| .macro inxy | ||||
| 	iny ; 2 | ||||
| 	beq *+4 ; 3 | ||||
| 		; -1 | ||||
| 	bne *+3 ; 3 | ||||
| 		; -1 | ||||
| 	inx ; 2 | ||||
| .endmacro | ||||
|  | ||||
| ; Negates A and adds it to operand | ||||
| .macro subaf Operand | ||||
| 	eor #$FF | ||||
| 	sec | ||||
| 	adc Operand | ||||
| .endmacro | ||||
|  | ||||
| ; Initializes CPU registers to reasonable values | ||||
| ; Preserved: A, Y | ||||
| .macro init_cpu_regs | ||||
| 	sei | ||||
| 	cld     ; unnecessary on NES, but might help on clone | ||||
| 	ldx #$FF | ||||
| 	txs | ||||
| 	.ifndef BUILD_NSF | ||||
| 		inx | ||||
| 		stx PPUCTRL | ||||
| 	.endif | ||||
| .endmacro | ||||
							
								
								
									
										195
									
								
								samples/Brainfuck/factor.b
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										195
									
								
								samples/Brainfuck/factor.b
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,195 @@ | ||||
| * factor an arbitrarily large positive integer | ||||
| * | ||||
| * Copyright (C) 1999 by Brian Raiter | ||||
| * under the GNU General Public License | ||||
|  | ||||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>- | ||||
|  | ||||
| * | ||||
| * read in the number | ||||
| * | ||||
|  | ||||
| <<<<<<<<<+ | ||||
| [-[>>>>>>>>>>][-]<<<<<<<<<<[[->>>>>>>>>>+<<<<<<<<<<]<<<<<<<<<<] | ||||
|   >>>>>>>>>>,----------] | ||||
| >>>>>>>>>>[------------------------------------->>>>>>>>>->] | ||||
| <[+>[>>>>>>>>>+>]<-<<<<<<<<<<]- | ||||
|  | ||||
| * | ||||
| * display the number and initialize the loop variable to two | ||||
| * | ||||
|  | ||||
| [>++++++++++++++++++++++++++++++++++++++++++++++++. | ||||
|   ------------------------------------------------<<<<<<<<<<<] | ||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++. | ||||
| --------------------------.[-] | ||||
| >>>>>>>>>>>>++<<<<+ | ||||
|  | ||||
| * | ||||
| * the main loop | ||||
| * | ||||
|  | ||||
| [ [-]>> | ||||
|  | ||||
|   * | ||||
|   * make copies of the number and the loop variable | ||||
|   * | ||||
|  | ||||
|   [>>>>[-]>[-]>[-]>[-] | ||||
|     >[-]>[-] | ||||
|     <<<<<<<[->>>+>+<<<<]>>>>>>>>] | ||||
|   <<<<<<<<<<[>>>>>>[-<<<<+>>>>]<<<<<<<<<<<<<<<<]>>>>>>>>>> | ||||
|   [>[->>>+>>+<<<<<]>>>>>>>>>] | ||||
|   <<<<<<<<<<[>>>>>>[-<<<<<+>>>>>]<<<<<<<<<<<<<<<<]>>>>>>>>>> | ||||
|  | ||||
|   * | ||||
|   * divide the number by the loop variable | ||||
|   * | ||||
|  | ||||
|   [>>>[-]>>>[-]>[-]>>>]                                  initialize | ||||
|   <<<<<<<<<<[<<<<<<<<<<] | ||||
|   >>>>>>>>>[-]>>>>>>>+<<<<<<<<[+]+ | ||||
|   [ ->>                               double divisor until above dividend | ||||
|     [>>>>>>[->++<]>>>>]<<<<<<<<<< | ||||
|     [>>>>>>>>[-]>[-] | ||||
|        <<<<[->>>++<<<]<<<<<<<<<<<<<<<]>>>>>>>>>> | ||||
|     [>>>>>>>>[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+< | ||||
|             [->--------->>>>>>>>>+<<<<<<<<<<[->+<]]]]]]]]]]]>>] | ||||
|     <<<<<<<<<<[>>>>>>>>>[-<+<<<+>>>>]<<<<<<<<<<<<<<<<<<<]>>>>>>>>>> | ||||
|     [>>>>>>>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+> | ||||
|             [-<--------->>>>>>>>>>>+<<<<<<<<<<[-<+>]]]]]]]]]]]>>>] | ||||
|     <<<<<<<<<< | ||||
|     [>>>>[->>>+>>+<<<<<]<<<<<<<<<<<<<<] | ||||
|     >>>>>>>>>>[>>>>>>>[-<<<+>>>]>>>]<<<<<<<<<< | ||||
|     [>>>>>>>>[->-<]> | ||||
|       [<<<<<<<<<[<[-]>>>>>>>>>>[-<<<<<<<<<<+>>>>>>>>>>]<<<<<<<<<<<<<<<<<<<] | ||||
|         >>>>>>>>>>>>>>>>>>>] | ||||
|       <<<<<<<<<<<<<<<<<<<] | ||||
|     >>>>>>>>>[+[+[+[+[+[+[+[+[+[+[[-]<+>]]]]]]]]]]]< | ||||
|   ] | ||||
|   >>>>>>>> | ||||
|   [                                   subtract divisor from dividend | ||||
|     <<<<<< | ||||
|     [>>>>>>>>[-]>[-]<<<<<[->>>+>+<<<<]>>>>>>]<<<<<<<<<< | ||||
|     [>>>>>>>>[-<<<<+>>>>]<<<[->>>+>+<<<<]<<<<<<<<<<<<<<<]>>>>>>>>>> | ||||
|     [>>>>>>>>>[-<<<<+>>>>]>]<<<<<<<<<< | ||||
|     [>>>>>>>>[-<->]<<<<<<<<<<<<<<<<<<]>>>>>>>>>> | ||||
|     [>>>>>>>[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+< | ||||
|             [++++++++++[+>-<]>>>>>>>>>>-<<<<<<<<<<]]]]]]]]]]]>>>] | ||||
|     >>>>>>>+ | ||||
|     [                                 if difference is nonnegative then | ||||
|       [-]<<<<<<<<<<<<<<<<<            replace dividend and increment quotient | ||||
|       [>>>>[-]>>>>[-<<<<+>>>>]<<[->>+<<]<<<<<<<<<<<<<<<<]>>>>>>>>>> | ||||
|       [>>>>>>>>[->+<<<+>>]>>]<<<<<<<<<< | ||||
|       [>>>[->>>>>>+<<<<<<]<<<<<<<<<<<<<]>>>>>>>>>> | ||||
|       [>>>>>>>>>[-<<<<<<+>>>>>>[-<<<<<<+>>>>>> | ||||
|                 [-<<<<<<+>>>>>>[-<<<<<<+>>>>>> | ||||
|                 [-<<<<<<+>>>>>>[-<<<<<<+>>>>>> | ||||
|                 [-<<<<<<+>>>>>>[-<<<<<<+>>>>>> | ||||
|                 [-<<<<<<+>>>>>>[-<<<<<<--------->>>>>>>>>>>>>>>>+<<<<<<<<<< | ||||
|                 [-<<<<<<+>>>>>>]]]]]]]]]]]>] | ||||
|       >>>>>>> | ||||
|     ]                                 halve divisor and loop until zero | ||||
|     <<<<<<<<<<<<<<<<<[<<<<<<<<<<]>>>>>>>>>> | ||||
|     [>>>>>>>>[-]<<[->+<]<[->>>+<<<]>>>>>]<<<<<<<<<< | ||||
|     [+>>>>>>>[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+> | ||||
|              [-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+> | ||||
|              [-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+> | ||||
|              [-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+> | ||||
|              [-<<<<<<<+>>>>>>>]]]]]]]]]<<<<<<< | ||||
|              [->>>>>>>+<<<<<<<]-<<<<<<<<<<] | ||||
|     >>>>>>> | ||||
|     [-<<<<<<<<<<<+>>>>>>>>>>>] | ||||
|       >>>[>>>>>>>[-<<<<<<<<<<<+++++>>>>>>>>>>>]>>>]<<<<<<<<<< | ||||
|     [+>>>>>>>>[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>> | ||||
|               [-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>> | ||||
|               [-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>> | ||||
|               [-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>> | ||||
|               [-<<<<<<<<+>>>>>>>>]]]]]]]]]<<<<<<<< | ||||
|               [->>>>>>>>+<<<<<<<<]-<<<<<<<<<<] | ||||
|     >>>>>>>>[-<<<<<<<<<<<<<+>>>>>>>>>>>>>]>> | ||||
|     [>>>>>>>>[-<<<<<<<<<<<<<+++++>>>>>>>>>>>>>]>>]<<<<<<<<<< | ||||
|     [<<<<<<<<<<]>>>>>>>>>> | ||||
|     >>>>>> | ||||
|   ] | ||||
|   <<<<<< | ||||
|  | ||||
|   * | ||||
|   * make copies of the loop variable and the quotient | ||||
|   * | ||||
|  | ||||
|   [>>>[->>>>+>+<<<<<]>>>>>>>] | ||||
|   <<<<<<<<<< | ||||
|   [>>>>>>>[-<<<<+>>>>]<<<<<[->>>>>+>>+<<<<<<<]<<<<<<<<<<<<] | ||||
|   >>>>>>>>>>[>>>>>>>[-<<<<<+>>>>>]>>>]<<<<<<<<<< | ||||
|  | ||||
|   * | ||||
|   * break out of the loop if the quotient is larger than the loop variable | ||||
|   * | ||||
|  | ||||
|   [>>>>>>>>>[-<->]< | ||||
|     [<<<<<<<< | ||||
|       [<<[-]>>>>>>>>>>[-<<<<<<<<<<+>>>>>>>>>>]<<<<<<<<<<<<<<<<<<] | ||||
|     >>>>>>>>>>>>>>>>>>]<<<<<<<<<<<<<<<<<<] | ||||
|   >>>>>>>>[>-<[+[+[+[+[+[+[+[+[+[[-]>+<]]]]]]]]]]]>+ | ||||
|  | ||||
|   [ [-] | ||||
|  | ||||
|     * | ||||
|     * partially increment the loop variable | ||||
|     * | ||||
|  | ||||
|     <[-]+>>>>+>>>>>>>>[>>>>>>>>>>]<<<<<<<<<< | ||||
|  | ||||
|     * | ||||
|     * examine the remainder for nonzero digits | ||||
|     * | ||||
|  | ||||
|     [<<<<<<[<<<<[<<<<<<<<<<]>>>>+<<<<<<<<<<]<<<<] | ||||
|     >>>>>>>>>>>>>>>>>>>>[>>>>>>>>>>]<<<<<<<<<<[<<<<<<<<<<] | ||||
|     >>>>- | ||||
|  | ||||
|     [ [+] | ||||
|  | ||||
|       * | ||||
|       * decrement the loop variable and replace the number with the quotient | ||||
|       * | ||||
|  | ||||
|       >>>>>>>>-<<[>[-]>>[-<<+>>]>>>>>>>]<<<<<<<<<< | ||||
|  | ||||
|       * | ||||
|       * display the loop variable | ||||
|       * | ||||
|  | ||||
|       [+>>[>>>>>>>>+>>]<<-<<<<<<<<<<]- | ||||
|       [>>++++++++++++++++++++++++++++++++++++++++++++++++. | ||||
|          ------------------------------------------------<<<<<<<<<<<<] | ||||
|       ++++++++++++++++++++++++++++++++.[-]>>>> | ||||
|  | ||||
|     ] | ||||
|  | ||||
|     * | ||||
|     * normalize the loop variable | ||||
|     * | ||||
|  | ||||
|     >>>>>> | ||||
|     [>>[->>>>>+<<<<<[->>>>>+<<<<< | ||||
|        [->>>>>+<<<<<[->>>>>+<<<<< | ||||
|        [->>>>>+<<<<<[->>>>>+<<<<< | ||||
|        [->>>>>+<<<<<[->>>>>+<<<<< | ||||
|        [->>>>>+<<<<<[->>>>>--------->>>>>+<<<<<<<<<< | ||||
|        [->>>>>+<<<<<]]]]]]]]]]]>>>>>>>>] | ||||
|     <<<<<<<<<<[>>>>>>>[-<<<<<+>>>>>]<<<<<<<<<<<<<<<<<] | ||||
|     >>>>>>>>> | ||||
|  | ||||
|   ]< | ||||
|  | ||||
| ]>> | ||||
|  | ||||
| * | ||||
| * display the number and end | ||||
| * | ||||
|  | ||||
| [>>>>>>>>>>]<<<<<<<<<<[+>[>>>>>>>>>+>]<-<<<<<<<<<<]- | ||||
| [>++++++++++++++++++++++++++++++++++++++++++++++++.<<<<<<<<<<<] | ||||
| ++++++++++. | ||||
							
								
								
									
										13
									
								
								samples/Brainfuck/fib100.bf
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										13
									
								
								samples/Brainfuck/fib100.bf
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,13 @@ | ||||
| # Calculate and output all fibonacci numbers under 100 | ||||
|  | ||||
| +++++++++++ | ||||
| >+>>>>++++++++++++++++++++++++++++++++++++++++++++ | ||||
| >++++++++++++++++++++++++++++++++<<<<<<[>[>>>>>>+> | ||||
| +<<<<<<<-]>>>>>>>[<<<<<<<+>>>>>>>-]<[>++++++++++[- | ||||
| <-[>>+>+<<<-]>>>[<<<+>>>-]+<[>[-]<[-]]>[<<[>>>+<<< | ||||
| -]>>[-]]<<]>>>[>>+>+<<<-]>>>[<<<+>>>-]+<[>[-]<[-]] | ||||
| >[<<+>>[-]]<<<<<<<]>>>>>[+++++++++++++++++++++++++ | ||||
| +++++++++++++++++++++++.[-]]++++++++++<[->-<]>++++ | ||||
| ++++++++++++++++++++++++++++++++++++++++++++.[-]<< | ||||
| <<<<<<<<<<[>>>+>+<<<<-]>>>>[<<<<+>>>>-]<-[>>.>.<<< | ||||
| [-]]<<[>>+>+<<<-]>>>[<<<+>>>-]<<[<+>-]>[<+>-]<<<-] | ||||
							
								
								
									
										4
									
								
								samples/Brainfuck/hello.bf
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										4
									
								
								samples/Brainfuck/hello.bf
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,4 @@ | ||||
| // More complex version of hello world | ||||
|  | ||||
| >++++++++[<+++++++++>-]<.>>+>+>++>[-]+<[>[->+<<++++>]<<]>.+++++++..+++.> | ||||
| >+++++++.<<<[[-]<[-]>]<+++++++++++++++.>>.+++.------.--------.>>+.>++++. | ||||
							
								
								
									
										3
									
								
								samples/Brainfuck/helloworld.bf
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										3
									
								
								samples/Brainfuck/helloworld.bf
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,3 @@ | ||||
| // Hello World | ||||
|  | ||||
| ++++++++[>++++[>++>+++>+++>+<<<<-]>+>+>->>+[<]<-]>>.>---.+++++++..+++.>>.<-.<.+++.------.--------.>>+.>++. | ||||
							
								
								
									
										30
									
								
								samples/Brainfuck/rot13.bf
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										30
									
								
								samples/Brainfuck/rot13.bf
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,30 @@ | ||||
| # ROT13 cipher | ||||
|  | ||||
| -,+[                         Read first character and start outer character reading loop | ||||
|     -[                       Skip forward if character is 0 | ||||
|         >>++++[>++++++++<-]  Set up divisor (32) for division loop | ||||
|                                (MEMORY LAYOUT: dividend copy remainder divisor quotient zero zero) | ||||
|         <+<-[                Set up dividend (x minus 1) and enter division loop | ||||
|             >+>+>-[>>>]      Increase copy and remainder / reduce divisor / Normal case: skip forward | ||||
|             <[[>+<-]>>+>]    Special case: move remainder back to divisor and increase quotient | ||||
|             <<<<<-           Decrement dividend | ||||
|         ]                    End division loop | ||||
|     ]>>>[-]+                 End skip loop; zero former divisor and reuse space for a flag | ||||
|     >--[-[<->+++[-]]]<[         Zero that flag unless quotient was 2 or 3; zero quotient; check flag | ||||
|         ++++++++++++<[       If flag then set up divisor (13) for second division loop | ||||
|                                (MEMORY LAYOUT: zero copy dividend divisor remainder quotient zero zero) | ||||
|             >-[>+>>]         Reduce divisor; Normal case: increase remainder | ||||
|             >[+[<+>-]>+>>]   Special case: increase remainder / move it back to divisor / increase quotient | ||||
|             <<<<<-           Decrease dividend | ||||
|         ]                    End division loop | ||||
|         >>[<+>-]             Add remainder back to divisor to get a useful 13 | ||||
|         >[                   Skip forward if quotient was 0 | ||||
|             -[               Decrement quotient and skip forward if quotient was 1 | ||||
|                 -<<[-]>>     Zero quotient and divisor if quotient was 2 | ||||
|             ]<<[<<->>-]>>    Zero divisor and subtract 13 from copy if quotient was 1 | ||||
|         ]<<[<<+>>-]          Zero divisor and add 13 to copy if quotient was 0 | ||||
|     ]                        End outer skip loop (jump to here if ((character minus 1)/32) was not 2 or 3) | ||||
|     <[-]                     Clear remainder from first division if second division was skipped | ||||
|     <.[-]                    Output ROT13ed character from copy and clear it | ||||
|     <-,+                     Read next character | ||||
| ]                            End character reading loop | ||||
							
								
								
									
										57
									
								
								samples/C++/ClasspathVMSystemProperties.inc
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										57
									
								
								samples/C++/ClasspathVMSystemProperties.inc
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,57 @@ | ||||
| //===- ClasspathVMSystem/Properties.cpp -----------------------------------===// | ||||
| //===--------------------- GNU classpath gnu/classpath/VMSystemProperties -===// | ||||
| // | ||||
| //                            The VMKit project | ||||
| // | ||||
| // This file is distributed under the University of Illinois Open Source | ||||
| // License. See LICENSE.TXT for details. | ||||
| // | ||||
| //===----------------------------------------------------------------------===// | ||||
|  | ||||
| #include <sys/utsname.h> | ||||
|  | ||||
| #include "types.h" | ||||
|  | ||||
| #include "Classpath.h" | ||||
| #include "JavaArray.h" | ||||
| #include "JavaClass.h" | ||||
| #include "JavaObject.h" | ||||
| #include "JavaThread.h" | ||||
| #include "JavaUpcalls.h" | ||||
| #include "Jnjvm.h" | ||||
|  | ||||
| #include "SetProperties.inc" | ||||
|  | ||||
| using namespace j3; | ||||
|  | ||||
| extern "C" { | ||||
|  | ||||
|  | ||||
| JNIEXPORT void JNICALL Java_gnu_classpath_VMSystemProperties_preInit( | ||||
| #ifdef NATIVE_JNI | ||||
| JNIEnv *env, | ||||
| jclass clazz, | ||||
| #endif | ||||
| JavaObject* prop) { | ||||
|    | ||||
|   llvm_gcroot(prop, 0); | ||||
|  | ||||
|   BEGIN_NATIVE_EXCEPTION(0) | ||||
|  | ||||
|   setProperties(prop); | ||||
|  | ||||
|   END_NATIVE_EXCEPTION | ||||
| } | ||||
|  | ||||
| extern "C" void Java_gnu_classpath_VMSystemProperties_postInit__Ljava_util_Properties_2(JavaObject* prop) { | ||||
|  | ||||
|   llvm_gcroot(prop, 0); | ||||
|  | ||||
|   BEGIN_NATIVE_EXCEPTION(0) | ||||
|  | ||||
|   setCommandLineProperties(prop); | ||||
|  | ||||
|   END_NATIVE_EXCEPTION | ||||
| } | ||||
|  | ||||
| } | ||||
							
								
								
									
										2764
									
								
								samples/C++/initClasses.inc
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										2764
									
								
								samples/C++/initClasses.inc
									
									
									
									
									
										Normal file
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										34
									
								
								samples/C++/instances.inc
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										34
									
								
								samples/C++/instances.inc
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,34 @@ | ||||
| #include "QPBO.h" | ||||
|  | ||||
| #ifdef _MSC_VER | ||||
| #pragma warning(disable: 4661) | ||||
| #endif | ||||
|  | ||||
| // Instantiations | ||||
|  | ||||
| template class QPBO<int>; | ||||
| template class QPBO<float>; | ||||
| template class QPBO<double>; | ||||
|  | ||||
| template <>  | ||||
| 	inline void QPBO<int>::get_type_information(char*& type_name, char*& type_format) | ||||
| { | ||||
| 	type_name = "int"; | ||||
| 	type_format = "d"; | ||||
| } | ||||
|  | ||||
| template <>  | ||||
| 	inline void QPBO<float>::get_type_information(char*& type_name, char*& type_format) | ||||
| { | ||||
| 	type_name = "float"; | ||||
| 	type_format = "f"; | ||||
| } | ||||
|  | ||||
| template <>  | ||||
| 	inline void QPBO<double>::get_type_information(char*& type_name, char*& type_format) | ||||
| { | ||||
| 	type_name = "double"; | ||||
| 	type_format = "Lf"; | ||||
| } | ||||
|  | ||||
|  | ||||
							
								
								
									
										2310
									
								
								samples/C/filenames/script
									
									
									
									
									
										Executable file
									
								
							
							
						
						
									
										2310
									
								
								samples/C/filenames/script
									
									
									
									
									
										Executable file
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										166
									
								
								samples/C/pqiv.h
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										166
									
								
								samples/C/pqiv.h
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,166 @@ | ||||
| /** | ||||
|  * pqiv | ||||
|  * | ||||
|  * Copyright (c) 2013-2014, Phillip Berndt | ||||
|  * | ||||
|  * This program is free software: you can redistribute it and/or modify | ||||
|  * it under the terms of the GNU General Public License as published by | ||||
|  * the Free Software Foundation, either version 3 of the License, or | ||||
|  * (at your option) any later version. | ||||
|  * This program is distributed in the hope that it will be useful, | ||||
|  * but WITHOUT ANY WARRANTY; without even the implied warranty of | ||||
|  * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the | ||||
|  * GNU General Public License for more details. | ||||
|  * You should have received a copy of the GNU General Public License | ||||
|  * along with this program.  If not, see <http://www.gnu.org/licenses/>. | ||||
|  * | ||||
|  */ | ||||
|  | ||||
| // This file contains the definition of files, image types and | ||||
| // the plugin infrastructure. It should be included in file type | ||||
| // handlers. | ||||
|  | ||||
| #ifndef _PQIV_H_INCLUDED | ||||
| #define _PQIV_H_INCLUDED | ||||
|  | ||||
| #include <glib.h> | ||||
| #include <gtk/gtk.h> | ||||
| #include <gio/gio.h> | ||||
| #include "lib/bostree.h" | ||||
|  | ||||
| #ifndef PQIV_VERSION | ||||
| #define PQIV_VERSION "2.3" | ||||
| #endif | ||||
|  | ||||
| #define FILE_FLAGS_ANIMATION      (guint)(1) | ||||
| #define FILE_FLAGS_MEMORY_IMAGE   (guint)(1<<1) | ||||
|  | ||||
| // The structure for images {{{ | ||||
| typedef struct file_type_handler_struct_t file_type_handler_t; | ||||
| typedef struct { | ||||
| 	// File type | ||||
| 	const file_type_handler_t *file_type; | ||||
|  | ||||
| 	// Special flags | ||||
| 	// FILE_FLAGS_ANIMATION        -> Animation functions are invoked | ||||
| 	//                                Set by file type handlers | ||||
| 	// FILE_FLAGS_MEMORY_IMAGE     -> File lives in memory | ||||
| 	guint file_flags; | ||||
|  | ||||
| 	// The file name to display and to sort by | ||||
| 	gchar *display_name; | ||||
|  | ||||
| 	// The URI or file name of the file | ||||
| 	gchar *file_name; | ||||
|  | ||||
| 	// If the file is a memory image, the actual image data | ||||
| 	GBytes *file_data; | ||||
|  | ||||
| 	// The file monitor structure is used for inotify-watching of | ||||
| 	// the files | ||||
| 	GFileMonitor *file_monitor; | ||||
|  | ||||
| 	// This flag stores whether this image is currently loaded | ||||
| 	// and valid. i.e. if it is set, you can assume that | ||||
| 	// private_data contains a representation of the image; | ||||
| 	// if not, you can NOT assume that it does not. | ||||
| 	gboolean is_loaded; | ||||
|  | ||||
| 	// Cached image size | ||||
| 	guint width; | ||||
| 	guint height; | ||||
|  | ||||
| 	// File-type specific data, allocated and freed by the file type handlers | ||||
| 	void *private; | ||||
| } file_t; | ||||
| // }}} | ||||
| // Definition of the built-in file types {{{ | ||||
|  | ||||
| // If you want to implement your own file type, you'll have to implement the | ||||
| // following functions and a non-static initialization function named | ||||
| // file_type_NAME_initializer that fills a file_type_handler_t with pointers to | ||||
| // the functions. Store the file in backends/NAME.c and adjust the Makefile to | ||||
| // add the required libraries if your backend is listed in the $(BACKENDS) | ||||
| // variable. | ||||
|  | ||||
| typedef enum { PARAMETER, RECURSION, INOTIFY, BROWSE_ORIGINAL_PARAMETER, FILTER_OUTPUT } load_images_state_t; | ||||
| // Allocation function: Allocate the ->private structure within a file and add the | ||||
| // image(s) to the list of available images via load_images_handle_parameter_add_file() | ||||
| // If an image is not to be loaded for any reason, the file structure should be | ||||
| // deallocated using file_free() | ||||
| // Returns a pointer to the first added image | ||||
| // Optional, you can also set the pointer to this function to NULL. | ||||
| typedef BOSNode *(*file_type_alloc_fn_t)(load_images_state_t state, file_t *file); | ||||
|  | ||||
| // Deallocation, if a file is removed from the images list. Free the ->private structure. | ||||
| // Only called if ->private is non-NULL. | ||||
| typedef void (*file_type_free_fn_t)(file_t *file); | ||||
|  | ||||
| // Actually load a file into memory | ||||
| typedef void (*file_type_load_fn_t)(file_t *file, GInputStream *data, GError **error_pointer); | ||||
|  | ||||
| // Unload a file | ||||
| typedef void (*file_type_unload_fn_t)(file_t *file); | ||||
|  | ||||
| // Animation support: Initialize memory for animations, return ms until first frame | ||||
| // Optional, you can also set the pointer to this function to NULL. | ||||
| typedef double (*file_type_animation_initialize_fn_t)(file_t *file); | ||||
|  | ||||
| // Animation support: Advance to the next frame, return ms until next frame | ||||
| // Optional, you can also set the pointer to this function to NULL. | ||||
| typedef double (*file_type_animation_next_frame_fn_t)(file_t *file); | ||||
|  | ||||
| // Draw the current view to a cairo context | ||||
| typedef void (*file_type_draw_fn_t)(file_t *file, cairo_t *cr); | ||||
|  | ||||
| struct file_type_handler_struct_t { | ||||
| 	// All files will be filtered with this filter. If it lets it pass, | ||||
| 	// a handler is assigned to a file. If none do, the file is | ||||
| 	// discarded if it was found during directory traversal or | ||||
| 	// loaded using the first image backend if it was an explicit | ||||
| 	// parameter. | ||||
| 	GtkFileFilter *file_types_handled; | ||||
|  | ||||
| 	// Pointers to the functions defined above | ||||
| 	file_type_alloc_fn_t alloc_fn; | ||||
| 	file_type_free_fn_t free_fn; | ||||
| 	file_type_load_fn_t load_fn; | ||||
| 	file_type_unload_fn_t unload_fn; | ||||
| 	file_type_animation_initialize_fn_t animation_initialize_fn; | ||||
| 	file_type_animation_next_frame_fn_t animation_next_frame_fn; | ||||
| 	file_type_draw_fn_t draw_fn; | ||||
| }; | ||||
|  | ||||
| // Initialization function: Tell pqiv about a backend | ||||
| typedef void (*file_type_initializer_fn_t)(file_type_handler_t *info); | ||||
|  | ||||
| // pqiv symbols available to plugins {{{ | ||||
|  | ||||
| // Global cancellable that should be used for every i/o operation | ||||
| extern GCancellable *image_loader_cancellable; | ||||
|  | ||||
| // Current scale level. For backends that don't support cairo natively. | ||||
| extern gdouble current_scale_level; | ||||
|  | ||||
| // Load a file from disc/memory/network | ||||
| GInputStream *image_loader_stream_file(file_t *file, GError **error_pointer); | ||||
|  | ||||
| // Add a file to the list of loaded files | ||||
| // Should be called at least once in a file_type_alloc_fn_t, with the state being | ||||
| // forwarded unaltered. | ||||
| BOSNode *load_images_handle_parameter_add_file(load_images_state_t state, file_t *file); | ||||
|  | ||||
| // Load all data from an input stream into memory, conveinience function | ||||
| GBytes *g_input_stream_read_completely(GInputStream *input_stream, GCancellable *cancellable, GError **error_pointer); | ||||
|  | ||||
| // Free a file | ||||
| void file_free(file_t *file); | ||||
|  | ||||
| // }}} | ||||
|  | ||||
| // File type handlers, used in the initializer and file type guessing | ||||
| extern file_type_handler_t file_type_handlers[]; | ||||
|  | ||||
| /* }}} */ | ||||
|  | ||||
| #endif | ||||
| @@ -58,6 +58,34 @@ var BA: [BlockSpace] int; | ||||
| forall ba in BA do | ||||
|   ba = here.id; | ||||
|  | ||||
| // | ||||
| // The 'hasSingleLocalSubdomain' method on arrays will return true if the  | ||||
| // index set for a locale can be represented by a single domain. | ||||
| // | ||||
| if !BA.hasSingleLocalSubdomain() then | ||||
|   halt("For a Block distribution, the index set per locale should be \ | ||||
|       represented by a single domain"); | ||||
|  | ||||
| // | ||||
| // If the distribution's subdomains can be represented as single subdomain, | ||||
| // we can use the 'localSubdomain' method to get the index set for the  | ||||
| // current locale. | ||||
| // | ||||
| // Below, we'll use the index set to confirm that the array elements have the  | ||||
| // correct locale id. | ||||
| // | ||||
|  | ||||
| for L in Locales { | ||||
|   on L { | ||||
|     const indices = BA.localSubdomain(); | ||||
|     for i in indices { | ||||
|       if BA[i] != L.id then | ||||
|         halt("Error: incorrect locale id"); | ||||
|     } | ||||
|   } | ||||
| } | ||||
|  | ||||
|  | ||||
| // | ||||
| // Output the Block-distributed array to visually see how the elements | ||||
| // are partitioned across the locales. | ||||
| @@ -104,6 +132,14 @@ writeln("Block Array Index Map"); | ||||
| writeln(BA2); | ||||
| writeln(); | ||||
|  | ||||
| // | ||||
| // We can use the 'targetLocales' method available on an array to get the | ||||
| // locales array used as targets. | ||||
| // | ||||
| for (L, ML) in zip(BA2.targetLocales(), MyLocales) do | ||||
|   if L != ML then | ||||
|     halt("Error: BA2.targetLocales() should equal MyLocales"); | ||||
|  | ||||
|  | ||||
|  | ||||
| // | ||||
| @@ -126,6 +162,18 @@ writeln("Cyclic Array Index Map"); | ||||
| writeln(CA); | ||||
| writeln(); | ||||
|  | ||||
| // | ||||
| // The domain returned by 'localSubdomain' need not be a dense block, as is | ||||
| // the case for the Cyclic Distribution. | ||||
| // | ||||
| on Locales[0] { | ||||
|   const indices = CA.localSubdomain(); | ||||
|   for i in indices { | ||||
|     if CA[i] != 0 then | ||||
|       halt("Error: Cyclic array values on Locale 0 should be zero"); | ||||
|   } | ||||
| } | ||||
|  | ||||
|  | ||||
| // | ||||
| // Next, we'll declare a Block-Cyclic distribution.  These | ||||
| @@ -134,7 +182,7 @@ writeln(); | ||||
| // of indices.  Thus, the BlockCyclic distribution is parameterized | ||||
| // by a starting index (as with Cyclic) and a block size (per | ||||
| // dimension) specifying how large the chunks to be dealt out are. | ||||
| //  | ||||
| // | ||||
| const BlkCycSpace = Space dmapped BlockCyclic(startIdx=Space.low,  | ||||
|                                               blocksize=(2, 3)); | ||||
| var BCA: [BlkCycSpace] int; | ||||
| @@ -146,6 +194,46 @@ writeln("Block-Cyclic Array Index Map"); | ||||
| writeln(BCA); | ||||
| writeln(); | ||||
|  | ||||
| // | ||||
| // A locale's index set for a Block-Cyclic distribution cannot be represented | ||||
| // by a single subdomain. | ||||
| // | ||||
| if BCA.hasSingleLocalSubdomain() then | ||||
|   halt("A Block-Cyclic index set cannot be represented by a single subdomain"); | ||||
|  | ||||
| // | ||||
| // If the local index set cannot be represented by a single subdomain,  | ||||
| // we can use the 'localSubdomains' iterator to yield a number of domains | ||||
| // that represent the whole index set. | ||||
| // | ||||
| // Let's write a function that will use 'localSubdomains' to verify the  | ||||
| // correctness of the array values. | ||||
| // | ||||
|  | ||||
| proc verifyID(Data: []) { | ||||
|   for L in Locales { | ||||
|     on L { | ||||
|       for indices in Data.localSubdomains() { | ||||
|         for i in indices { | ||||
|           if Data[i] != L.id then | ||||
|             halt("Error: incorrect locale id"); | ||||
|         } | ||||
|       } | ||||
|     } | ||||
|   } | ||||
| } | ||||
| verifyID(BCA); | ||||
|  | ||||
| // | ||||
| // The 'localSubdomains' iterator is also available on distributions that | ||||
| // can represent a locale's index set with a single domain. This allows us to | ||||
| // write more general code that will work for all distributions. | ||||
| // | ||||
| // This means that we can call the 'verifyID' function on any array, like the | ||||
| // 'BA' array from earlier. | ||||
| // | ||||
| verifyID(BA); | ||||
|  | ||||
|  | ||||
| // | ||||
| // The ReplicatedDist distribution is different: each of the | ||||
|   | ||||
| @@ -292,14 +292,14 @@ proc main() { | ||||
|     LagrangeLeapFrog(); | ||||
|  | ||||
|     if debug { | ||||
|       //      deprint("[[ Forces ]]", fx, fy, fz); | ||||
|       deprintatomic("[[ Forces ]]", fx, fy, fz); | ||||
|       deprint("[[ Positions ]]", x, y, z); | ||||
|       deprint("[[ p, e, q ]]", p, e, q); | ||||
|     } | ||||
|     if showProgress then | ||||
|       writeln("time = ", format("%e", time), ", dt=", format("%e", deltatime), | ||||
|               if doTiming then ", elapsed = " + (getCurrentTime()-iterTime)  | ||||
|                           else ""); | ||||
|       writef("time = %er, dt=%er, %s", time, deltatime, | ||||
|              if doTiming then ", elapsed = " + (getCurrentTime()-iterTime) +"\n" | ||||
|                          else "\n"); | ||||
|   } | ||||
|   if (cycle == maxcycles) { | ||||
|     writeln("Stopped early due to reaching maxnumsteps"); | ||||
| @@ -314,12 +314,10 @@ proc main() { | ||||
|   if printCoords { | ||||
|     var outfile = open("coords.out", iomode.cw); | ||||
|     var writer = outfile.writer(); | ||||
|     var fmtstr = if debug then "%1.9e" else "%1.4e"; | ||||
|     for i in Nodes { | ||||
|       writer.writeln(format(fmtstr, x[i]), " ",  | ||||
|                      format(fmtstr, y[i]), " ",  | ||||
|                      format(fmtstr, z[i])); | ||||
|     } | ||||
|     var fmtstr = if debug then "%1.9re %1.9er %1.9er\n"  | ||||
|                           else "%1.4er %1.4er %1.4er\n"; | ||||
|     for i in Nodes do | ||||
|       writer.writef(fmtstr, x[i], y[i], z[i]); | ||||
|     writer.close(); | ||||
|     outfile.close(); | ||||
|   } | ||||
| @@ -479,7 +477,7 @@ inline proc localizeNeighborNodes(eli: index(Elems), | ||||
|                                   y: [] real, ref y_local: 8*real, | ||||
|                                   z: [] real, ref z_local: 8*real) { | ||||
|  | ||||
|   for param i in 1..nodesPerElem { | ||||
|   for i in 1..nodesPerElem { | ||||
|     const noi = elemToNode[eli][i]; | ||||
|  | ||||
|     x_local[i] = x[noi]; | ||||
| @@ -670,7 +668,7 @@ proc SumElemStressesToNodeForces(b_x: 8*real, b_y: 8*real, b_z: 8*real, | ||||
|                                  ref fx: 8*real, | ||||
|                                  ref fy: 8*real, | ||||
|                                  ref fz: 8*real) { | ||||
|   for param i in 1..8 { | ||||
|   for i in 1..8 { | ||||
|     fx[i] = -(stress_xx * b_x[i]); | ||||
|     fy[i] = -(stress_yy * b_y[i]); | ||||
|     fz[i] = -(stress_zz * b_z[i]); | ||||
| @@ -725,17 +723,17 @@ inline proc CalcElemFBHourglassForce(xd: 8*real, yd: 8*real, zd: 8*real, | ||||
|   var hx, hy, hz: 4*real; | ||||
|  | ||||
|   // reduction | ||||
|   for param i in 1..4 { | ||||
|     for param j in 1..8 { | ||||
|   for i in 1..4 { | ||||
|     for j in 1..8 { | ||||
|       hx[i] += hourgam[j][i] * xd[j]; | ||||
|       hy[i] += hourgam[j][i] * yd[j]; | ||||
|       hz[i] += hourgam[j][i] * zd[j]; | ||||
|     } | ||||
|   } | ||||
|  | ||||
|   for param i in 1..8 { | ||||
|   for i in 1..8 { | ||||
|     var shx, shy, shz: real; | ||||
|     for param j in 1..4 { | ||||
|     for j in 1..4 { | ||||
|       shx += hourgam[i][j] * hx[j]; | ||||
|       shy += hourgam[i][j] * hy[j]; | ||||
|       shz += hourgam[i][j] * hz[j]; | ||||
| @@ -1088,16 +1086,16 @@ proc CalcFBHourglassForceForElems(determ, x8n, y8n, z8n, dvdx, dvdy, dvdz) { | ||||
|  | ||||
|     /* TODO: Can we enable this local block? */ | ||||
|     // local { | ||||
|       for param i in 1..4 { | ||||
|       for i in 1..4 { | ||||
|         var hourmodx, hourmody, hourmodz: real; | ||||
|         // reduction | ||||
|         for param j in 1..8 { | ||||
|         for j in 1..8 { | ||||
|           hourmodx += x8n[eli][j] * gammaCoef[i][j]; | ||||
|           hourmody += y8n[eli][j] * gammaCoef[i][j]; | ||||
|           hourmodz += z8n[eli][j] * gammaCoef[i][j]; | ||||
|         } | ||||
|  | ||||
|         for param j in 1..8 { | ||||
|         for j in 1..8 { | ||||
|           hourgam[j][i] = gammaCoef[i][j] - volinv *  | ||||
|             (dvdx[eli][j] * hourmodx + | ||||
|              dvdy[eli][j] * hourmody + | ||||
| @@ -1221,7 +1219,7 @@ proc CalcKinematicsForElems(dxx, dyy, dzz, const dt: real) { | ||||
|       arealg[k] = CalcElemCharacteristicLength(x_local, y_local, z_local, | ||||
|                                                volume); | ||||
|  | ||||
|       for param i in 1..8 { | ||||
|       for i in 1..8 { | ||||
|         x_local[i] -= dt2 * xd_local[i]; | ||||
|         y_local[i] -= dt2 * yd_local[i]; | ||||
|         z_local[i] -= dt2 * zd_local[i]; | ||||
| @@ -1669,7 +1667,7 @@ proc CalcSoundSpeedForElems(vnewc, rho0:real, enewc, pnewc, pbvc, bvc) { | ||||
|  | ||||
|  | ||||
| iter elemToNodes(elem) { | ||||
|   for param i in 1..nodesPerElem do | ||||
|   for i in 1..nodesPerElem do | ||||
|     yield elemToNode[elem][i]; | ||||
| } | ||||
|                                   | ||||
| @@ -1679,14 +1677,19 @@ iter elemToNodesTuple(e) { | ||||
| } | ||||
|  | ||||
|  | ||||
| proc deprint(title:string, x:[?D] real, y:[D]real, z:[D]real) { | ||||
| proc deprint(title:string, x:[?D] real, y:[D] real, z:[D] real) { | ||||
|   writeln(title); | ||||
|   for i in D { | ||||
|     writeln(format("%3d", i), ": ",  | ||||
|             format("%3.4e", x[i]), " ",  | ||||
|             format("%3.4e", y[i]), " ",  | ||||
|             format("%3.4e", z[i])); | ||||
|   } | ||||
|   for i in D do | ||||
|     writef("%3i: %3.4er %3.4er %3.4er\n",  | ||||
|            if use3DRepresentation then idx3DTo1D(i, D.dim(1).size) else i,  | ||||
|            x[i], y[i], z[i]); | ||||
| } | ||||
|  | ||||
|  | ||||
| proc deprintatomic(title:string, x:[?D] atomic real, y:[] atomic real, z:[] atomic real) { | ||||
|   writeln(title); | ||||
|   for i in D do | ||||
|     writef("%3i: %3.4er %3.4er %3.4er\n",  | ||||
|            if use3DRepresentation then idx3DTo1D(i, D.dim(1).size) else i,  | ||||
|            x[i].peek(), y[i].peek(), z[i].peek()); | ||||
| } | ||||
|   | ||||
							
								
								
									
										6
									
								
								samples/Charity/example.ch
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										6
									
								
								samples/Charity/example.ch
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,6 @@ | ||||
| % | ||||
| %   Some very badly written Charity | ||||
| % | ||||
|  | ||||
| data LA(A) -> D = ss: A -> D | ||||
|                 | ff: -> D. | ||||
							
								
								
									
										172
									
								
								samples/Clarion/CStringClass.clw
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										172
									
								
								samples/Clarion/CStringClass.clw
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,172 @@ | ||||
|       Member() | ||||
|          omit('***$***',_VER_C55) | ||||
| _ABCDllMode_  EQUATE(0) | ||||
| _ABCLinkMode_ EQUATE(1) | ||||
|          ***$*** | ||||
|       Include('Equates.CLW'),ONCE | ||||
|       Include('Keycodes.CLW'),ONCE | ||||
|       Include('Errors.CLW'),ONCE | ||||
|       Map | ||||
|       End ! map | ||||
|       Include('CStringClass.inc'),ONCE | ||||
| CStringClass.Construct PROCEDURE                       ! Declare Procedure | ||||
|   CODE | ||||
|   SELF.bufferSize  = DEFAULT_CS_BUFFER_SIZE | ||||
|   SELF.CS         &= New(CSTRING(SELF.bufferSize)) | ||||
| CStringClass.Destruct PROCEDURE                        ! Declare Procedure | ||||
|   CODE | ||||
|   Dispose(SELF.cs) | ||||
| CStringClass.Cat PROCEDURE  (STRING pStr) !,*CSTRING,PROC ! Declare Procedure | ||||
| newLen                       LONG,AUTO | ||||
| oldCS                        &CSTRING | ||||
|   CODE | ||||
|   newLen = Len(pStr) | ||||
|   IF (newLen+SELF.strLength+2) > SELF.newStrSize | ||||
|     ! Only grow the internal string if the result of the cat will be larger than the string currently is. | ||||
|     ! The reason for the "+2" is because this is used in the string slicing outside this IF. Without this matching +2 there is potential for an out of bounds slice which would be bad! | ||||
|  | ||||
|     ! Save a temporary copy of the old string so we can us it in the concatination after we have grown it! | ||||
|     oldCS &= New(CSTRING(SELF.strLength+1)) | ||||
|     oldCS = SELF.CS | ||||
|     Dispose(SELF.CS) | ||||
|  | ||||
|     SELF.newStrSize = newLen + SELF.strLength + 1 + SELF.bufferSize | ||||
|     SELF.CS &= New(CSTRING(SELF.newStrSize)) | ||||
|     SELF.CS = oldCS | ||||
|     Dispose(oldCS) | ||||
|   END | ||||
|  | ||||
|   ! Append the new string directly to the end of the old one. | ||||
|   SELF.CS[SELF.strLength+1 : SELF.strLength+newLen] = pStr | ||||
|   ! And terminate the CSTRING manually | ||||
|   SELF.CS[SELF.strLength+newLen+1] = '<0>' | ||||
|  | ||||
|   ! This is the same as doing "SELF.strLength = Len(SELF.CS)" but the Len() is _really_ slow on large strings. This is much faster! | ||||
|   SELF.strLength += newLen | ||||
|  | ||||
|   ! This is what it used to be: | ||||
|   ! SELF.Str(SELF.Str() & s) | ||||
|   ! It is a nice and neat solution but performance, especially on large strings was terrible! | ||||
|  | ||||
|   RETURN SELF.Str() | ||||
| CStringClass.Str PROCEDURE  (STRING pStr) !,*CSTRING, PROC   ! Declare Procedure | ||||
|   CODE | ||||
|   IF Len(pStr) > SELF.newStrSize | ||||
|     ! Only Dispose/New the internal string if the new one requires it. | ||||
|     ! This might be slightly innefficient in terms of memory usage when the string gets smaller | ||||
|     ! But it is _vasty_ better for performance when the string gets added to a lot. | ||||
|     Dispose(SELF.CS) | ||||
|     SELF.newStrSize = Len(pStr) + 1 + SELF.bufferSize | ||||
|     SELF.CS &= New(CSTRING(SELF.newStrSize)) | ||||
|   END | ||||
|  | ||||
|   SELF.CS        = pStr | ||||
|   SELF.strLength = Len(SELF.CS) | ||||
|  | ||||
|   RETURN SELF.CS | ||||
| CStringClass.Len PROCEDURE  !,LONG                     ! Declare Procedure | ||||
|   CODE | ||||
|   RETURN SELF.strLength | ||||
| CStringClass.Replace PROCEDURE  (STRING pFind, STRING pReplace) !,*CSTRING,PROC ! Declare Procedure | ||||
| ! FindString , ReplaceWith | ||||
| locate                       LONG,AUTO | ||||
| lastLocate                   LONG | ||||
|   CODE | ||||
|   LOOP | ||||
|     locate = InString(Upper(pFind), Upper(SELF.Str()), 1, lastLocate+1) | ||||
|     IF ~locate | ||||
|       BREAK | ||||
|     END | ||||
|  | ||||
|     ! So we dont end up having recursive replacement. | ||||
|     lastLocate = locate + Len(pReplace)-1 | ||||
|  | ||||
|     SELF.Str(Sub(SELF.Str(), 1, locate-1)                  & | | ||||
|              pReplace                                      & | | ||||
|              Sub(SELF.Str(), locate+Len(pFind), SELF.Len())    | | ||||
|              ) | ||||
|   END | ||||
|  | ||||
|   RETURN SELF.Str() | ||||
| CStringClass.Str PROCEDURE  () !,*CSTRING              ! Declare Procedure 3 | ||||
|   CODE | ||||
|   RETURN SELF.CS | ||||
| !------------------------------------------------------------------------------ | ||||
| CStringClass.Contains PROCEDURE  (STRING pFind, BYTE pCaseSensitive=TRUE) !,BYTE ! Declare Procedure | ||||
| ! Returns a value (TRUE) indicating whether the specified String occurs within this string. | ||||
| ! Second parameter defaults to a case sensitive search. | ||||
|   CODE | ||||
|   IF pCaseSensitive = TRUE | ||||
|     IF InString(pFind, SELF.Str(), 1 , 1) > 0 | ||||
|       RETURN TRUE | ||||
|     END | ||||
|   ELSE | ||||
|     IF InString(Lower(pFind), SELF.Lower(), 1 , 1) > 0 | ||||
|       RETURN TRUE | ||||
|     END | ||||
|   END | ||||
|  | ||||
|   RETURN FALSE | ||||
| CStringClass.Lower PROCEDURE  () !,STRING              ! Declare Procedure | ||||
| ! Returns a "Lowered" version of the self.cs doesnt change the self.cs | ||||
|   CODE | ||||
|   RETURN Lower(SELF.CS) | ||||
| CStringClass.SubString PROCEDURE  (LONG pPosition, LONG pLength) !,STRING,PROC ! Declare Procedure | ||||
|   CODE | ||||
|   RETURN Sub(SELF.Str(), pPosition, pLength) | ||||
| CStringClass.ToLower PROCEDURE  () !,*CSTRING,PROC     ! Declare Procedure | ||||
| ! Converts this string to lowercase and returns the converted string | ||||
|  | ||||
|   CODE | ||||
|   RETURN SELF.Str(SELF.Lower()) | ||||
| CStringClass.ToUpper PROCEDURE  () !,*CSTRING,PROC     ! Declare Procedure | ||||
| ! Converts this string to uppercase and returns the converted string | ||||
|  | ||||
|   CODE | ||||
|   RETURN SELF.Str(SELF.Upper()) | ||||
| CStringClass.Trim PROCEDURE  () !,*CSTRING,PROC        ! Declare Procedure | ||||
|   CODE | ||||
|   SELF.Str(Left(SELF.Str())) | ||||
|   SELF.Str(Clip(SELF.Str())) | ||||
|   RETURN SELF.Str() | ||||
| CStringClass.Upper PROCEDURE  () !,STRING              ! Declare Procedure | ||||
|   CODE | ||||
|   RETURN Upper(SELF.Str()) | ||||
| CStringClass.IndexOf PROCEDURE  (STRING pLookIn, BYTE pCaseSensitive=TRUE) !,LONG ! Declare Procedure | ||||
| ! Returns the index of the first parameter (pLookIn) is found within the SELF.CS | ||||
| ! zero if it is not found | ||||
|   CODE | ||||
|   IF pCaseSensitive = TRUE | ||||
|     RETURN InString(SELF.Str(), pLookIn, 1 , 1) | ||||
|   ELSE | ||||
|     RETURN InString(SELF.Lower(), Lower(pLookIn), 1 , 1) | ||||
|   END | ||||
| CStringClass.FoundIn PROCEDURE  (STRING pLookIn, BYTE pCaseSensitive=TRUE) !,BYTE ! Declare Procedure | ||||
| ! Returns TRUE if the first parameter (pLookIn) is found within the SELF.CS | ||||
| ! FALSE if it is no | ||||
|   CODE | ||||
|   IF SELF.IndexOf(pLookIn, pCaseSensitive) > 0 | ||||
|     RETURN TRUE | ||||
|   ELSE | ||||
|     RETURN FALSE | ||||
|   END | ||||
| CStringClass.SetBuffer PROCEDURE  (LONG pNewBuffer)    ! Declare Procedure | ||||
|   CODE | ||||
|   SELF.bufferSize = pNewBuffer | ||||
| CStringClass.EscapeXml PROCEDURE  (<STRING pStr>) !,STRING ! Declare Procedure | ||||
| CS CStringClass | ||||
|   CODE | ||||
|   IF Omitted(pStr)=FALSE | ||||
|     CS.Str(pStr) | ||||
|   ELSE | ||||
|     ! Make a copy so we don't alter the original | ||||
|     CS.Str(SELF.Str()) | ||||
|   END | ||||
|   CS.Replace('&', '&') | ||||
|   CS.Replace('<', '<') | ||||
|   CS.Replace('>', '>') | ||||
|   CS.Replace('"', '"') | ||||
|   CS.Replace('''', ''') | ||||
|  | ||||
|   RETURN CS.Str() | ||||
|  | ||||
							
								
								
									
										68
									
								
								samples/Clarion/ConsoleSupport.clw
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										68
									
								
								samples/Clarion/ConsoleSupport.clw
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,68 @@ | ||||
|       Member() | ||||
|       Include('ConsoleSupport.inc'),ONCE | ||||
| 	  Map | ||||
|         MODULE('32-bit Windows API') | ||||
|             ! General functions | ||||
|             GetLastError(),DWORD,PASCAL | ||||
|   | ||||
|             ! Console functions | ||||
|             GetStdHandle(DWORD),HANDLE,PASCAL,PROC,RAW | ||||
|             WriteConsole(Handle,Long,Dword,long,long),bool,Raw,Pascal,name('WriteConsoleA') | ||||
|             ReadConsole(Handle,Long,Dword,long,long),bool,Raw,Pascal,name('ReadConsoleA') | ||||
|             SetConsoleTitle(Long),Bool,Raw,Pascal,name('SetConsoleTitleA') | ||||
|             GetConsoleTitle(Long,dword),Bool,Raw,Pascal,name('GetConsoleTitleA') | ||||
|             SetConsoleMode(Handle,dWord),BOOL,RAW,PASCAL | ||||
|             GetConsoleMode(Handle,Long),BOOL,RAW,PASCAL | ||||
|         End | ||||
|       End  | ||||
|        | ||||
| ConsoleSupport.Construct PROCEDURE | ||||
|  | ||||
|   CODE | ||||
|  | ||||
| ConsoleSupport.Destruct PROCEDURE | ||||
|  | ||||
|   CODE | ||||
|  | ||||
| ConsoleSupport.Init				   PROCEDURE () !,BYTE,VIRTUAL  | ||||
|   CODE | ||||
|  | ||||
|     SELF.OutputHandle = GetStdHandle(STD_OUTPUT_HANDLE) | ||||
|     If SELF.OutputHandle = INVALID_HANDLE_VALUE | ||||
|         Halt(1,'Unable to get output handle (' & GetLastError() & ')') | ||||
|         RETURN INVALID_HANDLE_VALUE | ||||
|     End | ||||
|   | ||||
|     SELF.InputHandle = GetStdHandle(STD_INPUT_HANDLE) | ||||
|     if SELF.InputHandle = INVALID_HANDLE_VALUE | ||||
|         Halt(2,'Unable to get console input handle (' & GetLastError() & ')') | ||||
|         RETURN INVALID_HANDLE_VALUE | ||||
|     End | ||||
|   | ||||
|     If ~SetConsoleMode(SELF.InputHandle,ENABLE_PROCESSED_INPUT ) | ||||
|         Halt(3,'Unable to set console mode (' & GetLastError() & ')') | ||||
|         RETURN INVALID_OTHER | ||||
|     End | ||||
|  | ||||
|     RETURN FALSE | ||||
|  | ||||
| ConsoleSupport.WriteLine			   PROCEDURE (STRING pText) !,BYTE,PROC,VIRTUAL  | ||||
|   CODE | ||||
|     SELF.TextBuffer = SELF.Prefix & pText & '<13,10>' | ||||
|     If WriteConsole(SELF.OutputHandle, ADDRESS(SELF.TextBuffer), LEN(SELF.TextBuffer),ADDRESS(SELF.BytesWritten), NULL) = 0 | ||||
|         Halt(4,'WriteConsoleError (' & GetLastError() & ')') | ||||
|         RETURN -1 | ||||
|     End | ||||
|     RETURN FALSE | ||||
|  | ||||
| Consolesupport.ReadKey  			   PROCEDURE () !,STRING,PROC,VIRTUAL  | ||||
|   CODE | ||||
|   SELF.WriteLine('Press any key to continue...') | ||||
|   Clear(SELF.InBuffer) | ||||
|   Loop | ||||
|     IF ReadConsole(SELF.InputHandle,Address(SELF.InBuffer),100,Address(SELF.BytesRead),NULL) = 0 THEN | ||||
|       Halt(5,'Error on read console (' & GetLastError() & ')') | ||||
|       Break | ||||
|     End | ||||
|   Until SELF.BytesRead > 0 | ||||
|   RETURN SELF.InBuffer | ||||
							
								
								
									
										10
									
								
								samples/Clarion/HelloWorld.clw
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										10
									
								
								samples/Clarion/HelloWorld.clw
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,10 @@ | ||||
|   PROGRAM | ||||
|  | ||||
|   MAP | ||||
|   END | ||||
|  | ||||
|   CODE | ||||
|  | ||||
|   MESSAGE('Hello World!') | ||||
|  | ||||
|   RETURN | ||||
							
								
								
									
										12
									
								
								samples/Clarion/hello.clw
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										12
									
								
								samples/Clarion/hello.clw
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,12 @@ | ||||
|   MEMBER() | ||||
|   INCLUDE('HelloClass.inc'),ONCE | ||||
|   MAP | ||||
|   END | ||||
|  | ||||
| HelloClass.Construct              PROCEDURE | ||||
|   CODE | ||||
| HelloClass.Destruct               PROCEDURE() !,VIRTUAL | ||||
|   CODE | ||||
| HelloClass.SayHello               PROCEDURE | ||||
|   CODE | ||||
|   MESSAGE('Hello World!') | ||||
							
								
								
									
										15
									
								
								samples/Clojure/build.boot
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										15
									
								
								samples/Clojure/build.boot
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,15 @@ | ||||
| ;; from: https://github.com/boot-clj/boot#configure-task-options | ||||
|  | ||||
| (set-env! | ||||
|   :source-paths #{"src"} | ||||
|   :dependencies '[[me.raynes/conch "0.8.0"]]) | ||||
|  | ||||
| (task-options! | ||||
|   pom {:project 'my-project | ||||
|        :version "0.1.0"} | ||||
|   jar {:manifest {"Foo" "bar"}}) | ||||
|  | ||||
| (deftask build | ||||
|   "Build my project." | ||||
|   [] | ||||
|   (comp (pom) (jar) (install))) | ||||
							
								
								
									
										164
									
								
								samples/Common Lisp/array.l
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										164
									
								
								samples/Common Lisp/array.l
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,164 @@ | ||||
| ;;; -*- Mode: Lisp; Package: LISP -*- | ||||
| ;;; | ||||
| ;;; This file is part of xyzzy. | ||||
| ;;; | ||||
|  | ||||
| (provide "array") | ||||
|  | ||||
| (in-package "lisp") | ||||
|  | ||||
| (export '(make-vector make-array vector array-dimensions array-in-bounds-p | ||||
| 	  upgraded-array-element-type adjust-array)) | ||||
|  | ||||
| (defun upgraded-array-element-type (type) | ||||
|   (cond ((or (eq type 't) | ||||
| 	     (null type)) | ||||
| 	 't) | ||||
| 	((member type '(character base-character standard-char | ||||
| 			extended-character) :test #'eq) | ||||
| 	 'character) | ||||
| 	(t | ||||
| 	 (setq type (car (si:canonicalize-type type))) | ||||
| 	 (cond ((or (eq type 't) | ||||
| 		    (null type)) | ||||
| 		't) | ||||
| 	       ((member type '(character base-character standard-char | ||||
| 			       extended-character) :test #'eq) | ||||
| 		'character) | ||||
| 	       (t 't))))) | ||||
|  | ||||
| (defun check-array-initialize-option (ies-p ics-p displaced-to) | ||||
|   (let ((x 0)) | ||||
|     (and ies-p (incf x)) | ||||
|     (and ics-p (incf x)) | ||||
|     (and displaced-to (incf x)) | ||||
|     (when (> x 1) | ||||
|       (error ":initial-element, :initial-contents, :displaced-to")))) | ||||
|  | ||||
| (defun make-vector (length &key | ||||
| 			   (element-type t) | ||||
| 			   (initial-element nil ies-p) | ||||
| 			   (initial-contents nil ics-p) | ||||
| 			   fill-pointer | ||||
| 			   adjustable | ||||
| 			   displaced-to | ||||
| 			   (displaced-index-offset 0)) | ||||
|   (setq element-type (upgraded-array-element-type element-type)) | ||||
|   (check-array-initialize-option ies-p ics-p displaced-to) | ||||
|   (let ((vector (si:*make-vector length element-type initial-element adjustable | ||||
| 				 fill-pointer displaced-to displaced-index-offset))) | ||||
|     (when ics-p | ||||
|       (si:*copy-into-seq vector initial-contents)) | ||||
|     vector)) | ||||
|  | ||||
| (defun make-array (dimensions &rest rest | ||||
| 			      &key | ||||
| 			      (element-type t) | ||||
| 			      (initial-element nil ies-p) | ||||
| 			      (initial-contents nil ics-p) | ||||
| 			      fill-pointer | ||||
| 			      adjustable | ||||
| 			      displaced-to | ||||
| 			      (displaced-index-offset 0)) | ||||
|   (cond ((integerp dimensions) | ||||
| 	 (apply #'make-vector dimensions rest)) | ||||
| 	((= (length dimensions) 1) | ||||
| 	 (apply #'make-vector (car dimensions) rest)) | ||||
| 	(t | ||||
| 	 (setq element-type (upgraded-array-element-type element-type)) | ||||
| 	 (check-array-initialize-option ies-p ics-p displaced-to) | ||||
| 	 (when fill-pointer | ||||
| 	   (error ":fill-pointer")) | ||||
| 	 (let ((array (si:*make-array dimensions element-type | ||||
| 				      initial-element adjustable | ||||
| 				      displaced-to displaced-index-offset))) | ||||
| 	   (when ics-p | ||||
| 	     (let ((dims (make-list (array-rank array) | ||||
| 				    :initial-element 0)) | ||||
| 		   (stack (list initial-contents)) | ||||
| 		   (rank (1- (array-rank array)))) | ||||
| 	       (dolist (x dims) | ||||
| 		 (push (elt (car stack) 0) stack)) | ||||
| 	       (dotimes (i (array-total-size array)) | ||||
| 		 (setf (row-major-aref array i) (car stack)) | ||||
| 		 (do ((x dims (cdr x)) | ||||
| 		      (j rank (1- j))) | ||||
| 		     ((null x)) | ||||
| 		   (pop stack) | ||||
| 		   (incf (car x)) | ||||
| 		   (when (< (car x) (array-dimension array j)) | ||||
| 		     (do ((r (- rank j) (1- r))) | ||||
| 			 ((< r 0)) | ||||
| 		       (push (elt (car stack) (nth r dims)) stack)) | ||||
| 		     (return)) | ||||
| 		   (setf (car x) 0))))) | ||||
| 	   array)))) | ||||
|  | ||||
| (defun vector (&rest list) | ||||
|   (make-vector (length list) :element-type t :initial-contents list)) | ||||
|  | ||||
| (defun array-dimensions (array) | ||||
|   (do ((i (1- (array-rank array)) (1- i)) | ||||
|        (dims '())) | ||||
|       ((minusp i) dims) | ||||
|     (push (array-dimension array i) dims))) | ||||
|  | ||||
| (defun array-in-bounds-p (array &rest subscripts) | ||||
|   (let ((r (array-rank array))) | ||||
|     (when (/= r (length subscripts)) | ||||
|       (error "subscripts: ~S" subscripts)) | ||||
|     (do ((i 0 (1+ i)) | ||||
| 	 (s subscripts (cdr s))) | ||||
| 	((= i r) t) | ||||
|       (unless (<= 0 (car s) (1- (array-dimension array i))) | ||||
| 	(return nil))))) | ||||
|  | ||||
| (defun adjust-array (old-array | ||||
| 		     dimensions | ||||
| 		     &rest rest | ||||
| 		     &key | ||||
| 		     (element-type nil ets-p) | ||||
| 		     initial-element | ||||
| 		     (initial-contents nil ics-p) | ||||
| 		     (fill-pointer nil fps-p) | ||||
| 		     displaced-to | ||||
| 		     displaced-index-offset) | ||||
|   (when (/= (length dimensions) (array-rank old-array)) | ||||
|     (error "?")) | ||||
|   (unless ets-p | ||||
|     (push (array-element-type old-array) rest) | ||||
|     (push :element-type rest)) | ||||
|   (when (adjustable-array-p old-array) | ||||
|     (push t rest) | ||||
|     (push :adjustable rest)) | ||||
|   (cond (fps-p | ||||
| 	 (unless (array-has-fill-pointer-p old-array) | ||||
| 	   (error "?"))) | ||||
| 	(t | ||||
| 	 (when (array-has-fill-pointer-p old-array) | ||||
| 	   (push (fill-pointer old-array) rest) | ||||
| 	   (push :fill-pointer rest)))) | ||||
|   (when (eq old-array displaced-to) | ||||
|     (error "?")) | ||||
|   (let ((new-array (apply #'make-array dimensions rest))) | ||||
|     (or ics-p displaced-to | ||||
| 	(copy-array-partially old-array new-array)) | ||||
|     (cond ((adjustable-array-p old-array) | ||||
| 	   (si:*replace-array old-array new-array) | ||||
| 	   old-array) | ||||
| 	  (t | ||||
| 	   new-array)))) | ||||
|  | ||||
| (defun copy-array-partially (src dst) | ||||
|   (let* ((dims (mapcar #'min (array-dimensions src) (array-dimensions dst))) | ||||
| 	 (r (array-rank src)) | ||||
| 	 (s (make-list r :initial-element 0))) | ||||
|     (setq r (1- r)) | ||||
|     (dotimes (x (apply #'* dims)) | ||||
|       (setf (apply #'aref dst s) (apply #'aref src s)) | ||||
|       (do ((i r (1- i))) | ||||
| 	  ((minusp i)) | ||||
| 	(incf (nth i s)) | ||||
| 	(when (< (nth i s) (nth i dims)) | ||||
| 	  (return)) | ||||
| 	(setf (nth i s) 0))))) | ||||
							
								
								
									
										1201
									
								
								samples/Common Lisp/common.l
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										1201
									
								
								samples/Common Lisp/common.l
									
									
									
									
									
										Normal file
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										2
									
								
								samples/Common Lisp/config.sexp
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										2
									
								
								samples/Common Lisp/config.sexp
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,2 @@ | ||||
| ((exe_name hello) | ||||
|  (link_order (world hello))) | ||||
							
								
								
									
										2
									
								
								samples/Common Lisp/hello.lisp
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										2
									
								
								samples/Common Lisp/hello.lisp
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,2 @@ | ||||
| (DEFUN HELLO () | ||||
|   (PRINT 'HELLO)) | ||||
							
								
								
									
										103
									
								
								samples/Common Lisp/rss.sexp
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										103
									
								
								samples/Common Lisp/rss.sexp
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,103 @@ | ||||
|  | ||||
| (:TURTLE | ||||
|  | ||||
|  (:@PREFIX "rdf:" "<http://www.w3.org/1999/02/22-rdf-syntax-ns#>") | ||||
|  (:@PREFIX "owl:" "<http://www.w3.org/2002/07/owl#>") | ||||
|  (:@PREFIX "dc:" "<http://purl.org/dc/elements/1.1/>") | ||||
|  (:@PREFIX "xsd:" "<http://www.w3.org/2001/XMLSchema#>") | ||||
|  (:@PREFIX "rdfs:" "<http://www.w3.org/2000/01/rdf-schema#>") | ||||
|  | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/channel>") | ||||
|   | ||||
|    (:PREDICATE-OBJECT-LIST | ||||
|      (:URIREF #1="<http://www.w3.org/1999/02/22-rdf-syntax-ns#type>") | ||||
|      (:OBJECTS | ||||
|        (:QNAME "rdfs:Class"))) | ||||
|         | ||||
|    (:PREDICATE-OBJECT-LIST | ||||
|      (:QNAME "rdfs:comment") | ||||
|      (:OBJECTS | ||||
|        (:STRING "An RSS information channel."))) | ||||
|         | ||||
|    (:PREDICATE-OBJECT-LIST | ||||
|      (:QNAME "rdfs:isDefinedBy") | ||||
|      (:OBJECTS | ||||
|        (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|         | ||||
|    (:PREDICATE-OBJECT-LIST | ||||
|      (:QNAME "rdfs:label") | ||||
|      (:OBJECTS | ||||
|        (:STRING "Channel")))) | ||||
|         | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/description>") | ||||
|    | ||||
|    (:PREDICATE-OBJECT-LIST | ||||
|      (:URIREF #1#) | ||||
|      (:OBJECTS | ||||
|        (:QNAME "rdf:Property"))) | ||||
|        | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") | ||||
|    (:OBJECTS (:STRING "A short text description of the subject."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Description"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:subPropertyOf") (:OBJECTS (:QNAME "dc:description")))) | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/image>") | ||||
|   (:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdfs:Class"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") (:OBJECTS (:STRING "An RSS image."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Image")))) | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/item>") | ||||
|   (:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdfs:Class"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") (:OBJECTS (:STRING "An RSS item."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Item")))) | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/items>") | ||||
|   (:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") | ||||
|    (:OBJECTS | ||||
|     (:STRING "Points to a list of rss:item elements that are members of the subject channel."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Items")))) | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/link>") | ||||
|   (:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") | ||||
|    (:OBJECTS (:STRING "The URL to which an HTML rendering of the subject will link."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Link"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:subPropertyOf") (:OBJECTS (:QNAME "dc:identifier")))) | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/name>") | ||||
|   (:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") | ||||
|    (:OBJECTS (:STRING "The text input field's (variable) name."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Name")))) | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/textinput>") | ||||
|   (:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdfs:Class"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") (:OBJECTS (:STRING "An RSS text input."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Text Input")))) | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/title>") | ||||
|   (:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") | ||||
|    (:OBJECTS (:STRING "A descriptive title for the channel."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Title"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:subPropertyOf") (:OBJECTS (:QNAME "dc:title")))) | ||||
|  (:TRIPLES (:URIREF "<http://purl.org/rss/1.0/url>") | ||||
|   (:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") | ||||
|    (:OBJECTS | ||||
|     (:STRING | ||||
|      "The URL of the image to used in the 'src' attribute of the channel's image tag when rendered as HTML."))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy") | ||||
|    (:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "URL"))) | ||||
|   (:PREDICATE-OBJECT-LIST (:QNAME "rdfs:subPropertyOf") (:OBJECTS (:QNAME "dc:identifier"))))) | ||||
							
								
								
									
										318
									
								
								samples/D/mpq.d
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										318
									
								
								samples/D/mpq.d
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,318 @@ | ||||
| /* | ||||
|  *  mpq.d -- D programming language module for libmpq | ||||
|  * | ||||
|  *  Copyright (c) 2008 Georg Lukas <georg@op-co.de> | ||||
|  * | ||||
|  *  This program is free software; you can redistribute it and/or modify | ||||
|  *  it under the terms of the GNU General Public License as published by | ||||
|  *  the Free Software Foundation; either version 2 of the License, or | ||||
|  *  (at your option) any later version. | ||||
|  * | ||||
|  *  This program is distributed in the hope that it will be useful, | ||||
|  *  but WITHOUT ANY WARRANTY; without even the implied warranty of | ||||
|  *  MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the | ||||
|  *  GNU General Public License for more details. | ||||
|  * | ||||
|  *  You should have received a copy of the GNU General Public License | ||||
|  *  along with this program; if not, write to the Free Software | ||||
|  *  Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. | ||||
|  * | ||||
|  *  This module is written to support Phobos. Patches to allow binding to | ||||
|  *  Tango are welcome. | ||||
|  */ | ||||
|  | ||||
| module mpq; | ||||
|  | ||||
| /* the following pragma does not work on DMD/Linux, generates a warning on | ||||
|  * GDC/Linux and has not been tested on Windows. Commented out for now. */ | ||||
| // pragma(lib, "libmpq"); | ||||
|  | ||||
| import std.string; // for format() and toStringz() | ||||
| import std.traits; // for ParameterTypeTuple!() | ||||
|  | ||||
| /* XXX: this assumes that libmpq is compiled with Large File Support on */ | ||||
| alias long off_t; | ||||
|  | ||||
| /* libmpq error return values */ | ||||
| const LIBMPQ_ERROR_OPEN			= -1;	/* open error on file. */ | ||||
| const LIBMPQ_ERROR_CLOSE		= -2;	/* close error on file. */ | ||||
| const LIBMPQ_ERROR_SEEK			= -3;	/* lseek error on file. */ | ||||
| const LIBMPQ_ERROR_READ			= -4;	/* read error on file. */ | ||||
| const LIBMPQ_ERROR_WRITE		= -5;	/* write error on file. */ | ||||
| const LIBMPQ_ERROR_MALLOC		= -6;	/* memory allocation error. */ | ||||
| const LIBMPQ_ERROR_FORMAT		= -7;	/* format errror. */ | ||||
| const LIBMPQ_ERROR_NOT_INITIALIZED	= -8;	/* init() wasn't called. */ | ||||
| const LIBMPQ_ERROR_SIZE			= -9;	/* buffer size is to small. */ | ||||
| const LIBMPQ_ERROR_EXIST		= -10;	/* file or block does not exist in archive. */ | ||||
| const LIBMPQ_ERROR_DECRYPT		= -11;	/* we don't know the decryption seed. */ | ||||
| const LIBMPQ_ERROR_UNPACK		= -12;	/* error on unpacking file. */ | ||||
|  | ||||
| /** libmpq internal meta-data for an archive */ | ||||
| extern struct mpq_archive_s; | ||||
|  | ||||
| extern(C) { | ||||
|  | ||||
| /* libmpq__generic information about library. */ | ||||
| char *libmpq__version(); | ||||
|  | ||||
| /* libmpq__generic mpq archive information. */ | ||||
| int libmpq__archive_open(mpq_archive_s **mpq_archive, char *mpq_filename, off_t archive_offset); | ||||
| int libmpq__archive_close(mpq_archive_s *mpq_archive); | ||||
| int libmpq__archive_packed_size(mpq_archive_s *mpq_archive, off_t *packed_size); | ||||
| int libmpq__archive_unpacked_size(mpq_archive_s *mpq_archive, off_t *unpacked_size); | ||||
| int libmpq__archive_offset(mpq_archive_s *mpq_archive, off_t *offset); | ||||
| int libmpq__archive_version(mpq_archive_s *mpq_archive, uint *version_); | ||||
| int libmpq__archive_files(mpq_archive_s *mpq_archive, uint *files); | ||||
|  | ||||
| /* libmpq__generic file processing functions. */ | ||||
| int libmpq__file_packed_size(mpq_archive_s *mpq_archive, uint file_number, off_t *packed_size); | ||||
| int libmpq__file_unpacked_size(mpq_archive_s *mpq_archive, uint file_number, off_t *unpacked_size); | ||||
| int libmpq__file_offset(mpq_archive_s *mpq_archive, uint file_number, off_t *offset); | ||||
| int libmpq__file_blocks(mpq_archive_s *mpq_archive, uint file_number, uint *blocks); | ||||
| int libmpq__file_encrypted(mpq_archive_s *mpq_archive, uint file_number, uint *encrypted); | ||||
| int libmpq__file_compressed(mpq_archive_s *mpq_archive, uint file_number, uint *compressed); | ||||
| int libmpq__file_imploded(mpq_archive_s *mpq_archive, uint file_number, uint *imploded); | ||||
| int libmpq__file_number(mpq_archive_s *mpq_archive, char *filename, uint *number); | ||||
| int libmpq__file_read(mpq_archive_s *mpq_archive, uint file_number, ubyte *out_buf, off_t out_size, off_t *transferred); | ||||
|  | ||||
| /* libmpq__generic block processing functions. */ | ||||
| int libmpq__block_open_offset(mpq_archive_s *mpq_archive, uint file_number); | ||||
| int libmpq__block_close_offset(mpq_archive_s *mpq_archive, uint file_number); | ||||
| int libmpq__block_unpacked_size(mpq_archive_s *mpq_archive, uint file_number, uint block_number, off_t *unpacked_size); | ||||
| int libmpq__block_read(mpq_archive_s *mpq_archive, uint file_number, uint block_number, ubyte *out_buf, off_t out_size, off_t *transferred); | ||||
|  | ||||
| } | ||||
|  | ||||
|  | ||||
| /** exception class for failed libmpq calls */ | ||||
| class MPQException : Exception { | ||||
| 	const string[] Errors = [ | ||||
| 		"unknown error", | ||||
| 		"open error on file", | ||||
| 		"close error on file", | ||||
| 		"lseek error on file", | ||||
| 		"read error on file", | ||||
| 		"write error on file", | ||||
| 		"memory allocation error", | ||||
| 		"format errror", | ||||
| 		"init() wasn't called", | ||||
| 		"buffer size is to small", | ||||
| 		"file or block does not exist in archive", | ||||
| 		"we don't know the decryption seed", | ||||
| 		"error on unpacking file"]; | ||||
|  | ||||
| 	public int errno; | ||||
| 	this(char[] fnname = "unknown_function", int errno = 0) { | ||||
|  | ||||
| 		this.errno = errno; | ||||
| 		if (-errno >= Errors.length) | ||||
| 			errno = 0; | ||||
| 		super(std.string.format("Error in %s(): %s (%d)", | ||||
| 					fnname, Errors[-errno], errno)); | ||||
| 	} | ||||
| } | ||||
|  | ||||
|  | ||||
| /** template to wrap function calls and throw exceptions in case of error | ||||
|  * | ||||
|  * thanks for the idea to while(nan) blog, | ||||
|  * http://while-nan.blogspot.com/2007/06/wrapping-functions-for-fun-and-profit.html | ||||
|  * | ||||
|  * use: MPQ_CHECKERR(libmpq__archive_open)(&m, "foo.mpq", -1); | ||||
|  *   returns the retval of archive_open on success; | ||||
|  *   throws an MPQException on failure. | ||||
|  * | ||||
|  * @param Fn libmpq__function reference | ||||
|  * @param args libmpq__function parameters | ||||
|  * @return return value of libmpq__function on success | ||||
|  * @throw MPQException on error | ||||
|  */ | ||||
| int MPQ_CHECKERR(alias Fn)(ParameterTypeTuple!(Fn) args) | ||||
| { | ||||
| 	int result = Fn(args); | ||||
| 	if (result < 0) { | ||||
| 		/* XXX: relying on non-specified stringof() behaviour */ | ||||
| 		throw new MPQException((&Fn).stringof[2..$], result); | ||||
| 	} | ||||
|         return result; | ||||
| } | ||||
|  | ||||
|  | ||||
| /** mixin alias to wrap library functions into MPQ_CHECKERR. | ||||
|  * | ||||
|  * alias mpq.func_name(...) to MPQ_CHECKERR(libmpq__func_name)(...) | ||||
|  * @param func_name name of the function to be wrapped | ||||
|  */ | ||||
| template MPQ_FUNC(char[] func_name) { | ||||
| 	const char[] MPQ_FUNC = "alias MPQ_CHECKERR!(libmpq__" ~ func_name ~ ") " ~ func_name ~ ";"; | ||||
| } | ||||
|  | ||||
| alias libmpq__version libversion; /* must be direct alias because it returns char*, not error int */ | ||||
| mixin(MPQ_FUNC!("archive_open")); | ||||
| mixin(MPQ_FUNC!("archive_close")); | ||||
| mixin(MPQ_FUNC!("archive_packed_size")); | ||||
| mixin(MPQ_FUNC!("archive_unpacked_size")); | ||||
| mixin(MPQ_FUNC!("archive_offset")); | ||||
| mixin(MPQ_FUNC!("archive_version")); | ||||
| mixin(MPQ_FUNC!("archive_files")); | ||||
| mixin(MPQ_FUNC!("file_packed_size")); | ||||
| mixin(MPQ_FUNC!("file_unpacked_size")); | ||||
| mixin(MPQ_FUNC!("file_offset")); | ||||
| mixin(MPQ_FUNC!("file_blocks")); | ||||
| mixin(MPQ_FUNC!("file_encrypted")); | ||||
| mixin(MPQ_FUNC!("file_compressed")); | ||||
| mixin(MPQ_FUNC!("file_imploded")); | ||||
| mixin(MPQ_FUNC!("file_number")); | ||||
| mixin(MPQ_FUNC!("file_read")); | ||||
| mixin(MPQ_FUNC!("block_open_offset")); | ||||
| mixin(MPQ_FUNC!("block_close_offset")); | ||||
| mixin(MPQ_FUNC!("block_unpacked_size")); | ||||
| mixin(MPQ_FUNC!("block_read")); | ||||
|  | ||||
| /** getter function named name for returning archive_* single values: | ||||
|  * | ||||
|  *   <type> Archive.<name>() { return libmpq__archive_<name>() } | ||||
|  * | ||||
|  * @param type return type for the original function reference | ||||
|  * @param name name of the original function | ||||
|  * @param name2 name for the prototype (defaults to name, used for "version") | ||||
|  * @return getter function mixin | ||||
|  */ | ||||
| template MPQ_A_GET(char[] type, char[] name, char[] name2 = name) { | ||||
| 	const char[] MPQ_A_GET = type ~ " " ~ name2 ~ "() { " ~ | ||||
| 			type ~ " ret; " ~ | ||||
| 			"archive_" ~ name ~ "(m, &ret); return ret;" ~ | ||||
| 		"}"; | ||||
| } | ||||
|  | ||||
| /** wrapper class for an MPQ Archive | ||||
|  * | ||||
|  * syntax: auto a = new mpq.Archive("somefile.mpq"); | ||||
|  */ | ||||
| class Archive { | ||||
| 	mpq_archive_s *m; | ||||
| 	File listfile; | ||||
| 	char[][] listfiledata; | ||||
|  | ||||
| 	this(char[] archivename, off_t offset = -1) { | ||||
| 		archive_open(&m, toStringz(archivename), offset); | ||||
| 	} | ||||
|  | ||||
| 	mixin(MPQ_A_GET!("off_t", "packed_size")); | ||||
| 	mixin(MPQ_A_GET!("off_t", "unpacked_size")); | ||||
| 	mixin(MPQ_A_GET!("off_t", "offset")); | ||||
| 	mixin(MPQ_A_GET!("uint", "version", "version_")); | ||||
| 	mixin(MPQ_A_GET!("uint", "files")); | ||||
|  | ||||
| 	~this() { | ||||
| 		archive_close(m); | ||||
| 	} | ||||
|  | ||||
| 	mpq_archive_s* archive() { | ||||
| 		return m; | ||||
| 	} | ||||
|  | ||||
| 	File opIndex(char[] fname) { | ||||
| 		return new File(this, fname); | ||||
| 	} | ||||
| 	File opIndex(int fno) { | ||||
| 		return new File(this, fno); | ||||
| 	} | ||||
|  | ||||
| 	char[][] filelist() { | ||||
| 		try { | ||||
| 			if (!listfile) { | ||||
| 				listfile = this["(listfile)"]; | ||||
| 				listfiledata = (cast(char[])listfile.read()).splitlines(); | ||||
| 			} | ||||
| 			return listfiledata; | ||||
| 		} catch (MPQException e) { | ||||
| 			return []; | ||||
| 		} | ||||
| 	} | ||||
|  | ||||
| 	/+uint filenumber(char[] filename) { | ||||
| 		try { | ||||
| 			if (!listfile) { | ||||
| 				listfile = this["(listfile)"]; | ||||
| 				listfiledata = (cast(char[])listfile.read()).splitlines(); | ||||
| 			} | ||||
| 			return listfiledata; | ||||
| 		} catch (MPQException e) { | ||||
| 			return []; | ||||
| 		} | ||||
| 	}+/ | ||||
|  | ||||
| } | ||||
|  | ||||
|  | ||||
| /** getter function named name for returning file_* single values: | ||||
|  * | ||||
|  *   <type> File.<name>() { return libmpq__file_<name>() } | ||||
|  * | ||||
|  * @param type return type for the original function reference | ||||
|  * @param name name of the original function | ||||
|  * @param name2 name for the prototype (defaults to name, used for "version") | ||||
|  * @return getter function mixin | ||||
|  */ | ||||
| template MPQ_F_GET(char[] type, char[] name, char[] name2 = name) { | ||||
| 	const char[] MPQ_F_GET = type ~ " " ~ name2 ~ "() { " ~ | ||||
| 			type ~ " ret; " ~ | ||||
| 			"file_" ~ name ~ "(am, fileno, &ret); " ~ | ||||
| 			"return ret;" ~ | ||||
| 		"}"; | ||||
| } | ||||
|  | ||||
| /** wrapper class for a single file in an MPQ Archive | ||||
|  * | ||||
|  * syntax: | ||||
|  *    auto a = new mpq.Archive("somefile.mpq"); | ||||
|  *    auto f = a["(listfile)"]; | ||||
|  *    auto f2 = a[0]; | ||||
|  *    auto f3 = new File(a, "(listfile)"); | ||||
|  */ | ||||
| class File { | ||||
| 	Archive a; | ||||
| 	mpq_archive_s* am; | ||||
| 	char[] filename; | ||||
| 	uint fileno; | ||||
|  | ||||
| 	this(Archive a, int fileno) { | ||||
| 		this.a = a; | ||||
| 		this.am = a.archive(); | ||||
| 		if (fileno >= a.files) { | ||||
| 			throw new MPQException(format("File(%d)", fileno), | ||||
| 				LIBMPQ_ERROR_EXIST); | ||||
| 		} | ||||
| 		this.filename = format("file%04d.xxx", fileno); | ||||
| 		this.fileno = fileno; | ||||
| 	} | ||||
|  | ||||
| 	this(Archive a, char[] filename) { | ||||
| 		this.a = a; | ||||
| 		this.am = a.archive(); | ||||
| 		this.filename = filename; | ||||
| 		/* this line will throw an exception when the file is not there */ | ||||
| 		mpq.file_number(am, toStringz(filename), &this.fileno); | ||||
| 	} | ||||
|  | ||||
| 	mixin(MPQ_F_GET!("off_t", "packed_size")); | ||||
| 	mixin(MPQ_F_GET!("off_t", "unpacked_size")); | ||||
| 	mixin(MPQ_F_GET!("off_t", "offset")); | ||||
| 	mixin(MPQ_F_GET!("uint", "blocks")); | ||||
| 	mixin(MPQ_F_GET!("uint", "encrypted")); | ||||
| 	mixin(MPQ_F_GET!("uint", "compressed")); | ||||
| 	mixin(MPQ_F_GET!("uint", "imploded")); | ||||
|  | ||||
| 	uint no() {	return fileno; } | ||||
| 	char[] name() {	return filename; } | ||||
|  | ||||
| 	ubyte[] read() { | ||||
| 		ubyte[] content; | ||||
| 		content.length = this.unpacked_size(); | ||||
| 		off_t trans; | ||||
| 		mpq.file_read(am, fileno, content.ptr, content.length, &trans); | ||||
| 		content.length = trans; | ||||
| 		return content; | ||||
| 	} | ||||
| } | ||||
							
								
								
									
										443
									
								
								samples/DIGITAL Command Language/fis_gtm_kitinstal.com
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										443
									
								
								samples/DIGITAL Command Language/fis_gtm_kitinstal.com
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,443 @@ | ||||
| $!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! | ||||
| $!								! | ||||
| $!	Copyright 2001, 2011 Fidelity Information Services, Inc	! | ||||
| $!								! | ||||
| $!	This source code contains the intellectual property	! | ||||
| $!	of its copyright holder(s), and is made available	! | ||||
| $!	under a license.  If you do not know the terms of	! | ||||
| $!	the license, please stop and do not read further.	! | ||||
| $!								! | ||||
| $!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! | ||||
| $! | ||||
| $! | ||||
| $!	KITINSTAL.COM PROCEDURE FOR THE GT.M PRODUCT | ||||
| $! | ||||
| $ ON CONTROL_Y THEN VMI$CALLBACK CONTROL_Y | ||||
| $! ON WARNING THEN EXIT $STATUS !! allow warning errors for INSTALL REPLACE | ||||
| $ IF P1 .EQS. "VMI$_INSTALL" THEN GOTO INSTALL | ||||
| $ IF P1 .EQS. "VMI$_POSTINSTALL" THEN GOTO POSTINSTALL | ||||
| $ IF P1 .EQS. "VMI$_IVP" THEN GOTO IVP | ||||
| $ EXIT VMI$_UNSUPPORTED | ||||
| $! | ||||
| $INSTALL: | ||||
| $ TYPE SYS$INPUT | ||||
|  | ||||
|   GT.M  (c)  COPYRIGHT 1985 - 2000  by  Sanchez Computer Associates | ||||
|                             ALL RIGHTS RESERVED | ||||
|  | ||||
| $!  the following 2 lines must be maintained | ||||
| $ GTM$VMS_VERSION :== 072	! Minimum VMS version required | ||||
| $ ALPHA = (f$getsyi("arch_name") .eqs. "Alpha") | ||||
| $ IF ALPHA | ||||
| $  THEN | ||||
| $   GTM$DISK_SPACE == 28000	! Minumum disk space on system disk required | ||||
| $  ELSE | ||||
| $   GTM$DISK_SPACE == 16000	! Minumum disk space on system disk required | ||||
| $ ENDIF | ||||
| $ IF F$ELEMENT(0,",",VMI$VMS_VERSION) .EQS. "RELEASED" | ||||
| $  THEN | ||||
| $   GTM$VMS_IS == F$ELEMENT(1,",",VMI$VMS_VERSION) | ||||
| $   IF GTM$VMS_IS .LTS. GTM$VMS_VERSION | ||||
| $    THEN | ||||
| $     VMI$CALLBACK MESSAGE E VMSMISMATCH "This GT.M kit requires an existing VMS''GTM$VMS_VERSION' system." | ||||
| $     EXIT VMI$_FAILURE | ||||
| $   ENDIF | ||||
| $  ELSE | ||||
| $   GTM$VMS_IS :== | ||||
| $   WRITE SYS$OUTPUT "  No VMS version checking performed for field test versions." | ||||
| $ ENDIF | ||||
| $ IF (GTM$VMS_IS .GES. "052") THEN T1 = F$VERIFY(VMI$KIT_DEBUG) | ||||
| $ VMI$CALLBACK CHECK_NET_UTILIZATION GTM$ROOM 'GTM$DISK_SPACE' | ||||
| $ IF .NOT. GTM$ROOM | ||||
| $  THEN | ||||
| $   VMI$CALLBACK MESSAGE E NOSPACE "There is not enough disk space -- GT.M needs ''GTM$DISK_SPACE' blocks." | ||||
| $   EXIT VMI$_FAILURE | ||||
| $ ENDIF | ||||
| $!  setup default answers | ||||
| $ GTM$DOPURGE :== YES | ||||
| $ GTM$RUN_IVP :== YES | ||||
| $ GTM$STD_CNF :== YES | ||||
| $ GTM$DST_OWN :== SYSTEM | ||||
| $ IF F$IDENTIFIER(GTM$DST_OWN,"NAME_TO_NUMBER") .EQ. 0 THEN GTM$DST_OWN :== 1,4 | ||||
| $ GTM$SYS_DST :== YES | ||||
| $ GTM$DST_DIR :== GTM_DIST | ||||
| $ GTM$DST_CRE == GTM$DST_DIR | ||||
| $ GTM$DST_DEV :== | ||||
| $ GTM$STARTDB :== YES | ||||
| $ GTM$MGR_COM :== YES | ||||
| $ GTM$HLP_DIR :== NO | ||||
| $ GTM$DEF_DCL :== YES | ||||
| $ GTM$DEF_SYS :== YES | ||||
| $ GTM$LNK_LOG :== YES | ||||
| $ GTM$INSTALL :== YES | ||||
| $ GTM$DEF_GLD :== YES | ||||
| $ GTM$GBL_DIR :== MUMPS.GLD | ||||
| $ GTM$DEF_RTN :== YES | ||||
| $ GTM$RTN_DIR :== [],GTM$DIST: | ||||
| $ GTM$PCT_RTN :== YES | ||||
| $ VMI$CALLBACK ASK GTM$DOPURGE "Do you want to purge files replaced by this installation" 'GTM$DOPURGE' B - | ||||
|   "@VMI$KWD:GTMKITHLP HELP_PURGE" | ||||
| $ IF .NOT. GTM$DOPURGE THEN VMI$CALLBACK SET PURGE NO | ||||
| $ VMI$CALLBACK ASK GTM$STD_CNF "Do you want the standard GT.M configuration (performs INSTALL)" 'GTM$STD_CNF' B - | ||||
|   "@VMI$KWD:GTMKITHLP HELP_STD_CNF" | ||||
| $ IF GTM$STD_CNF | ||||
| $  THEN | ||||
| $   GTM$SYS_DST == 1 | ||||
| $   GTM$STARTDB == 1 | ||||
| $   GTM$MGR_COM == 1 | ||||
| $   GTM$HLP_DIR == 0 | ||||
| $   GTM$DEF_DCL == 1 | ||||
| $   GTM$DEF_SYS == 1 | ||||
| $   GTM$INSTALL == 1 | ||||
| $   GTM$LNK_LOG == 1 | ||||
| $   GTM$INSTALL == 1 | ||||
| $   GTM$DEF_GLD == 1 | ||||
| $   GTM$DEF_RTN == 1 | ||||
| $   GTM$PCT_RTN == 1 | ||||
| $   GTM$DST_LOG :== SYS$COMMON:['GTM$DST_DIR'] | ||||
| $   GTM$DIR_TYPE :== COMMON | ||||
| $  ELSE ! Not standard configuration | ||||
| $   VMI$CALLBACK ASK GTM$DST_OWN "What UIC should own the GT.M distribution" 'GTM$DST_OWN' S "@VMI$KWD:GTMKITHLP HELP_DST_OWN" | ||||
| $   GTM$DST_OWN == GTM$DST_OWN - "[" - "]" | ||||
| $   VMI$CALLBACK ASK GTM$SYS_DST "Do you want the GT.M distribution to go into a System Directory" 'GTM$SYS_DST' B - | ||||
|     "@VMI$KWD:GTMKITHLP HELP_SYS_DST" | ||||
| $   IF GTM$SYS_DST | ||||
| $    THEN | ||||
| $     VMI$CALLBACK ASK GTM$DST_DIR "In what System Directory do you want to place GT.M" 'GTM$DST_DIR' S - | ||||
|       "@VMI$KWD:GTMKITHLP HELP_SYS_DIR" | ||||
| $     GTM$DST_DIR == GTM$DST_DIR - "[" - "]" | ||||
| $     GTM$DST_CRE == GTM$DST_DIR | ||||
| $     GTM$DST_LOG :== SYS$COMMON:['GTM$DST_DIR'] | ||||
| $     GTM$DIR_TYPE :== COMMON | ||||
| $    ELSE ! Not system disk | ||||
| $     VMI$CALLBACK ASK GTM$DST_DEV "On which device do you want to place GT.M" "''GTM$DST_DEV'" S "@VMI$KWD:GTMKITHLP HELP_DST_DEV" | ||||
| $     VMI$CALLBACK ASK GTM$DST_DIR "In what directory on that device do you want to place GT.M" 'GTM$DST_DIR' S - | ||||
|       "@VMI$KWD:GTMKITHLP HELP_DST_DIR" | ||||
| $     GTM$DST_DEV == GTM$DST_DEV - ":" | ||||
| $     GTM$DST_DIR == GTM$DST_DIR - "[" - "]" | ||||
| $     GTM$DST_LOG :== 'GTM$DST_DEV':['GTM$DST_DIR'] | ||||
| $     GTM$DST_CRE == GTM$DST_LOG | ||||
| $     GTM$DIR_TYPE :== USER | ||||
| $   ENDIF ! system disk | ||||
| $   VMI$CALLBACK ASK GTM$STARTDB "Do you want GTMSTART.COM in the startup database" 'GTM$STARTDB' B - | ||||
|     "@VMI$KWD:GTMKITHLP HELP_STARTDB" | ||||
| $   IF .NOT. GTM$STARTDB | ||||
| $    THEN | ||||
| $     VMI$CALLBACK ASK GTM$MGR_COM "Do you want the GT.M .COM files in SYS$MANAGER" 'GTM$MGR_COM' B - | ||||
|       "@VMI$KWD:GTMKITHLP HELP_MGR_COM" | ||||
| $   ENDIF | ||||
| $   VMI$CALLBACK ASK GTM$HLP_DIR "Do you want the GT.M help files in SYS$HELP" 'GTM$HLP_DIR' B "@VMI$KWD:GTMKITHLP HELP_HLP_DIR" | ||||
| $   VMI$CALLBACK ASK GTM$DEF_DCL "Do you want to define GT.M commands to the system" 'GTM$DEF_DCL' B - | ||||
|     "@VMI$KWD:GTMKITHLP HELP_DEF_DCL" | ||||
| $   VMI$CALLBACK ASK GTM$DEF_SYS "Do you want to define GT.M logical names in the System Table" 'GTM$DEF_SYS' B - | ||||
|     "@VMI$KWD:GTMKITHLP HELP_DEF_SYS" | ||||
| $   VMI$CALLBACK ASK GTM$LNK_LOG "Do you want to define the LNK$LIBRARY logical names" 'GTM$LNK_LOG' B - | ||||
|     "@VMI$KWD:GTMKITHLP HELP_LNK_LOG" | ||||
| $   VMI$CALLBACK ASK GTM$RUN_IVP "Do you want to run the IVP (performs INSTALL)" 'GTM$RUN_IVP' B - | ||||
|     "@VMI$KWD:GTMKITHLP HELP_RUN_IVP" | ||||
| $   IF GTM$RUN_IVP | ||||
| $    THEN | ||||
| $     GTM$PCT_RTN == 1 | ||||
| $    ELSE | ||||
| $     VMI$CALLBACK ASK GTM$PCT_RTN "Do you want to compile the GT.M percent routines (performs INSTALL)" 'GTM$PCT_RTN' B - | ||||
|       "@VMI$KWD:GTMKITHLP HELP_PCT_RTN" | ||||
| $   ENDIF | ||||
| $   IF (GTM$RUN_IVP .OR. GTM$PCT_RTN) | ||||
| $    THEN | ||||
| $     GTM$INSTALL == 1 | ||||
| $    ELSE | ||||
| $     VMI$CALLBACK ASK GTM$INSTALL "Do you want to INSTALL the GT.M shareable images now" 'GTM$INSTALL' B - | ||||
|       "@VMI$KWD:GTMKITHLP HELP_INSTALL" | ||||
| $   ENDIF | ||||
| $   VMI$CALLBACK ASK GTM$DEF_RTN "Do you want to have a default definition for GTM$ROUTINES" 'GTM$DEF_RTN' B - | ||||
|     "@VMI$KWD:GTMKITHLP HELP_DEF_RTN" | ||||
| $   IF GTM$DEF_RTN | ||||
| $    THEN | ||||
| $     VMI$CALLBACK ASK GTM$RTN_DIR "What is the search specification for GTM$ROUTINES" 'GTM$RTN_DIR' S - | ||||
|       "@VMI$KWD:GTMKITHLP HELP_RTN_DIR" | ||||
| $   ENDIF | ||||
| $   VMI$CALLBACK ASK GTM$DEF_GLD "Do you want to have a default definition for GTM$GBLDIR" 'GTM$DEF_GLD' B - | ||||
|     "@VMI$KWD:GTMKITHLP HELP_DEF_GLD" | ||||
| $   IF GTM$DEF_GLD | ||||
| $    THEN | ||||
| $     VMI$CALLBACK ASK GTM$GBL_DIR "What is the file specification for GTM$GBLDIR" 'GTM$GBL_DIR' S - | ||||
|       "@VMI$KWD:GTMKITHLP HELP_GBL_DIR" | ||||
| $   ENDIF | ||||
| $ ENDIF ! standard configuration | ||||
| $!  tell them what's happening | ||||
| $ IF GTM$MGR_COM | ||||
| $  THEN | ||||
| $   WRITE SYS$OUTPUT "  The following command files are created and copied to SYS$MANAGER:" | ||||
| $  ELSE | ||||
| $   WRITE SYS$OUTPUT "  The following command files are created:" | ||||
| $ ENDIF | ||||
| $ TYPE SYS$INPUT | ||||
|  | ||||
|         GTMINSTALL.COM | ||||
|         GTMLOGICALS.COM | ||||
|         GTMLOGIN.COM | ||||
|         GTMSTART.COM | ||||
|         GTMSTOP.COM | ||||
|  | ||||
|   Each file contains its own user documentation. | ||||
|  | ||||
|   All the questions have been asked.   Installation now proceeds  without your | ||||
|   manual intervention for about 10-15 minutes. | ||||
| $ IF GTM$RUN_IVP THEN WRITE SYS$OUTPUT "  Finally the Installation Verification Procedure tests the installation." | ||||
| $ WRITE SYS$OUTPUT "" | ||||
| $ VMI$CALLBACK CREATE_DIRECTORY 'GTM$DIR_TYPE' 'GTM$DST_CRE' "/OWNER_UIC=[''GTM$DST_OWN'] /PROTECTION=(WO:RE)" | ||||
| $ VMI$CALLBACK RESTORE_SAVESET B | ||||
| $ VMI$CALLBACK RESTORE_SAVESET C | ||||
| $ WRITE SYS$OUTPUT "" | ||||
| $ VMI$CALLBACK MESSAGE I CRECOM "Creating command files." | ||||
| $!  Create GTMINSTALL.COM | ||||
| $ OPEN /WRITE OUFILE VMI$KWD:GTMINSTALL.COM | ||||
| $ WRITE OUFILE "$!" | ||||
| $ WRITE OUFILE "$!	GTMINSTALL.COM installs GTMSECSHR and other GT.M images." | ||||
| $ WRITE OUFILE "$!      GTMSECSHR is a small protected image and must be installed." | ||||
| $ WRITE OUFILE "$!      GTMSHR is the run-time library and is installed for performance." | ||||
| $ WRITE OUFILE "$!      GTM$DMOD and MCOMPILE are small images frequently used in development." | ||||
| $ WRITE OUFILE "$!" | ||||
| $ WRITE OUFILE "$ INSTALL" | ||||
| $ WRITE OUFILE "REPLACE  /OPEN/SHARED/HEADER/PROTECTED	GTMSECSHR" | ||||
| $ WRITE OUFILE "REPLACE  /OPEN/SHARED/HEADER		GTMSHR" | ||||
| $ WRITE OUFILE "REPLACE  /OPEN/SHARED/HEADER		GTM$DMOD" | ||||
| $ WRITE OUFILE "REPLACE  /OPEN/SHARED/HEADER		MCOMPILE" | ||||
| $ WRITE OUFILE "$ EXIT" | ||||
| $ CLOSE OUFILE | ||||
| $!  Create GTMLOGICALS.COM | ||||
| $ GTM$HLP_LOG :== GTM$DIST | ||||
| $ IF GTM$HLP_DIR THEN GTM$HLP_LOG :== SYS$HELP | ||||
| $ OPEN /WRITE OUFILE VMI$KWD:GTMLOGICALS.COM | ||||
| $ WRITE OUFILE "$!" | ||||
| $ WRITE OUFILE "$!	GTMLOGICALS.COM defines the logical names required to use GT.M." | ||||
| $ WRITE OUFILE "$!	By default the definitions are placed in the PROCESS table." | ||||
| $ WRITE OUFILE "$!	Parameter 1, if supplied should be the name of a logical name table" | ||||
| $ WRITE OUFILE "$!	and/or the mode of definition." | ||||
| $ WRITE OUFILE "$!      Assignments in a ""permanent"" table reduce GT.M activation time." | ||||
| $ WRITE OUFILE "$!" | ||||
| $ IF GTM$LNK_LOG THEN WRITE OUFILE "$!	The LNK$LIBRARY names many require adjustment to your environment." | ||||
| $ IF GTM$DEF_GLD THEN WRITE OUFILE "$!	GTM$GBLDIR is defined to provide default access to a global directory." | ||||
| $ IF GTM$DEF_RTN THEN WRITE OUFILE "$!	GTM$ROUTINES is defined to provide access to the GT.M utilities." | ||||
| $ IF GTM$DEF_RTN THEN WRITE OUFILE "$!	You may wish to define a different structure for $ZROUTINES." | ||||
| $ WRITE OUFILE "$!" | ||||
| $ WRITE OUFILE "$ IF (P1 .NES. """") .AND. (F$EXTRACT(0,1,P1) .NES. ""/"") THEN P1 := /'P1" | ||||
| $ WRITE OUFILE "$ DEFINE 'P1' GTM$DIST		''GTM$DST_LOG'" | ||||
| $ IF GTM$DEF_GLD THEN WRITE OUFILE "$ DEFINE 'P1' GTM$GBLDIR	''GTM$GBL_DIR'" | ||||
| $ IF GTM$DEF_RTN THEN WRITE OUFILE "$ DEFINE 'P1' GTM$ROUTINES	""''GTM$RTN_DIR'""" | ||||
| $ WRITE OUFILE "$ DEFINE 'P1' GTM$HELP		''GTM$HLP_LOG'" | ||||
| $ WRITE OUFILE "$ DEFINE 'P1' GTMSHR		GTM$DIST:GTMSHR.EXE" | ||||
| $ WRITE OUFILE "$ DEFINE 'P1' GTMSECSHR		GTM$DIST:GTMSECSHR.EXE" | ||||
| $ WRITE OUFILE "$ DEFINE 'P1' GTM$DMOD		GTM$DIST:GTM$DMOD.EXE" | ||||
| $ WRITE OUFILE "$ DEFINE 'P1' MCOMPILE		GTM$DIST:MCOMPILE.EXE" | ||||
| $ IF GTM$LNK_LOG | ||||
| $  THEN | ||||
| $   N1 = 0 | ||||
| $   DN = 0 | ||||
| $   T1 = F$TRNLNM("LNK$LIBRARY") | ||||
| $   IF  (T1 .EQS. "") .OR. (F$LOCATE("GTMLIB",T1) .NE. F$LENGTH(T1)) .OR. (F$LOCATE("GTMSHR",T1) .NE. F$LENGTH(T1)) | ||||
| $    THEN | ||||
| $     WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY	GTM$DIST:GTMLIB.OLB" | ||||
| $     DN = 1 | ||||
| $    ELSE ! lnk$library is in use | ||||
| $LNK_LOOP: | ||||
| $     N1 = N1 + 1 | ||||
| $     T1 = F$TRNLNM("LNK$LIBRARY_''N1'") | ||||
| $     IF  (T1 .EQS. "") .OR. (F$LOCATE("GTMLIB",T1) .NE. F$LENGTH(T1)) .OR. (F$LOCATE("GTMSHR",T1) .NE. F$LENGTH(T1)) | ||||
| $      THEN | ||||
| $       WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY_''N1'	GTM$DIST:GTMLIB.OLB" | ||||
| $       DN = 1 | ||||
| $     ENDIF | ||||
| $     IF  (.NOT. DN) .AND. (N1 .LT. 998)  THEN  GOTO LNK_LOOP | ||||
| $   ENDIF ! gtmlib handling | ||||
| $   IF  DN ! placed gtmlib | ||||
| $    THEN | ||||
| $     N1 = N1 + 1 | ||||
| $     WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY_''N1'	GTM$DIST:GTMSHR.OLB" | ||||
| $    ELSE | ||||
| $     VMI$CALLBACK MESSAGE I NOLNKLOG "No LNK$LIBRARY logical names available" | ||||
| $   ENDIF | ||||
| $ ENDIF ! setting up LNK$LIBRARYs | ||||
| $ WRITE OUFILE "$ EXIT" | ||||
| $ CLOSE OUFILE | ||||
| $!  Create GTMLOGIN.COM | ||||
| $ OPEN /WRITE OUFILE VMI$KWD:GTMLOGIN.COM | ||||
| $ WRITE OUFILE "$!" | ||||
| $ WRITE OUFILE "$!	GTMLOGIN.COM performs process specific setup for GT.M." | ||||
| $ WRITE OUFILE "$!	It calls GTMLOGICALS.COM if the logical names are not" | ||||
| $ WRITE OUFILE "$!      in the SYSTEM table." | ||||
| $ WRITE OUFILE "$!	It defines symbols to access GT.M images." | ||||
| $ WRITE OUFILE "$!	It defines GT.M commands locally if they are not defined to the system." | ||||
| $ WRITE OUFILE "$!      When the command and logical names are not defined on a process level," | ||||
| $ WRITE OUFILE "$!      a production user may save start-up time by not using GTMLOGIN." | ||||
| $ WRITE OUFILE "$!      CCE is infrequently used, but may be defined as a foreign command." | ||||
| $ WRITE OUFILE "$!" | ||||
| $ IF .NOT. GTM$DEF_SYS | ||||
| $  THEN | ||||
| $   WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")" | ||||
| $   WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")" | ||||
| $   WRITE OUFILE "$ @'dir'GTMLOGICALS.COM" | ||||
| $ ENDIF | ||||
| $ IF .NOT. GTM$DEF_DCL THEN WRITE OUFILE "$ SET COMMAND GTM$DIST:GTMCOMMANDS.CLD" | ||||
| $ WRITE OUFILE "$ DSE :== $GTM$DIST:DSE.EXE	! Database System Editor" | ||||
| $ WRITE OUFILE "$ GDE :== $GTM$DIST:GDE.EXE	! Global Directory Editor" | ||||
| $ WRITE OUFILE "$ GTM :== MUMPS/DIRECT		! Direct Mode MUMPS" | ||||
| $ WRITE OUFILE "$ LKE :== $GTM$DIST:LKE.EXE	! Lock Editor" | ||||
| $ WRITE OUFILE "$ MUPI*P :== $GTM$DIST:MUPIP.EXE	! MUMPS Peripheral Interchange Program" | ||||
| $ WRITE OUFILE "$ EXIT" | ||||
| $ WRITE OUFILE "$ CCE :== $GTM$DIST:CCE.EXE	! GT.CX Operator Interface Program" | ||||
| $ WRITE OUFILE "$ EXIT" | ||||
| $ CLOSE OUFILE | ||||
| $!  Create GTMSTART.COM | ||||
| $ OPEN /WRITE OUFILE VMI$KWD:GTMSTART.COM | ||||
| $ WRITE OUFILE "$!" | ||||
| $ WRITE OUFILE "$!	GTMSTART.COM should be placed in the VMS startup database." | ||||
| $ WRITE OUFILE "$!	It invokes GTMLOGICALS.COM and GTMINSTALL.COM." | ||||
| $ WRITE OUFILE "$!" | ||||
| $ WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")" | ||||
| $ WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")" | ||||
| $ IF GTM$DEF_SYS THEN WRITE OUFILE "$ IF P1 .EQS. """" .OR. (P1 .EQS. ""FULL"") THEN P1 := SYSTEM/EXEC" | ||||
| $ WRITE OUFILE "$ @'dir'GTMLOGICALS 'P1'" | ||||
| $ WRITE OUFILE "$ @'dir'GTMINSTALL" | ||||
| $ WRITE OUFILE "$ EXIT" | ||||
| $ CLOSE OUFILE | ||||
| $!  Create GTMSTOP.COM | ||||
| $ OPEN /WRITE OUFILE VMI$KWD:GTMSTOP.COM | ||||
| $ WRITE OUFILE "$!" | ||||
| $ WRITE OUFILE "$!	GTMSTOP.COM stops all the active GT.M processes and does a RUNDOWN." | ||||
| $ WRITE OUFILE "$!	Place an invocation or copy of this procedure in the site specific" | ||||
| $ WRITE OUFILE "$!	 shutdown: SYS$MANAGER:SYSHUTDWN to ensure all GT.M databases are" | ||||
| $ WRITE OUFILE "$!	 properly closed before VMS terminates.  GTMSTOP should follow" | ||||
| $ WRITE OUFILE "$!	 GTCMSTOP and precede GTCXSTOP, if they are used." | ||||
| $ WRITE OUFILE "$!	If GTMSTOP is not intended to disable subsequent use of GT.M," | ||||
| $ WRITE OUFILE "$!	 add a comment (!) before the INSTALL REMOVE GTMSECSHR." | ||||
| $ WRITE OUFILE "$!" | ||||
| $ IF .NOT. GTM$DEF_SYS | ||||
| $  THEN | ||||
| $   WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")" | ||||
| $   WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")" | ||||
| $   WRITE OUFILE "$ @'dir'GTMLOGICALS.COM" | ||||
| $ ENDIF | ||||
| $ WRITE OUFILE "$ MUPIP := $GTM$DIST:MUPIP.EXE" | ||||
| $ WRITE OUFILE "$ STOP := $GTM$DIST:GTM$STOP" | ||||
| $ WRITE OUFILE "$ STOP 'P1'" | ||||
| $ WRITE OUFILE "$ MUPIP RUNDOWN" | ||||
| $ WRITE OUFILE "$ INSTALL REMOVE GTMSECSHR" | ||||
| $ WRITE OUFILE "$ EXIT" | ||||
| $ IF GTM$DEF_SYS THEN WRITE OUFILE "$ IF P2 .EQS. """" THEN P2 := /SYSTEM/EXEC" | ||||
| $ WRITE OUFILE "$ DEASSIGN 'P2' GTMSECSHR" | ||||
| $ CLOSE OUFILE | ||||
| $ VMI$CALLBACK MESSAGE I PREINS "Preparing files for installation." | ||||
| $!  GTMFILES.KIT must be maintained as kit contents change | ||||
| $ GTM$HLP_LOG == GTM$DST_LOG | ||||
| $ IF GTM$HLP_DIR THEN GTM$HLP_LOG :== VMI$ROOT:[SYSHLP] | ||||
| $ OPEN /WRITE OUFILE VMI$KWD:GTMFILES.KIT | ||||
| $ IF GTM$MGR_COM | ||||
| $  THEN | ||||
| $   WRITE OUFILE "GTM$ GTMINSTALL.COM VMI$ROOT:[SYSMGR] C" | ||||
| $   WRITE OUFILE "GTM$ GTMLOGICALS.COM VMI$ROOT:[SYSMGR] C" | ||||
| $   WRITE OUFILE "GTM$ GTMLOGIN.COM VMI$ROOT:[SYSMGR] C" | ||||
| $   WRITE OUFILE "GTM$ GTMSTART.COM VMI$ROOT:[SYSMGR] C" | ||||
| $   WRITE OUFILE "GTM$ GTMSTOP.COM VMI$ROOT:[SYSMGR] C" | ||||
| $ ENDIF | ||||
| $ WRITE OUFILE "GTM$ GTMINSTALL.COM ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMLOGICALS.COM ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMLOGIN.COM ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMSTART.COM ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMSTOP.COM ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ DSE.HLB ''GTM$HLP_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GDE.HLB ''GTM$HLP_LOG'" | ||||
| $ WRITE OUFILE "GTM$ LKE.HLB ''GTM$HLP_LOG'" | ||||
| $ WRITE OUFILE "GTM$ MUMPS.HLB ''GTM$HLP_LOG'" | ||||
| $ WRITE OUFILE "GTM$ MUPIP.HLB ''GTM$HLP_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMLIB.OLB ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMSHR.OLB ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMZCALL.MLB ''GTM$DST_LOG'" | ||||
| $ IF ALPHA | ||||
| $  THEN | ||||
| $   WRITE OUFILE "GTM$ GTM$DEFAULTS.M64 ''GTM$DST_LOG'" | ||||
| $  ELSE | ||||
| $   WRITE OUFILE "GTM$ GTM$DEFAULTS.MAR ''GTM$DST_LOG'" | ||||
| $ ENDIF | ||||
| $ WRITE OUFILE "GTM$ GTM$CE.H ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMCOLLECT.OPT ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMCOMMANDS.CLD ''GTM$DST_LOG' C" | ||||
| $ WRITE OUFILE "GTM$ *.M ''GTM$DST_LOG'" | ||||
| $ CLOSE OUFILE | ||||
| $!  GTMIMAGES.KIT must be maintained as kit contents change | ||||
| $ OPEN /WRITE OUFILE VMI$KWD:GTMIMAGES.KIT | ||||
| $ WRITE OUFILE "GTM$ GTMSECSHR.EXE ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTMSHR.EXE ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ DSE.EXE ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GDE.EXE ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTM$DMOD.EXE ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ LKE.EXE ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ MCOMPILE.EXE ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ MUPIP.EXE ''GTM$DST_LOG'" | ||||
| $ WRITE OUFILE "GTM$ GTM$STOP.EXE ''GTM$DST_LOG'" | ||||
| $ CLOSE OUFILE | ||||
| $!  Provide with file.KITs | ||||
| $ VMI$CALLBACK PROVIDE_FILE "" VMI$KWD:GTMFILES.KIT "" T | ||||
| $ VMI$CALLBACK PROVIDE_IMAGE "" VMI$KWD:GTMIMAGES.KIT "" T | ||||
| $ VMI$CALLBACK MESSAGE I FININS "Finalizing the installation." | ||||
| $ IF GTM$DEF_DCL THEN VMI$CALLBACK PROVIDE_DCL_COMMAND GTMCOMMANDS.CLD | ||||
| $ IF GTM$STARTDB THEN VMI$CALLBACK MODIFY_STARTUP_DB ADD GTMSTART.COM LPMAIN | ||||
| $!  GTM$INSTALL is TRUE if GTM$RUN_IVP or GTM$PCT_RTN | ||||
| $ IF GTM$INSTALL THEN VMI$CALLBACK SET POSTINSTALL YES | ||||
| $ IF GTM$RUN_IVP THEN VMI$CALLBACK SET IVP YES | ||||
| $ EXIT VMI$_SUCCESS | ||||
| $! | ||||
| $POSTINSTALL: | ||||
| $ ON CONTROL_Y THEN EXIT VMI$_FAILURE | ||||
| $! remove MUPIP from command tables for change from V2.4 to V2.5 | ||||
| $ SET NOON | ||||
| $ DEFINE /USER_MODE SYS$OUTPUT NL: | ||||
| $ DEFINE /USER_MODE SYS$ERROR NL: | ||||
| $ SET COMMAND /TABLE=SYS$COMMON:[SYSLIB]DCLTABLES /OUTPUT=SYS$COMMON:[SYSLIB]DCLTABLES /DELETE=MUPIP | ||||
| $ DEFINE /USER_MODE SYS$OUTPUT NL: | ||||
| $ DEFINE /USER_MODE SYS$ERROR NL: | ||||
| $ SET COMMAND /DELETE=MUPIP | ||||
| $ SET ON | ||||
| $ IF GTM$MGR_COM | ||||
| $  THEN | ||||
| $   T1 := SYS$MANAGER: | ||||
| $  ELSE | ||||
| $   T1 = GTM$DST_LOG | ||||
| $ ENDIF | ||||
| $ @'T1'GTMSTART | ||||
| $ @'T1'GTMLOGIN | ||||
| $ ON CONTROL_Y THEN EXIT VMI$_FAILURE | ||||
| $ SET DEFAULT GTM$DIST | ||||
| $ T2 = F$ENVIRONMENT("PROTECTION") | ||||
| $ SET PROTECTION=(S=REWD,O=REWD,G=REWD,W=RE)/DEFAULT | ||||
| $ MUMPS GTM$DMOD.M | ||||
| $ IF GTM$LNK_LOG | ||||
| $  THEN | ||||
| $   T1 := | ||||
| $  ELSE | ||||
| $   T1 :=,GTMLIB.OLB/LIB,GTMSHR.OLB/LIB | ||||
| $ ENDIF | ||||
| $ LINK GTM$DMOD.OBJ/NOTRACE'T1 | ||||
| $ IF GTM$PCT_RTN | ||||
| $  THEN | ||||
| $   TYPE SYS$INPUT | ||||
|  | ||||
|   Compiling the GT.M percent (%) routines. | ||||
| $   MUMPS * | ||||
| $   IF GTM$DOPURGE THEN PURGE *.* | ||||
| $   SET DEFAULT VMI$KWD | ||||
| $ ENDIF ! percent routines | ||||
| $ SET PROTECTION=('T2')/DEFAULT | ||||
| $ EXIT VMI$_SUCCESS | ||||
| $! | ||||
| $IVP: | ||||
| $!	The real Installation Verification Procedure. | ||||
| $ TYPE SYS$INPUT | ||||
|  | ||||
|   GT.M  Installation Verification Procedure | ||||
|  | ||||
| $!	Extract the IVP .COM file from the text library. | ||||
| $ LIBRARIAN /EXTRACT=GTM$IVP /OUTPUT=GTM$IVP.COM	GTM$IVP.TLB | ||||
| $ @GTM$IVP | ||||
| $ EXIT $STATUS | ||||
| $! | ||||
							
								
								
									
										867
									
								
								samples/DIGITAL Command Language/ghostpdl_zlib_make_vms.com
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										867
									
								
								samples/DIGITAL Command Language/ghostpdl_zlib_make_vms.com
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,867 @@ | ||||
| $! make libz under VMS written by | ||||
| $! Martin P.J. Zinser | ||||
| $! | ||||
| $! In case of problems with the install you might contact me at | ||||
| $! zinser@zinser.no-ip.info(preferred) or | ||||
| $! martin.zinser@eurexchange.com (work) | ||||
| $! | ||||
| $! Make procedure history for Zlib | ||||
| $! | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! Version history | ||||
| $! 0.01 20060120 First version to receive a number | ||||
| $! 0.02 20061008 Adapt to new Makefile.in | ||||
| $! 0.03 20091224 Add support for large file check | ||||
| $! 0.04 20100110 Add new gzclose, gzlib, gzread, gzwrite | ||||
| $! 0.05 20100221 Exchange zlibdefs.h by zconf.h.in | ||||
| $! 0.06 20120111 Fix missing amiss_err, update zconf_h.in, fix new exmples | ||||
| $!               subdir path, update module search in makefile.in | ||||
| $! 0.07 20120115 Triggered by work done by Alexey Chupahin completly redesigned | ||||
| $!               shared image creation | ||||
| $! 0.08 20120219 Make it work on VAX again, pre-load missing symbols to shared | ||||
| $!               image | ||||
| $! 0.09 20120305 SMS.  P1 sets builder ("MMK", "MMS", " " (built-in)). | ||||
| $!               "" -> automatic, preference: MMK, MMS, built-in. | ||||
| $! | ||||
| $ on error then goto err_exit | ||||
| $! | ||||
| $ true  = 1 | ||||
| $ false = 0 | ||||
| $ tmpnam = "temp_" + f$getjpi("","pid") | ||||
| $ tt = tmpnam + ".txt" | ||||
| $ tc = tmpnam + ".c" | ||||
| $ th = tmpnam + ".h" | ||||
| $ define/nolog tconfig 'th' | ||||
| $ its_decc = false | ||||
| $ its_vaxc = false | ||||
| $ its_gnuc = false | ||||
| $ s_case   = False | ||||
| $! | ||||
| $! Setup variables holding "config" information | ||||
| $! | ||||
| $ Make    = "''p1'" | ||||
| $ name     = "Zlib" | ||||
| $ version  = "?.?.?" | ||||
| $ v_string = "ZLIB_VERSION" | ||||
| $ v_file   = "zlib.h" | ||||
| $ ccopt   = "/include = []" | ||||
| $ lopts   = "" | ||||
| $ dnsrl   = "" | ||||
| $ aconf_in_file = "zconf.h.in#zconf.h_in#zconf_h.in" | ||||
| $ conf_check_string = "" | ||||
| $ linkonly = false | ||||
| $ optfile  = name + ".opt" | ||||
| $ mapfile  = name + ".map" | ||||
| $ libdefs  = "" | ||||
| $ vax      = f$getsyi("HW_MODEL").lt.1024 | ||||
| $ axp      = f$getsyi("HW_MODEL").ge.1024 .and. f$getsyi("HW_MODEL").lt.4096 | ||||
| $ ia64     = f$getsyi("HW_MODEL").ge.4096 | ||||
| $! | ||||
| $! 2012-03-05 SMS. | ||||
| $! Why is this needed?  And if it is needed, why not simply ".not. vax"? | ||||
| $! | ||||
| $!!! if axp .or. ia64 then  set proc/parse=extended | ||||
| $! | ||||
| $ whoami = f$parse(f$environment("Procedure"),,,,"NO_CONCEAL") | ||||
| $ mydef  = F$parse(whoami,,,"DEVICE") | ||||
| $ mydir  = f$parse(whoami,,,"DIRECTORY") - "][" | ||||
| $ myproc = f$parse(whoami,,,"Name") + f$parse(whoami,,,"type") | ||||
| $! | ||||
| $! Check for MMK/MMS | ||||
| $! | ||||
| $ if (Make .eqs. "") | ||||
| $ then | ||||
| $   If F$Search ("Sys$System:MMS.EXE") .nes. "" Then Make = "MMS" | ||||
| $   If F$Type (MMK) .eqs. "STRING" Then Make = "MMK" | ||||
| $ else | ||||
| $   Make = f$edit( Make, "trim") | ||||
| $ endif | ||||
| $! | ||||
| $ gosub find_version | ||||
| $! | ||||
| $  open/write topt tmp.opt | ||||
| $  open/write optf 'optfile' | ||||
| $! | ||||
| $ gosub check_opts | ||||
| $! | ||||
| $! Look for the compiler used | ||||
| $! | ||||
| $ gosub check_compiler | ||||
| $ close topt | ||||
| $ close optf | ||||
| $! | ||||
| $ if its_decc | ||||
| $ then | ||||
| $   ccopt = "/prefix=all" + ccopt | ||||
| $   if f$trnlnm("SYS") .eqs. "" | ||||
| $   then | ||||
| $     if axp | ||||
| $     then | ||||
| $       define sys sys$library: | ||||
| $     else | ||||
| $       ccopt = "/decc" + ccopt | ||||
| $       define sys decc$library_include: | ||||
| $     endif | ||||
| $   endif | ||||
| $! | ||||
| $! 2012-03-05 SMS. | ||||
| $! Why /NAMES = AS_IS?  Why not simply ".not. vax"?  And why not on VAX? | ||||
| $! | ||||
| $   if axp .or. ia64 | ||||
| $   then | ||||
| $       ccopt = ccopt + "/name=as_is/opt=(inline=speed)" | ||||
| $       s_case = true | ||||
| $   endif | ||||
| $ endif | ||||
| $ if its_vaxc .or. its_gnuc | ||||
| $ then | ||||
| $    if f$trnlnm("SYS").eqs."" then define sys sys$library: | ||||
| $ endif | ||||
| $! | ||||
| $! Build a fake configure input header | ||||
| $! | ||||
| $ open/write conf_hin config.hin | ||||
| $ write conf_hin "#undef _LARGEFILE64_SOURCE" | ||||
| $ close conf_hin | ||||
| $! | ||||
| $! | ||||
| $ i = 0 | ||||
| $FIND_ACONF: | ||||
| $ fname = f$element(i,"#",aconf_in_file) | ||||
| $ if fname .eqs. "#" then goto AMISS_ERR | ||||
| $ if f$search(fname) .eqs. "" | ||||
| $ then | ||||
| $   i = i + 1 | ||||
| $   goto find_aconf | ||||
| $ endif | ||||
| $ open/read/err=aconf_err aconf_in 'fname' | ||||
| $ open/write aconf zconf.h | ||||
| $ACONF_LOOP: | ||||
| $ read/end_of_file=aconf_exit aconf_in line | ||||
| $ work = f$edit(line, "compress,trim") | ||||
| $ if f$extract(0,6,work) .nes. "#undef" | ||||
| $ then | ||||
| $   if f$extract(0,12,work) .nes. "#cmakedefine" | ||||
| $   then | ||||
| $       write aconf line | ||||
| $   endif | ||||
| $ else | ||||
| $   cdef = f$element(1," ",work) | ||||
| $   gosub check_config | ||||
| $ endif | ||||
| $ goto aconf_loop | ||||
| $ACONF_EXIT: | ||||
| $ write aconf "" | ||||
| $ write aconf "/* VMS specifics added by make_vms.com: */" | ||||
| $ write aconf "#define VMS 1" | ||||
| $ write aconf "#include <unistd.h>" | ||||
| $ write aconf "#include <unixio.h>" | ||||
| $ write aconf "#ifdef _LARGEFILE" | ||||
| $ write aconf "# define off64_t __off64_t" | ||||
| $ write aconf "# define fopen64 fopen" | ||||
| $ write aconf "# define fseeko64 fseeko" | ||||
| $ write aconf "# define lseek64 lseek" | ||||
| $ write aconf "# define ftello64 ftell" | ||||
| $ write aconf "#endif" | ||||
| $ write aconf "#if !defined( __VAX) && (__CRTL_VER >= 70312000)" | ||||
| $ write aconf "# define HAVE_VSNPRINTF" | ||||
| $ write aconf "#endif" | ||||
| $ close aconf_in | ||||
| $ close aconf | ||||
| $ if f$search("''th'") .nes. "" then delete 'th';* | ||||
| $! Build the thing plain or with mms | ||||
| $! | ||||
| $ write sys$output "Compiling Zlib sources ..." | ||||
| $ if make.eqs."" | ||||
| $ then | ||||
| $   if (f$search( "example.obj;*") .nes. "") then delete example.obj;* | ||||
| $   if (f$search( "minigzip.obj;*") .nes. "") then delete minigzip.obj;* | ||||
| $   CALL MAKE adler32.OBJ "CC ''CCOPT' adler32" - | ||||
|                 adler32.c zlib.h zconf.h | ||||
| $   CALL MAKE compress.OBJ "CC ''CCOPT' compress" - | ||||
|                 compress.c zlib.h zconf.h | ||||
| $   CALL MAKE crc32.OBJ "CC ''CCOPT' crc32" - | ||||
|                 crc32.c zlib.h zconf.h | ||||
| $   CALL MAKE deflate.OBJ "CC ''CCOPT' deflate" - | ||||
|                 deflate.c deflate.h zutil.h zlib.h zconf.h | ||||
| $   CALL MAKE gzclose.OBJ "CC ''CCOPT' gzclose" - | ||||
|                 gzclose.c zutil.h zlib.h zconf.h | ||||
| $   CALL MAKE gzlib.OBJ "CC ''CCOPT' gzlib" - | ||||
|                 gzlib.c zutil.h zlib.h zconf.h | ||||
| $   CALL MAKE gzread.OBJ "CC ''CCOPT' gzread" - | ||||
|                 gzread.c zutil.h zlib.h zconf.h | ||||
| $   CALL MAKE gzwrite.OBJ "CC ''CCOPT' gzwrite" - | ||||
|                 gzwrite.c zutil.h zlib.h zconf.h | ||||
| $   CALL MAKE infback.OBJ "CC ''CCOPT' infback" - | ||||
|                 infback.c zutil.h inftrees.h inflate.h inffast.h inffixed.h | ||||
| $   CALL MAKE inffast.OBJ "CC ''CCOPT' inffast" - | ||||
|                 inffast.c zutil.h zlib.h zconf.h inffast.h | ||||
| $   CALL MAKE inflate.OBJ "CC ''CCOPT' inflate" - | ||||
|                 inflate.c zutil.h zlib.h zconf.h infblock.h | ||||
| $   CALL MAKE inftrees.OBJ "CC ''CCOPT' inftrees" - | ||||
|                 inftrees.c zutil.h zlib.h zconf.h inftrees.h | ||||
| $   CALL MAKE trees.OBJ "CC ''CCOPT' trees" - | ||||
|                 trees.c deflate.h zutil.h zlib.h zconf.h | ||||
| $   CALL MAKE uncompr.OBJ "CC ''CCOPT' uncompr" - | ||||
|                 uncompr.c zlib.h zconf.h | ||||
| $   CALL MAKE zutil.OBJ "CC ''CCOPT' zutil" - | ||||
|                 zutil.c zutil.h zlib.h zconf.h | ||||
| $   write sys$output "Building Zlib ..." | ||||
| $   CALL MAKE libz.OLB "lib/crea libz.olb *.obj" *.OBJ | ||||
| $   write sys$output "Building example..." | ||||
| $   CALL MAKE example.OBJ "CC ''CCOPT' [.test]example" - | ||||
|                 [.test]example.c zlib.h zconf.h | ||||
| $   call make example.exe "LINK example,libz.olb/lib" example.obj libz.olb | ||||
| $   write sys$output "Building minigzip..." | ||||
| $   CALL MAKE minigzip.OBJ "CC ''CCOPT' [.test]minigzip" - | ||||
|               [.test]minigzip.c zlib.h zconf.h | ||||
| $   call make minigzip.exe - | ||||
|               "LINK minigzip,libz.olb/lib" - | ||||
|               minigzip.obj libz.olb | ||||
| $ else | ||||
| $   gosub crea_mms | ||||
| $   write sys$output "Make ''name' ''version' with ''Make' " | ||||
| $   'make' | ||||
| $ endif | ||||
| $! | ||||
| $! Create shareable image | ||||
| $! | ||||
| $ gosub crea_olist | ||||
| $ write sys$output "Creating libzshr.exe" | ||||
| $ call map_2_shopt 'mapfile' 'optfile' | ||||
| $ LINK_'lopts'/SHARE=libzshr.exe modules.opt/opt,'optfile'/opt | ||||
| $ write sys$output "Zlib build completed" | ||||
| $ delete/nolog tmp.opt;* | ||||
| $ exit | ||||
| $AMISS_ERR: | ||||
| $ write sys$output "No source for config.hin found." | ||||
| $ write sys$output "Tried any of ''aconf_in_file'" | ||||
| $ goto err_exit | ||||
| $CC_ERR: | ||||
| $ write sys$output "C compiler required to build ''name'" | ||||
| $ goto err_exit | ||||
| $ERR_EXIT: | ||||
| $ set message/facil/ident/sever/text | ||||
| $ close/nolog optf | ||||
| $ close/nolog topt | ||||
| $ close/nolog aconf_in | ||||
| $ close/nolog aconf | ||||
| $ close/nolog out | ||||
| $ close/nolog min | ||||
| $ close/nolog mod | ||||
| $ close/nolog h_in | ||||
| $ write sys$output "Exiting..." | ||||
| $ exit 2 | ||||
| $! | ||||
| $! | ||||
| $MAKE: SUBROUTINE   !SUBROUTINE TO CHECK DEPENDENCIES | ||||
| $ V = 'F$Verify(0) | ||||
| $! P1 = What we are trying to make | ||||
| $! P2 = Command to make it | ||||
| $! P3 - P8  What it depends on | ||||
| $ | ||||
| $ If F$Search(P1) .Eqs. "" Then Goto Makeit | ||||
| $ Time = F$CvTime(F$File(P1,"RDT")) | ||||
| $arg=3 | ||||
| $Loop: | ||||
| $       Argument = P'arg | ||||
| $       If Argument .Eqs. "" Then Goto Exit | ||||
| $       El=0 | ||||
| $Loop2: | ||||
| $       File = F$Element(El," ",Argument) | ||||
| $       If File .Eqs. " " Then Goto Endl | ||||
| $       AFile = "" | ||||
| $Loop3: | ||||
| $       OFile = AFile | ||||
| $       AFile = F$Search(File) | ||||
| $       If AFile .Eqs. "" .Or. AFile .Eqs. OFile Then Goto NextEl | ||||
| $       If F$CvTime(F$File(AFile,"RDT")) .Ges. Time Then Goto Makeit | ||||
| $       Goto Loop3 | ||||
| $NextEL: | ||||
| $       El = El + 1 | ||||
| $       Goto Loop2 | ||||
| $EndL: | ||||
| $ arg=arg+1 | ||||
| $ If arg .Le. 8 Then Goto Loop | ||||
| $ Goto Exit | ||||
| $ | ||||
| $Makeit: | ||||
| $ VV=F$VERIFY(0) | ||||
| $ write sys$output P2 | ||||
| $ 'P2 | ||||
| $ VV='F$Verify(VV) | ||||
| $Exit: | ||||
| $ If V Then Set Verify | ||||
| $ENDSUBROUTINE | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Check command line options and set symbols accordingly | ||||
| $! | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! Version history | ||||
| $! 0.01 20041206 First version to receive a number | ||||
| $! 0.02 20060126 Add new "HELP" target | ||||
| $ CHECK_OPTS: | ||||
| $ i = 1 | ||||
| $ OPT_LOOP: | ||||
| $ if i .lt. 9 | ||||
| $ then | ||||
| $   cparm = f$edit(p'i',"upcase") | ||||
| $! | ||||
| $! Check if parameter actually contains something | ||||
| $! | ||||
| $   if f$edit(cparm,"trim") .nes. "" | ||||
| $   then | ||||
| $     if cparm .eqs. "DEBUG" | ||||
| $     then | ||||
| $       ccopt = ccopt + "/noopt/deb" | ||||
| $       lopts = lopts + "/deb" | ||||
| $     endif | ||||
| $     if f$locate("CCOPT=",cparm) .lt. f$length(cparm) | ||||
| $     then | ||||
| $       start = f$locate("=",cparm) + 1 | ||||
| $       len   = f$length(cparm) - start | ||||
| $       ccopt = ccopt + f$extract(start,len,cparm) | ||||
| $       if f$locate("AS_IS",f$edit(ccopt,"UPCASE")) .lt. f$length(ccopt) - | ||||
|           then s_case = true | ||||
| $     endif | ||||
| $     if cparm .eqs. "LINK" then linkonly = true | ||||
| $     if f$locate("LOPTS=",cparm) .lt. f$length(cparm) | ||||
| $     then | ||||
| $       start = f$locate("=",cparm) + 1 | ||||
| $       len   = f$length(cparm) - start | ||||
| $       lopts = lopts + f$extract(start,len,cparm) | ||||
| $     endif | ||||
| $     if f$locate("CC=",cparm) .lt. f$length(cparm) | ||||
| $     then | ||||
| $       start  = f$locate("=",cparm) + 1 | ||||
| $       len    = f$length(cparm) - start | ||||
| $       cc_com = f$extract(start,len,cparm) | ||||
|         if (cc_com .nes. "DECC") .and. - | ||||
|            (cc_com .nes. "VAXC") .and. - | ||||
|            (cc_com .nes. "GNUC") | ||||
| $       then | ||||
| $         write sys$output "Unsupported compiler choice ''cc_com' ignored" | ||||
| $         write sys$output "Use DECC, VAXC, or GNUC instead" | ||||
| $       else | ||||
| $         if cc_com .eqs. "DECC" then its_decc = true | ||||
| $         if cc_com .eqs. "VAXC" then its_vaxc = true | ||||
| $         if cc_com .eqs. "GNUC" then its_gnuc = true | ||||
| $       endif | ||||
| $     endif | ||||
| $     if f$locate("MAKE=",cparm) .lt. f$length(cparm) | ||||
| $     then | ||||
| $       start  = f$locate("=",cparm) + 1 | ||||
| $       len    = f$length(cparm) - start | ||||
| $       mmks = f$extract(start,len,cparm) | ||||
| $       if (mmks .eqs. "MMK") .or. (mmks .eqs. "MMS") | ||||
| $       then | ||||
| $         make = mmks | ||||
| $       else | ||||
| $         write sys$output "Unsupported make choice ''mmks' ignored" | ||||
| $         write sys$output "Use MMK or MMS instead" | ||||
| $       endif | ||||
| $     endif | ||||
| $     if cparm .eqs. "HELP" then gosub bhelp | ||||
| $   endif | ||||
| $   i = i + 1 | ||||
| $   goto opt_loop | ||||
| $ endif | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Look for the compiler used | ||||
| $! | ||||
| $! Version history | ||||
| $! 0.01 20040223 First version to receive a number | ||||
| $! 0.02 20040229 Save/set value of decc$no_rooted_search_lists | ||||
| $! 0.03 20060202 Extend handling of GNU C | ||||
| $! 0.04 20090402 Compaq -> hp | ||||
| $CHECK_COMPILER: | ||||
| $ if (.not. (its_decc .or. its_vaxc .or. its_gnuc)) | ||||
| $ then | ||||
| $   its_decc = (f$search("SYS$SYSTEM:DECC$COMPILER.EXE") .nes. "") | ||||
| $   its_vaxc = .not. its_decc .and. (F$Search("SYS$System:VAXC.Exe") .nes. "") | ||||
| $   its_gnuc = .not. (its_decc .or. its_vaxc) .and. (f$trnlnm("gnu_cc") .nes. "") | ||||
| $ endif | ||||
| $! | ||||
| $! Exit if no compiler available | ||||
| $! | ||||
| $ if (.not. (its_decc .or. its_vaxc .or. its_gnuc)) | ||||
| $ then goto CC_ERR | ||||
| $ else | ||||
| $   if its_decc | ||||
| $   then | ||||
| $     write sys$output "CC compiler check ... hp C" | ||||
| $     if f$trnlnm("decc$no_rooted_search_lists") .nes. "" | ||||
| $     then | ||||
| $       dnrsl = f$trnlnm("decc$no_rooted_search_lists") | ||||
| $     endif | ||||
| $     define/nolog decc$no_rooted_search_lists 1 | ||||
| $   else | ||||
| $     if its_vaxc then write sys$output "CC compiler check ... VAX C" | ||||
| $     if its_gnuc | ||||
| $     then | ||||
| $         write sys$output "CC compiler check ... GNU C" | ||||
| $         if f$trnlnm(topt) then write topt "gnu_cc:[000000]gcclib.olb/lib" | ||||
| $         if f$trnlnm(optf) then write optf "gnu_cc:[000000]gcclib.olb/lib" | ||||
| $         cc = "gcc" | ||||
| $     endif | ||||
| $     if f$trnlnm(topt) then write topt "sys$share:vaxcrtl.exe/share" | ||||
| $     if f$trnlnm(optf) then write optf "sys$share:vaxcrtl.exe/share" | ||||
| $   endif | ||||
| $ endif | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! If MMS/MMK are available dump out the descrip.mms if required | ||||
| $! | ||||
| $CREA_MMS: | ||||
| $ write sys$output "Creating descrip.mms..." | ||||
| $ create descrip.mms | ||||
| $ open/append out descrip.mms | ||||
| $ copy sys$input: out | ||||
| $ deck | ||||
| # descrip.mms: MMS description file for building zlib on VMS | ||||
| # written by Martin P.J. Zinser | ||||
| # <zinser@zinser.no-ip.info or martin.zinser@eurexchange.com> | ||||
|  | ||||
| OBJS = adler32.obj, compress.obj, crc32.obj, gzclose.obj, gzlib.obj\ | ||||
|        gzread.obj, gzwrite.obj, uncompr.obj, infback.obj\ | ||||
|        deflate.obj, trees.obj, zutil.obj, inflate.obj, \ | ||||
|        inftrees.obj, inffast.obj | ||||
|  | ||||
| $ eod | ||||
| $ write out "CFLAGS=", ccopt | ||||
| $ write out "LOPTS=", lopts | ||||
| $ write out "all : example.exe minigzip.exe libz.olb" | ||||
| $ copy sys$input: out | ||||
| $ deck | ||||
|         @ write sys$output " Example applications available" | ||||
|  | ||||
| libz.olb : libz.olb($(OBJS)) | ||||
| 	@ write sys$output " libz available" | ||||
|  | ||||
| example.exe : example.obj libz.olb | ||||
|               link $(LOPTS) example,libz.olb/lib | ||||
|  | ||||
| minigzip.exe : minigzip.obj libz.olb | ||||
|               link $(LOPTS) minigzip,libz.olb/lib | ||||
|  | ||||
| clean : | ||||
| 	delete *.obj;*,libz.olb;*,*.opt;*,*.exe;* | ||||
|  | ||||
|  | ||||
| # Other dependencies. | ||||
| adler32.obj  : adler32.c zutil.h zlib.h zconf.h | ||||
| compress.obj : compress.c zlib.h zconf.h | ||||
| crc32.obj    : crc32.c zutil.h zlib.h zconf.h | ||||
| deflate.obj  : deflate.c deflate.h zutil.h zlib.h zconf.h | ||||
| example.obj  : [.test]example.c zlib.h zconf.h | ||||
| gzclose.obj  : gzclose.c zutil.h zlib.h zconf.h | ||||
| gzlib.obj    : gzlib.c zutil.h zlib.h zconf.h | ||||
| gzread.obj   : gzread.c zutil.h zlib.h zconf.h | ||||
| gzwrite.obj  : gzwrite.c zutil.h zlib.h zconf.h | ||||
| inffast.obj  : inffast.c zutil.h zlib.h zconf.h inftrees.h inffast.h | ||||
| inflate.obj  : inflate.c zutil.h zlib.h zconf.h | ||||
| inftrees.obj : inftrees.c zutil.h zlib.h zconf.h inftrees.h | ||||
| minigzip.obj : [.test]minigzip.c zlib.h zconf.h | ||||
| trees.obj    : trees.c deflate.h zutil.h zlib.h zconf.h | ||||
| uncompr.obj  : uncompr.c zlib.h zconf.h | ||||
| zutil.obj    : zutil.c zutil.h zlib.h zconf.h | ||||
| infback.obj  : infback.c zutil.h inftrees.h inflate.h inffast.h inffixed.h | ||||
| $ eod | ||||
| $ close out | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Read list of core library sources from makefile.in and create options | ||||
| $! needed to build shareable image | ||||
| $! | ||||
| $CREA_OLIST: | ||||
| $ open/read min makefile.in | ||||
| $ open/write mod modules.opt | ||||
| $ src_check_list = "OBJZ =#OBJG =" | ||||
| $MRLOOP: | ||||
| $ read/end=mrdone min rec | ||||
| $ i = 0 | ||||
| $SRC_CHECK_LOOP: | ||||
| $ src_check = f$element(i, "#", src_check_list) | ||||
| $ i = i+1 | ||||
| $ if src_check .eqs. "#" then goto mrloop | ||||
| $ if (f$extract(0,6,rec) .nes. src_check) then goto src_check_loop | ||||
| $ rec = rec - src_check | ||||
| $ gosub extra_filnam | ||||
| $ if (f$element(1,"\",rec) .eqs. "\") then goto mrloop | ||||
| $MRSLOOP: | ||||
| $ read/end=mrdone min rec | ||||
| $ gosub extra_filnam | ||||
| $ if (f$element(1,"\",rec) .nes. "\") then goto mrsloop | ||||
| $MRDONE: | ||||
| $ close min | ||||
| $ close mod | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Take record extracted in crea_olist and split it into single filenames | ||||
| $! | ||||
| $EXTRA_FILNAM: | ||||
| $ myrec = f$edit(rec - "\", "trim,compress") | ||||
| $ i = 0 | ||||
| $FELOOP: | ||||
| $ srcfil = f$element(i," ", myrec) | ||||
| $ if (srcfil .nes. " ") | ||||
| $ then | ||||
| $   write mod f$parse(srcfil,,,"NAME"), ".obj" | ||||
| $   i = i + 1 | ||||
| $   goto feloop | ||||
| $ endif | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Find current Zlib version number | ||||
| $! | ||||
| $FIND_VERSION: | ||||
| $ open/read h_in 'v_file' | ||||
| $hloop: | ||||
| $ read/end=hdone h_in rec | ||||
| $ rec = f$edit(rec,"TRIM") | ||||
| $ if (f$extract(0,1,rec) .nes. "#") then goto hloop | ||||
| $ rec = f$edit(rec - "#", "TRIM") | ||||
| $ if f$element(0," ",rec) .nes. "define" then goto hloop | ||||
| $ if f$element(1," ",rec) .eqs. v_string | ||||
| $ then | ||||
| $   version = 'f$element(2," ",rec)' | ||||
| $   goto hdone | ||||
| $ endif | ||||
| $ goto hloop | ||||
| $hdone: | ||||
| $ close h_in | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $CHECK_CONFIG: | ||||
| $! | ||||
| $ in_ldef = f$locate(cdef,libdefs) | ||||
| $ if (in_ldef .lt. f$length(libdefs)) | ||||
| $ then | ||||
| $   write aconf "#define ''cdef' 1" | ||||
| $   libdefs = f$extract(0,in_ldef,libdefs) + - | ||||
|               f$extract(in_ldef + f$length(cdef) + 1, - | ||||
|                         f$length(libdefs) - in_ldef - f$length(cdef) - 1, - | ||||
|                         libdefs) | ||||
| $ else | ||||
| $   if (f$type('cdef') .eqs. "INTEGER") | ||||
| $   then | ||||
| $     write aconf "#define ''cdef' ", 'cdef' | ||||
| $   else | ||||
| $     if (f$type('cdef') .eqs. "STRING") | ||||
| $     then | ||||
| $       write aconf "#define ''cdef' ", """", '''cdef'', """" | ||||
| $     else | ||||
| $       gosub check_cc_def | ||||
| $     endif | ||||
| $   endif | ||||
| $ endif | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Check if this is a define relating to the properties of the C/C++ | ||||
| $! compiler | ||||
| $! | ||||
| $ CHECK_CC_DEF: | ||||
| $ if (cdef .eqs. "_LARGEFILE64_SOURCE") | ||||
| $ then | ||||
| $   copy sys$input: 'tc' | ||||
| $   deck | ||||
| #include "tconfig" | ||||
| #define _LARGEFILE | ||||
| #include <stdio.h> | ||||
|  | ||||
| int main(){ | ||||
| FILE *fp; | ||||
|   fp = fopen("temp.txt","r"); | ||||
|   fseeko(fp,1,SEEK_SET); | ||||
|   fclose(fp); | ||||
| } | ||||
|  | ||||
| $   eod | ||||
| $   test_inv = false | ||||
| $   comm_h = false | ||||
| $   gosub cc_prop_check | ||||
| $   return | ||||
| $ endif | ||||
| $ write aconf "/* ", line, " */" | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Check for properties of C/C++ compiler | ||||
| $! | ||||
| $! Version history | ||||
| $! 0.01 20031020 First version to receive a number | ||||
| $! 0.02 20031022 Added logic for defines with value | ||||
| $! 0.03 20040309 Make sure local config file gets not deleted | ||||
| $! 0.04 20041230 Also write include for configure run | ||||
| $! 0.05 20050103 Add processing of "comment defines" | ||||
| $CC_PROP_CHECK: | ||||
| $ cc_prop = true | ||||
| $ is_need = false | ||||
| $ is_need = (f$extract(0,4,cdef) .eqs. "NEED") .or. (test_inv .eq. true) | ||||
| $ if f$search(th) .eqs. "" then create 'th' | ||||
| $ set message/nofac/noident/nosever/notext | ||||
| $ on error then continue | ||||
| $ cc 'tmpnam' | ||||
| $ if .not. ($status)  then cc_prop = false | ||||
| $ on error then continue | ||||
| $! The headers might lie about the capabilities of the RTL | ||||
| $ link 'tmpnam',tmp.opt/opt | ||||
| $ if .not. ($status)  then cc_prop = false | ||||
| $ set message/fac/ident/sever/text | ||||
| $ on error then goto err_exit | ||||
| $ delete/nolog 'tmpnam'.*;*/exclude='th' | ||||
| $ if (cc_prop .and. .not. is_need) .or. - | ||||
|      (.not. cc_prop .and. is_need) | ||||
| $ then | ||||
| $   write sys$output "Checking for ''cdef'... yes" | ||||
| $   if f$type('cdef_val'_yes) .nes. "" | ||||
| $   then | ||||
| $     if f$type('cdef_val'_yes) .eqs. "INTEGER" - | ||||
|          then call write_config f$fao("#define !AS !UL",cdef,'cdef_val'_yes) | ||||
| $     if f$type('cdef_val'_yes) .eqs. "STRING" - | ||||
|          then call write_config f$fao("#define !AS !AS",cdef,'cdef_val'_yes) | ||||
| $   else | ||||
| $     call write_config f$fao("#define !AS 1",cdef) | ||||
| $   endif | ||||
| $   if (cdef .eqs. "HAVE_FSEEKO") .or. (cdef .eqs. "_LARGE_FILES") .or. - | ||||
|        (cdef .eqs. "_LARGEFILE64_SOURCE") then - | ||||
|       call write_config f$string("#define _LARGEFILE 1") | ||||
| $ else | ||||
| $   write sys$output "Checking for ''cdef'... no" | ||||
| $   if (comm_h) | ||||
| $   then | ||||
|       call write_config f$fao("/* !AS */",line) | ||||
| $   else | ||||
| $     if f$type('cdef_val'_no) .nes. "" | ||||
| $     then | ||||
| $       if f$type('cdef_val'_no) .eqs. "INTEGER" - | ||||
|            then call write_config f$fao("#define !AS !UL",cdef,'cdef_val'_no) | ||||
| $       if f$type('cdef_val'_no) .eqs. "STRING" - | ||||
|            then call write_config f$fao("#define !AS !AS",cdef,'cdef_val'_no) | ||||
| $     else | ||||
| $       call write_config f$fao("#undef !AS",cdef) | ||||
| $     endif | ||||
| $   endif | ||||
| $ endif | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Check for properties of C/C++ compiler with multiple result values | ||||
| $! | ||||
| $! Version history | ||||
| $! 0.01 20040127 First version | ||||
| $! 0.02 20050103 Reconcile changes from cc_prop up to version 0.05 | ||||
| $CC_MPROP_CHECK: | ||||
| $ cc_prop = true | ||||
| $ i    = 1 | ||||
| $ idel = 1 | ||||
| $ MT_LOOP: | ||||
| $ if f$type(result_'i') .eqs. "STRING" | ||||
| $ then | ||||
| $   set message/nofac/noident/nosever/notext | ||||
| $   on error then continue | ||||
| $   cc 'tmpnam'_'i' | ||||
| $   if .not. ($status)  then cc_prop = false | ||||
| $   on error then continue | ||||
| $! The headers might lie about the capabilities of the RTL | ||||
| $   link 'tmpnam'_'i',tmp.opt/opt | ||||
| $   if .not. ($status)  then cc_prop = false | ||||
| $   set message/fac/ident/sever/text | ||||
| $   on error then goto err_exit | ||||
| $   delete/nolog 'tmpnam'_'i'.*;* | ||||
| $   if (cc_prop) | ||||
| $   then | ||||
| $     write sys$output "Checking for ''cdef'... ", mdef_'i' | ||||
| $     if f$type(mdef_'i') .eqs. "INTEGER" - | ||||
|          then call write_config f$fao("#define !AS !UL",cdef,mdef_'i') | ||||
| $     if f$type('cdef_val'_yes) .eqs. "STRING" - | ||||
|          then call write_config f$fao("#define !AS !AS",cdef,mdef_'i') | ||||
| $     goto msym_clean | ||||
| $   else | ||||
| $     i = i + 1 | ||||
| $     goto mt_loop | ||||
| $   endif | ||||
| $ endif | ||||
| $ write sys$output "Checking for ''cdef'... no" | ||||
| $ call write_config f$fao("#undef !AS",cdef) | ||||
| $ MSYM_CLEAN: | ||||
| $ if (idel .le. msym_max) | ||||
| $ then | ||||
| $   delete/sym mdef_'idel' | ||||
| $   idel = idel + 1 | ||||
| $   goto msym_clean | ||||
| $ endif | ||||
| $ return | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Write configuration to both permanent and temporary config file | ||||
| $! | ||||
| $! Version history | ||||
| $! 0.01 20031029 First version to receive a number | ||||
| $! | ||||
| $WRITE_CONFIG: SUBROUTINE | ||||
| $  write aconf 'p1' | ||||
| $  open/append confh 'th' | ||||
| $  write confh 'p1' | ||||
| $  close confh | ||||
| $ENDSUBROUTINE | ||||
| $!------------------------------------------------------------------------------ | ||||
| $! | ||||
| $! Analyze the project map file and create the symbol vector for a shareable | ||||
| $! image from it | ||||
| $! | ||||
| $! Version history | ||||
| $! 0.01 20120128 First version | ||||
| $! 0.02 20120226 Add pre-load logic | ||||
| $! | ||||
| $ MAP_2_SHOPT: Subroutine | ||||
| $! | ||||
| $ SAY := "WRITE_ SYS$OUTPUT" | ||||
| $! | ||||
| $ IF F$SEARCH("''P1'") .EQS. "" | ||||
| $ THEN | ||||
| $    SAY "MAP_2_SHOPT-E-NOSUCHFILE:  Error, inputfile ''p1' not available" | ||||
| $    goto exit_m2s | ||||
| $ ENDIF | ||||
| $ IF "''P2'" .EQS. "" | ||||
| $ THEN | ||||
| $    SAY "MAP_2_SHOPT:  Error, no output file provided" | ||||
| $    goto exit_m2s | ||||
| $ ENDIF | ||||
| $! | ||||
| $ module1 = "deflate#deflateEnd#deflateInit_#deflateParams#deflateSetDictionary" | ||||
| $ module2 = "gzclose#gzerror#gzgetc#gzgets#gzopen#gzprintf#gzputc#gzputs#gzread" | ||||
| $ module3 = "gzseek#gztell#inflate#inflateEnd#inflateInit_#inflateSetDictionary" | ||||
| $ module4 = "inflateSync#uncompress#zlibVersion#compress" | ||||
| $ open/read map 'p1 | ||||
| $ if axp .or. ia64 | ||||
| $ then | ||||
| $     open/write aopt a.opt | ||||
| $     open/write bopt b.opt | ||||
| $     write aopt " CASE_SENSITIVE=YES" | ||||
| $     write bopt "SYMBOL_VECTOR= (-" | ||||
| $     mod_sym_num = 1 | ||||
| $ MOD_SYM_LOOP: | ||||
| $     if f$type(module'mod_sym_num') .nes. "" | ||||
| $     then | ||||
| $         mod_in = 0 | ||||
| $ MOD_SYM_IN: | ||||
| $         shared_proc = f$element(mod_in, "#", module'mod_sym_num') | ||||
| $         if shared_proc .nes. "#" | ||||
| $         then | ||||
| $             write aopt f$fao(" symbol_vector=(!AS/!AS=PROCEDURE)",- | ||||
|         		       f$edit(shared_proc,"upcase"),shared_proc) | ||||
| $             write bopt f$fao("!AS=PROCEDURE,-",shared_proc) | ||||
| $             mod_in = mod_in + 1 | ||||
| $             goto mod_sym_in | ||||
| $         endif | ||||
| $         mod_sym_num = mod_sym_num + 1 | ||||
| $         goto mod_sym_loop | ||||
| $     endif | ||||
| $MAP_LOOP: | ||||
| $     read/end=map_end map line | ||||
| $     if (f$locate("{",line).lt. f$length(line)) .or. - | ||||
|          (f$locate("global:", line) .lt. f$length(line)) | ||||
| $     then | ||||
| $         proc = true | ||||
| $         goto map_loop | ||||
| $     endif | ||||
| $     if f$locate("}",line).lt. f$length(line) then proc = false | ||||
| $     if f$locate("local:", line) .lt. f$length(line) then proc = false | ||||
| $     if proc | ||||
| $     then | ||||
| $         shared_proc = f$edit(line,"collapse") | ||||
| $         chop_semi = f$locate(";", shared_proc) | ||||
| $         if chop_semi .lt. f$length(shared_proc) then - | ||||
|               shared_proc = f$extract(0, chop_semi, shared_proc) | ||||
| $         write aopt f$fao(" symbol_vector=(!AS/!AS=PROCEDURE)",- | ||||
|         			 f$edit(shared_proc,"upcase"),shared_proc) | ||||
| $         write bopt f$fao("!AS=PROCEDURE,-",shared_proc) | ||||
| $     endif | ||||
| $     goto map_loop | ||||
| $MAP_END: | ||||
| $     close/nolog aopt | ||||
| $     close/nolog bopt | ||||
| $     open/append libopt 'p2' | ||||
| $     open/read aopt a.opt | ||||
| $     open/read bopt b.opt | ||||
| $ALOOP: | ||||
| $     read/end=aloop_end aopt line | ||||
| $     write libopt line | ||||
| $     goto aloop | ||||
| $ALOOP_END: | ||||
| $     close/nolog aopt | ||||
| $     sv = "" | ||||
| $BLOOP: | ||||
| $     read/end=bloop_end bopt svn | ||||
| $     if (svn.nes."") | ||||
| $     then | ||||
| $        if (sv.nes."") then write libopt sv | ||||
| $        sv = svn | ||||
| $     endif | ||||
| $     goto bloop | ||||
| $BLOOP_END: | ||||
| $     write libopt f$extract(0,f$length(sv)-2,sv), "-" | ||||
| $     write libopt ")" | ||||
| $     close/nolog bopt | ||||
| $     delete/nolog/noconf a.opt;*,b.opt;* | ||||
| $ else | ||||
| $     if vax | ||||
| $     then | ||||
| $     open/append libopt 'p2' | ||||
| $     mod_sym_num = 1 | ||||
| $ VMOD_SYM_LOOP: | ||||
| $     if f$type(module'mod_sym_num') .nes. "" | ||||
| $     then | ||||
| $         mod_in = 0 | ||||
| $ VMOD_SYM_IN: | ||||
| $         shared_proc = f$element(mod_in, "#", module'mod_sym_num') | ||||
| $         if shared_proc .nes. "#" | ||||
| $         then | ||||
| $     	      write libopt f$fao("UNIVERSAL=!AS",- | ||||
|       	  			     f$edit(shared_proc,"upcase")) | ||||
| $             mod_in = mod_in + 1 | ||||
| $             goto vmod_sym_in | ||||
| $         endif | ||||
| $         mod_sym_num = mod_sym_num + 1 | ||||
| $         goto vmod_sym_loop | ||||
| $     endif | ||||
| $VMAP_LOOP: | ||||
| $     	  read/end=vmap_end map line | ||||
| $     	  if (f$locate("{",line).lt. f$length(line)) .or. - | ||||
|    	      (f$locate("global:", line) .lt. f$length(line)) | ||||
| $     	  then | ||||
| $     	      proc = true | ||||
| $     	      goto vmap_loop | ||||
| $     	  endif | ||||
| $     	  if f$locate("}",line).lt. f$length(line) then proc = false | ||||
| $     	  if f$locate("local:", line) .lt. f$length(line) then proc = false | ||||
| $     	  if proc | ||||
| $     	  then | ||||
| $     	      shared_proc = f$edit(line,"collapse") | ||||
| $     	      chop_semi = f$locate(";", shared_proc) | ||||
| $     	      if chop_semi .lt. f$length(shared_proc) then - | ||||
|       	  	  shared_proc = f$extract(0, chop_semi, shared_proc) | ||||
| $     	      write libopt f$fao("UNIVERSAL=!AS",- | ||||
|       	  			     f$edit(shared_proc,"upcase")) | ||||
| $     	  endif | ||||
| $     	  goto vmap_loop | ||||
| $VMAP_END: | ||||
| $     else | ||||
| $         write sys$output "Unknown Architecture (Not VAX, AXP, or IA64)" | ||||
| $         write sys$output "No options file created" | ||||
| $     endif | ||||
| $ endif | ||||
| $ EXIT_M2S: | ||||
| $ close/nolog map | ||||
| $ close/nolog libopt | ||||
| $ endsubroutine | ||||
							
								
								
									
										342
									
								
								samples/DIGITAL Command Language/libxslt_build.com
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										342
									
								
								samples/DIGITAL Command Language/libxslt_build.com
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,342 @@ | ||||
| $! BUILD_XSLT.COM | ||||
| $! | ||||
| $! Build the XSLT library | ||||
| $! | ||||
| $! Arguments: | ||||
| $! | ||||
| $!	p1	- "DEBUG" is you want to build with debug | ||||
| $! | ||||
| $! This package requires libxml to have already been installed.  You need | ||||
| $! to ensure that the logical name LIBXML is defined and points to the  | ||||
| $! directory containing libxml's .h files | ||||
| $! | ||||
| $! This procedure creates the object libraries | ||||
| $! | ||||
| $!	XML_LIBDIR:LIBXSLT.OLB | ||||
| $!	XML_LIBDIR:LIBEXSLT.OLB | ||||
| $! | ||||
| $! and the program | ||||
| $! | ||||
| $!	XSLTPROC | ||||
| $! | ||||
| $! After the library is built, you can link these routines into | ||||
| $! your code with the command   | ||||
| $! | ||||
| $! 	LINK your_modules,XML_LIBDIR:LIBEXSLT/LIB,LIBXSLT/LIBRARY,LIBXML/LIB | ||||
| $! | ||||
| $! Change History | ||||
| $! -------------- | ||||
| $! Command file author : John A Fotheringham (jaf@jafsoft.com) | ||||
| $! Last update         : 2 Nov 2001 | ||||
| $!  | ||||
| $!- configuration ------------------------------------------------------------- | ||||
| $! | ||||
| $!- compile command. | ||||
| $! | ||||
| $   cc_opts = "/INCLUDE=([],XML_SRCDIR:,[-.libxslt])/NAMES=(SHORTENED)/FLOAT=IEEE/IEEE_MODE=DENORM_RESULTS" | ||||
| $! | ||||
| $   if p1.eqs."DEBUG" | ||||
| $   then | ||||
| $     debug = "Y" | ||||
| $     cc_command = "CC''cc_opts'/DEBUG/NOOPTIMIZE/LIST/SHOW=ALL" | ||||
| $   else | ||||
| $     debug = "N" | ||||
| $     cc_command = "CC''cc_opts'" | ||||
| $   endif | ||||
| $! | ||||
| $!- configure multiple build passes for each library. ------------------------- | ||||
| $! | ||||
| $!  For each pass: | ||||
| $! | ||||
| $!  "libname" is the name of the library or module being created | ||||
| $! | ||||
| $!  "progname" is the name of the program being created | ||||
| $! | ||||
| $!  "src" is the list of sources to be built into the library  or program | ||||
| $!	- This should be compared to the definition of  | ||||
| $!	  "<NAME>_la_SOURCES" in the MAKEFILE.IN file in  | ||||
| $!	  corresponding directory. | ||||
| $! | ||||
| $   num_passes = 3	! two libraries and a program | ||||
| $! | ||||
| $!- pass 1 - library LIBXSLT | ||||
| $! | ||||
| $   libname_1  = "LIBXSLT" | ||||
| $   h_file_1   = "xslt.h" | ||||
| $   progname_1 = "" | ||||
| $! | ||||
| $   ! see "libxslt_la_SOURCES" in [.libxslt]makefile.in | ||||
| $   src_1 = "xslt.c xsltutils.c pattern.c templates.c variables.c keys.c" | ||||
| $   src_1 = src_1 + " numbers.c extensions.c extra.c functions.c" | ||||
| $   src_1 = src_1 + " namespaces.c imports.c attributes.c documents.c" | ||||
| $   src_1 = src_1 + " preproc.c transform.c security.c" | ||||
| $! | ||||
| $!- pass 2 - library LIBEXSLT | ||||
| $! | ||||
| $   libname_2  = "LIBEXSLT" | ||||
| $   h_file_2   = "exslt.h" | ||||
| $   progname_2 = "" | ||||
| $! | ||||
| $   ! see "libexslt_la_SOURCES" in [.libexslt]makefile.in | ||||
| $   src_2   = "exslt.c common.c math.c sets.c functions.c strings.c date.c saxon.c dynamic.c" | ||||
| $! | ||||
| $!- pass 3 - program XSLTPROC | ||||
| $! | ||||
| $   libname_3  = "" | ||||
| $   h_file_3   = "" | ||||
| $   progname_3 = "XSLTPROC" | ||||
| $! | ||||
| $   ! see "xsltproc_SOURCES" in [.xsltproc]makefile.in | ||||
| $   src_3   = "xsltproc.c" | ||||
| $! | ||||
| $!- set up and check logicals  ----------------------------------------------- | ||||
| $! | ||||
| $!  XML_LIBDIR - object library directory | ||||
| $!  XML_SRCDIR - top-level build directory of libxml package -- needed for config.h and trio.h | ||||
| $!  LIBXML - source directory containing .h files for libxml package | ||||
| $! | ||||
| $   if f$trnlnm("XML_LIBDIR").eqs."" | ||||
| $   then | ||||
| $     on error then continue | ||||
| $     globfile = f$search("[--...]libxml.olb") | ||||
| $     if globfile.eqs."" | ||||
| $     then | ||||
| $       write sys$output "" | ||||
| $       write sys$output "	You need to define the XML_LIBDIR logical name to" | ||||
| $       write sys$output "	point to the directory containing your object" | ||||
| $       write sys$output "	libraries.  This should already contain LIBXML.OLB" | ||||
| $       write sys$output "	from the libxml package, and will be the directory" | ||||
| $       write sys$output "	the new LIBXSLT.OLB library will be placed in" | ||||
| $       write sys$output "" | ||||
| $       exit | ||||
| $     else | ||||
| $	srcdir = f$parse(globfile,,,"DEVICE") + f$parse(globfile,,,"DIRECTORY") | ||||
| $	define/process XML_LIBDIR "''srcdir'" | ||||
| $       write sys$output "Defining XML_LIBDIR as ""''srcdir'""" | ||||
| $     endif | ||||
| $   endif | ||||
| $! | ||||
| $   if f$trnlnm("libxml").eqs."" | ||||
| $   then | ||||
| $     ! look for globals.h in a directory installed paralle to this one | ||||
| $     on error then continue | ||||
| $     globfile = f$search("[--...]globals.h") | ||||
| $     if globfile.eqs."" | ||||
| $     then | ||||
| $       write sys$output "" | ||||
| $       write sys$output "	You need to define a LIBXML logical directory to" | ||||
| $       write sys$output "	point to the directory containing the .h files" | ||||
| $       write sys$output "	for the libxml package" | ||||
| $       write sys$output "" | ||||
| $       exit | ||||
| $     else | ||||
| $	srcdir = f$element(0,"]",globfile)+ "]" | ||||
| $	define/process LIBXML "''srcdir'" | ||||
| $       write sys$output "Defining LIBXML as ""''srcdir'""" | ||||
| $     endif | ||||
| $   endif | ||||
| $! | ||||
| $   if f$trnlnm("XML_SRCDIR").eqs."" | ||||
| $   then | ||||
| $     globfile = f$search("[--...]globals.c") | ||||
| $     if globfile.eqs."" | ||||
| $     then | ||||
| $	write sys$output "Can't locate globals.c.  You need to manually define a XML_SRCDIR logical" | ||||
| $	exit | ||||
| $     else | ||||
| $	srcdir = f$parse(globfile,,,"DEVICE") + f$parse(globfile,,,"DIRECTORY") | ||||
| $	define/process XML_SRCDIR "''srcdir'" | ||||
| $       write sys$output "Defining XML_SRCDIR as ""''srcdir'""" | ||||
| $     endif | ||||
| $   endif | ||||
| $! | ||||
| $!- set up some working logicals ------------------- | ||||
| $! | ||||
| $ pass_no = 1 | ||||
| $ set_pass_logical: | ||||
| $! | ||||
| $   if pass_no.le.num_passes | ||||
| $   then | ||||
| $! | ||||
| $     Libname  = libname_'pass_no' | ||||
| $     progname = progname_'pass_no' | ||||
| $     if libname.nes."" | ||||
| $     then | ||||
| $       logname  = "''libname'_SRCDIR" | ||||
| $     else | ||||
| $       logname  = "''progname'_SRCDIR" | ||||
| $     endif | ||||
| $     findfile = f$element(0," ",src_'pass_no') | ||||
| $! | ||||
| $!--- set up a source directory logical | ||||
| $! | ||||
| $     if f$trnlnm("''logname'").eqs."" | ||||
| $     then | ||||
| $       ! look for the target file in a parallel subdirectory | ||||
| $       globfile = f$search("[-...]''findfile'") | ||||
| $       if globfile.eqs."" | ||||
| $       then | ||||
| $  	  write sys$output "Can't locate ''findfile'.  You need to manually define a ''logname' logical" | ||||
| $	  exit | ||||
| $       else | ||||
| $  	  srcdir = f$element(0,"]",globfile)+ "]" | ||||
| $	  define/process 'logname' "''srcdir'" | ||||
| $         write sys$output "Defining ''logname' as ""''srcdir'""" | ||||
| $       endif | ||||
| $     endif | ||||
| $! | ||||
| $!--- if it's a library, set up a logical pointing to the .h files | ||||
| $! | ||||
| $     if libname.nes.""  | ||||
| $     then | ||||
| $	if f$trnlnm("''libname'").eqs.""  | ||||
| $       then  | ||||
| $         ! look for the target .h file in a parallel subdirectory | ||||
| $  	  h_file = h_file_'pass_no' | ||||
| $         globfile = f$search("[-...]''h_file'") | ||||
| $         if globfile.eqs."" | ||||
| $         then | ||||
| $	    write sys$output "Can't locate ''h_file'.  You need to manually define a ''libname' logical" | ||||
| $	    exit | ||||
| $         else | ||||
| $	    includedir = f$element(0,"]",globfile)+ "]" | ||||
| $	    define/process 'libname' "''includedir'" | ||||
| $           write sys$output "Defining ''libname' as ""''includedir'""" | ||||
| $	  endif | ||||
| $       endif | ||||
| $     endif | ||||
| $! | ||||
| $     pass_no = pass_no +1 | ||||
| $     goto set_pass_logical | ||||
| $! | ||||
| $   endif	! for each pass | ||||
| $! | ||||
| $!- set up error handling (such as it is) ------------------------------------- | ||||
| $! | ||||
| $ exit_status = 1 | ||||
| $ saved_default = f$environment("default") | ||||
| $ on error then goto ERROR_OUT  | ||||
| $ on control_y then goto ERROR_OUT  | ||||
| $! | ||||
| $ goto start_here | ||||
| $ start_here:	  ! move this line to debug/rerun parts of this command file | ||||
| $! | ||||
| $!- compile modules into the library ------------------------------------------ | ||||
| $! | ||||
| $! | ||||
| $ pass_no = 1	! make three passes, one for each library, one for XSLTPROC | ||||
| $ pass_loop: | ||||
| $! | ||||
| $ if pass_no.le.num_passes | ||||
| $ then | ||||
| $   Libname  = libname_'pass_no' | ||||
| $   progname = progname_'pass_no' | ||||
| $   if libname.nes."" | ||||
| $   then | ||||
| $     logname  = "''libname'_SRCDIR" | ||||
| $     pass_description = "the XML_LIBDIR:''libname'.OLB object library" | ||||
| $   else | ||||
| $     logname  = "''progname'_SRCDIR" | ||||
| $     pass_description = "the programs in ''progname'" | ||||
| $   endif | ||||
| $   src  = src_'pass_no' | ||||
| $! | ||||
| $!- create the library if need | ||||
| $! | ||||
| $   if libname.nes.""  | ||||
| $   then | ||||
| $     if f$search("XML_LIBDIR:''libname'.OLB").eqs.""  | ||||
| $     then | ||||
| $       write sys$output "Creating new object library XML_LIBDIR:''libname'.OLB..." | ||||
| $       library/create XML_LIBDIR:'libname'.OLB | ||||
| $     endif | ||||
| $   endif | ||||
| $! | ||||
| $!- move to the source directory  | ||||
| $! | ||||
| $   set def 'logname' | ||||
| $! | ||||
| $!- define the library and link commands (link command not used as is) | ||||
| $! | ||||
| $   if libname.nes."" | ||||
| $   then | ||||
| $     lib_command  = "LIBRARY/REPLACE XML_LIBDIR:''libname'.OLB" | ||||
| $     link_command = "" | ||||
| $   else | ||||
| $     lib_command  = "" | ||||
| $     link_command = "LINK" | ||||
| $   endif | ||||
| $! | ||||
| $   write sys$output "" | ||||
| $   write sys$output "Building ''pass_description' | ||||
| $   write sys$output "" | ||||
| $! | ||||
| $   s_no = 0 | ||||
| $   src = f$edit(src,"COMPRESS") | ||||
| $! | ||||
| $ source_loop: | ||||
| $! | ||||
| $     next_source = f$element (S_no," ",src) | ||||
| $     if next_source.nes."" .and. next_source.nes." " | ||||
| $     then | ||||
| $       call build 'next_source' | ||||
| $       s_no = s_no + 1 | ||||
| $       goto source_loop | ||||
| $     endif | ||||
| $! | ||||
| $     pass_no = pass_no + 1 | ||||
| $     goto pass_loop | ||||
| $! | ||||
| $   endif	! for each pass | ||||
| $! | ||||
| $!- Th-th-th-th-th-that's all folks! ------------------------------------------ | ||||
| $! | ||||
| $EXIT_OUT: | ||||
| $! | ||||
| $ set def 'saved_default | ||||
| $ exit 'exit_status | ||||
| $! | ||||
| $ | ||||
| $ERROR_OUT: | ||||
| $ exit_status = $status | ||||
| $ write sys$output "''f$message(exit_status)'" | ||||
| $ goto EXIT_OUT | ||||
| $! | ||||
| $!- the BUILD subroutine.  Compile then insert into library or link as required | ||||
| $! | ||||
| $BUILD: subroutine | ||||
| $   on warning then goto EXIT_BUILD | ||||
| $   source_file = p1 | ||||
| $   name = f$element(0,".",source_file) | ||||
| $   object_file = f$fao("XML_LIBDIR:!AS.OBJ",name) | ||||
| $! | ||||
| $!- compile | ||||
| $   write sys$output "Compiling ",p1,p2,"..." | ||||
| $   cc_command /object='object_file 'source_file' 'p2' | ||||
| $! | ||||
| $!- insert into library if command defined | ||||
| $! | ||||
| $   if lib_command.nes.""   | ||||
| $   then  | ||||
| $     lib_command 'object_file' | ||||
| $     delete/nolog 'object_file';* | ||||
| $   endif | ||||
| $! | ||||
| $!- link module if command defined | ||||
| $! | ||||
| $   if link_command.nes.""  | ||||
| $   then | ||||
| $	text = f$element(0,".",p1)	! lose the ".c" | ||||
| $	write sys$output "Linking ",text,"..." | ||||
| $	dbgopts = "" | ||||
| $	if debug then dbgopts = "/DEBUG" | ||||
| $	link_command'dbgopts' 'object_file',- | ||||
|       		XML_LIBDIR:libexslt/lib,- | ||||
|       		XML_LIBDIR:libxslt/lib,- | ||||
|       		XML_LIBDIR:libxml/library | ||||
| $   endif | ||||
| $! | ||||
| $EXIT_BUILD: | ||||
| $   exit $status | ||||
| $! | ||||
| $endsubroutine | ||||
							
								
								
									
										10
									
								
								samples/DIGITAL Command Language/vmsbackup_build.com
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										10
									
								
								samples/DIGITAL Command Language/vmsbackup_build.com
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,10 @@ | ||||
| $! Compiling with VAXC is said to work, but it requires the usual cruft | ||||
| $! (vaxcrtl and all), and to avoid hair we don't supply said cruft here. | ||||
| $ CC/DECC/PREFIX=all VMSBACKUP.C/DEFINE=(HAVE_MT_IOCTLS=0,HAVE_UNIXIO_H=1) | ||||
| $ CC/DECC/PREFIX=all DCLMAIN.C | ||||
| $! Probably we don't want match as it probably doesn't implement VMS-style | ||||
| $! matching, but I haven't looking into the issues yet. | ||||
| $ CC/DECC/PREFIX=all match | ||||
| $ LINK/exe=VMSBACKUP.EXE - | ||||
| vmsbackup.obj,dclmain.obj,match.obj,sys$input/opt | ||||
| identification="VMSBACKUP4.1.1" | ||||
							
								
								
									
										13
									
								
								samples/DNS Zone/sample.arpa
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										13
									
								
								samples/DNS Zone/sample.arpa
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,13 @@ | ||||
| $ORIGIN 0.0.0.c.2.1.0.3.0.0.2.1.e.f.f.3.ip6.arpa. | ||||
| $TTL     60 | ||||
| @ 	 IN SOA ns root ( | ||||
| 	     2002042901 ; SERIAL | ||||
| 	     7200       ; REFRESH | ||||
| 	     600        ; RETRY | ||||
| 	     36000000   ; EXPIRE | ||||
| 	     120        ; MINIMUM | ||||
| 	     ) | ||||
|  | ||||
| 	    NS	 ns.example.com. | ||||
|  | ||||
| c.a.7.e.d.7.e.f.f.f.0.2.8.0.a.0 PTR  sip01.example.com. | ||||
							
								
								
									
										12
									
								
								samples/DNS Zone/sneaky.net.zone
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										12
									
								
								samples/DNS Zone/sneaky.net.zone
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,12 @@ | ||||
| $TTL 3d | ||||
| @ IN SOA root.localhost. root.sneaky.net. ( | ||||
|     2015042907 ; serial | ||||
|     3d         ; refresh | ||||
|     1h         ; retry | ||||
|     12d        ; expire | ||||
|     2h         ; negative response TTL | ||||
|   ) | ||||
|   IN NS root.localhost. | ||||
|   IN NS localhost. ; secondary name server is preferably externally maintained | ||||
|  | ||||
| www IN A 3.141.59.26 | ||||
							
								
								
									
										23
									
								
								samples/DTrace/counts.d
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										23
									
								
								samples/DTrace/counts.d
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,23 @@ | ||||
| /* | ||||
|  * This software is in the public domain. | ||||
|  * | ||||
|  * $Id: counts.d 10510 2005-08-15 01:46:19Z kateturner $ | ||||
|  */ | ||||
|  | ||||
| #pragma D option quiet | ||||
|  | ||||
| self int tottime; | ||||
| BEGIN { | ||||
| 	tottime = timestamp; | ||||
| } | ||||
|  | ||||
| php$target:::function-entry | ||||
| 	@counts[copyinstr(arg0)] = count(); | ||||
| } | ||||
|  | ||||
| END { | ||||
| 	printf("Total time: %dus\n", (timestamp - tottime) / 1000); | ||||
| 	printf("# calls by function:\n"); | ||||
| 	printa("%-40s %@d\n", @counts); | ||||
| } | ||||
|  | ||||
							
								
								
									
										73
									
								
								samples/DTrace/javascript-trace.d
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										73
									
								
								samples/DTrace/javascript-trace.d
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,73 @@ | ||||
| /* -*- Mode: dtrace-script; tab-width: 2; indent-tabs-mode: nil; c-basic-offset: 2 -*- */ | ||||
| /* ***** BEGIN LICENSE BLOCK ***** | ||||
|  * Version: MPL 1.1/GPL 2.0/LGPL 2.1 | ||||
|  * | ||||
|  * The contents of this file are subject to the Mozilla Public License Version | ||||
|  * 1.1 (the "License"); you may not use this file except in compliance with | ||||
|  * the License. You may obtain a copy of the License at | ||||
|  * http://www.mozilla.org/MPL/ | ||||
|  * | ||||
|  * Software distributed under the License is distributed on an "AS IS" basis, | ||||
|  * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License | ||||
|  * for the specific language governing rights and limitations under the | ||||
|  * License. | ||||
|  * | ||||
|  * Copyright (C) 2007  Sun Microsystems, Inc. All Rights Reserved. | ||||
|  * | ||||
|  * Alternatively, the contents of this file may be used under the terms of | ||||
|  * either the GNU General Public License Version 2 or later (the "GPL"), or | ||||
|  * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"), | ||||
|  * in which case the provisions of the GPL or the LGPL are applicable instead | ||||
|  * of those above. If you wish to allow use of your version of this file only | ||||
|  * under the terms of either the GPL or the LGPL, and not to allow others to | ||||
|  * use your version of this file under the terms of the MPL, indicate your | ||||
|  * decision by deleting the provisions above and replace them with the notice | ||||
|  * and other provisions required by the GPL or the LGPL. If you do not delete | ||||
|  * the provisions above, a recipient may use your version of this file under | ||||
|  * the terms of any one of the MPL, the GPL or the LGPL. | ||||
|  * | ||||
|  * ***** END LICENSE BLOCK ***** */ | ||||
|  | ||||
| /* | ||||
|  * javascript provider probes | ||||
|  * | ||||
|  * function-entry       (filename, classname, funcname) | ||||
|  * function-info        (filename, classname, funcname, lineno, | ||||
|  *                      runfilename, runlineno) | ||||
|  * function-args        (filename, classname, funcname, argc, argv, argv0, | ||||
|  *                      argv1, argv2, argv3, argv4) | ||||
|  * function-rval        (filename, classname, funcname, lineno, rval, rval0) | ||||
|  * function-return      (filename, classname, funcname) | ||||
|  * object-create-start  (filename, classname) | ||||
|  * object-create        (filename, classname, *object, rlineno) | ||||
|  * object-create-done   (filename, classname) | ||||
|  * object-finalize      (NULL, classname, *object) | ||||
|  * execute-start        (filename, lineno) | ||||
|  * execute-done         (filename, lineno) | ||||
|  */ | ||||
|  | ||||
| provider javascript { | ||||
|  probe function__entry(char *, char *, char *); | ||||
|  probe function__info(char *, char *, char *, int, char *, int); | ||||
|  probe function__args(char *, char *, char *, int, void *, void *, void *, | ||||
|      void *, void *, void *); | ||||
|  probe function__rval(char *, char *, char *, int, void *, void *); | ||||
|  probe function__return(char *, char *, char *); | ||||
|  probe object__create__start(char *, char *); | ||||
|  probe object__create__done(char *, char *); | ||||
|  /* XXX must use unsigned longs here instead of uintptr_t for OS X  | ||||
|     (Apple radar: 5194316 & 5565198) */ | ||||
|  probe object__create(char *, char *, unsigned long, int); | ||||
|  probe object__finalize(char *, char *, unsigned long); | ||||
|  probe execute__start(char *, int); | ||||
|  probe execute__done(char *, int); | ||||
| }; | ||||
|  | ||||
| /* | ||||
| #pragma D attributes Unstable/Unstable/Common provider mozilla provider | ||||
| #pragma D attributes Private/Private/Unknown provider mozilla module | ||||
| #pragma D attributes Private/Private/Unknown provider mozilla function | ||||
| #pragma D attributes Unstable/Unstable/Common provider mozilla name | ||||
| #pragma D attributes Unstable/Unstable/Common provider mozilla args | ||||
| */ | ||||
|  | ||||
							
								
								
									
										93
									
								
								samples/DTrace/probes.d
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										93
									
								
								samples/DTrace/probes.d
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,93 @@ | ||||
| /* ---------- | ||||
|  *	DTrace probes for PostgreSQL backend | ||||
|  * | ||||
|  *	Copyright (c) 2006-2009, PostgreSQL Global Development Group | ||||
|  * | ||||
|  *	$PostgreSQL: pgsql/src/backend/utils/probes.d,v 1.11 2009/04/02 20:59:10 momjian Exp $ | ||||
|  * ---------- | ||||
|  */ | ||||
|  | ||||
|  | ||||
| /* | ||||
|  * Typedefs used in PostgreSQL. | ||||
|  * | ||||
|  * NOTE: Do not use system-provided typedefs (e.g. uintptr_t, uint32_t, etc) | ||||
|  * in probe definitions, as they cause compilation errors on Mac OS X 10.5. | ||||
|  */ | ||||
| #define LocalTransactionId unsigned int | ||||
| #define LWLockId int | ||||
| #define LWLockMode int | ||||
| #define LOCKMODE int | ||||
| #define BlockNumber unsigned int | ||||
| #define Oid unsigned int | ||||
| #define ForkNumber int | ||||
| #define bool char | ||||
|  | ||||
| provider postgresql { | ||||
|  | ||||
| 	probe transaction__start(LocalTransactionId); | ||||
| 	probe transaction__commit(LocalTransactionId); | ||||
| 	probe transaction__abort(LocalTransactionId); | ||||
|  | ||||
| 	probe lwlock__acquire(LWLockId, LWLockMode); | ||||
| 	probe lwlock__release(LWLockId); | ||||
| 	probe lwlock__wait__start(LWLockId, LWLockMode); | ||||
| 	probe lwlock__wait__done(LWLockId, LWLockMode); | ||||
| 	probe lwlock__condacquire(LWLockId, LWLockMode); | ||||
| 	probe lwlock__condacquire__fail(LWLockId, LWLockMode); | ||||
|  | ||||
| 	probe lock__wait__start(unsigned int, unsigned int, unsigned int, unsigned int, unsigned int, LOCKMODE); | ||||
| 	probe lock__wait__done(unsigned int, unsigned int, unsigned int, unsigned int, unsigned int, LOCKMODE); | ||||
|  | ||||
| 	probe query__parse__start(const char *); | ||||
| 	probe query__parse__done(const char *); | ||||
| 	probe query__rewrite__start(const char *); | ||||
| 	probe query__rewrite__done(const char *); | ||||
| 	probe query__plan__start(); | ||||
| 	probe query__plan__done(); | ||||
| 	probe query__execute__start(); | ||||
| 	probe query__execute__done(); | ||||
| 	probe query__start(const char *); | ||||
| 	probe query__done(const char *); | ||||
| 	probe statement__status(const char *); | ||||
|  | ||||
| 	probe sort__start(int, bool, int, int, bool); | ||||
| 	probe sort__done(bool, long); | ||||
|  | ||||
| 	probe buffer__read__start(ForkNumber, BlockNumber, Oid, Oid, Oid, bool, bool); | ||||
| 	probe buffer__read__done(ForkNumber, BlockNumber, Oid, Oid, Oid, bool, bool, bool); | ||||
| 	probe buffer__flush__start(ForkNumber, BlockNumber, Oid, Oid, Oid); | ||||
| 	probe buffer__flush__done(ForkNumber, BlockNumber, Oid, Oid, Oid); | ||||
|  | ||||
| 	probe buffer__checkpoint__start(int); | ||||
| 	probe buffer__checkpoint__sync__start(); | ||||
| 	probe buffer__checkpoint__done(); | ||||
| 	probe buffer__sync__start(int, int); | ||||
| 	probe buffer__sync__written(int); | ||||
| 	probe buffer__sync__done(int, int, int); | ||||
| 	probe buffer__write__dirty__start(ForkNumber, BlockNumber, Oid, Oid, Oid); | ||||
| 	probe buffer__write__dirty__done(ForkNumber, BlockNumber, Oid, Oid, Oid); | ||||
|  | ||||
| 	probe deadlock__found(); | ||||
|  | ||||
| 	probe checkpoint__start(int); | ||||
| 	probe checkpoint__done(int, int, int, int, int); | ||||
| 	probe clog__checkpoint__start(bool); | ||||
| 	probe clog__checkpoint__done(bool); | ||||
| 	probe subtrans__checkpoint__start(bool); | ||||
| 	probe subtrans__checkpoint__done(bool); | ||||
| 	probe multixact__checkpoint__start(bool); | ||||
| 	probe multixact__checkpoint__done(bool); | ||||
| 	probe twophase__checkpoint__start(); | ||||
| 	probe twophase__checkpoint__done(); | ||||
|  | ||||
| 	probe smgr__md__read__start(ForkNumber, BlockNumber, Oid, Oid, Oid); | ||||
| 	probe smgr__md__read__done(ForkNumber, BlockNumber, Oid, Oid, Oid, int, int); | ||||
| 	probe smgr__md__write__start(ForkNumber, BlockNumber, Oid, Oid, Oid); | ||||
| 	probe smgr__md__write__done(ForkNumber, BlockNumber, Oid, Oid, Oid, int, int); | ||||
|  | ||||
| 	probe xlog__insert(unsigned char, unsigned char); | ||||
| 	probe xlog__switch(); | ||||
| 	probe wal__buffer__write__dirty__start(); | ||||
| 	probe wal__buffer__write__dirty__done(); | ||||
| }; | ||||
							
								
								
									
										44
									
								
								samples/Eiffel/application.e
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										44
									
								
								samples/Eiffel/application.e
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,44 @@ | ||||
| note | ||||
| 	description : "nino application root class" | ||||
| 	date        : "$Date$" | ||||
| 	revision    : "$Revision$" | ||||
|  | ||||
| class | ||||
| 	APPLICATION | ||||
|  | ||||
| inherit | ||||
| 	ARGUMENTS | ||||
|  | ||||
| 	HTTP_SERVER_SHARED_CONFIGURATION | ||||
|  | ||||
| create | ||||
| 	make | ||||
|  | ||||
| feature {NONE} -- Initialization | ||||
|  | ||||
| 	make | ||||
| 			-- Run application. | ||||
| 		local | ||||
| 			l_server : HTTP_SERVER | ||||
| 			l_cfg: HTTP_SERVER_CONFIGURATION | ||||
| 			l_http_handler : HTTP_HANDLER | ||||
| 		do | ||||
| 			create l_cfg.make | ||||
| 			l_cfg.http_server_port := 9_000 | ||||
| 			l_cfg.document_root := default_document_root | ||||
| 			set_server_configuration (l_cfg) | ||||
| 			debug ("nino") | ||||
| 				l_cfg.set_is_verbose (True) | ||||
| 			end | ||||
|  | ||||
| 			create l_server.make (l_cfg) | ||||
| 			create {APPLICATION_CONNECTION_HANDLER} l_http_handler.make (l_server) | ||||
| 			l_server.setup (l_http_handler) | ||||
| 		end | ||||
|  | ||||
| feature -- Access | ||||
|  | ||||
| 	default_document_root: STRING = "webroot" | ||||
|  | ||||
| end | ||||
|  | ||||
							
								
								
									
										82
									
								
								samples/Eiffel/book_collection.e
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										82
									
								
								samples/Eiffel/book_collection.e
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,82 @@ | ||||
| class | ||||
| 	BOOK_COLLECTION | ||||
|  | ||||
| create | ||||
| 	make | ||||
|  | ||||
| feature {NONE} -- Initialization | ||||
|  | ||||
| 	make (a_name: STRING_32) | ||||
| 			-- Create a book collection with `a_name' as `name'. | ||||
| 		do | ||||
| 			set_name (a_name) | ||||
| 			create book_index.make (10) | ||||
| 		ensure | ||||
| 			name_set: name = a_name | ||||
| 		end | ||||
|  | ||||
| feature -- Access | ||||
|  | ||||
| 	name: STRING_32 | ||||
| 			-- Name. | ||||
|  | ||||
| 	books: LIST [BOOK] | ||||
| 			-- collection of book. | ||||
| 		do | ||||
| 			create {LINKED_LIST [BOOK]} Result.make | ||||
| 			across | ||||
| 				book_index as it | ||||
| 			loop | ||||
| 				Result.append (it.item) | ||||
| 			end | ||||
| 		end | ||||
|  | ||||
| 	books_by_author (a_author: STRING_32): LIST [BOOK] | ||||
| 			-- Books wrote by `a_author' in this collection. | ||||
| 		do | ||||
| 			if attached book_index [a_author] as l_result then | ||||
| 				Result := l_result | ||||
| 			else | ||||
| 				create {LINKED_LIST [BOOK]} Result.make | ||||
| 			end | ||||
| 		end | ||||
|  | ||||
| feature -- Change | ||||
|  | ||||
| 	set_name (a_name: STRING_32) | ||||
| 			-- Set `name' with `a_name'. | ||||
| 		do | ||||
| 			name := a_name | ||||
| 		ensure | ||||
| 			name_set: name = a_name | ||||
| 		end | ||||
|  | ||||
| 	add_book (a_book: BOOK) | ||||
| 			-- Extend collection with `a_book'. | ||||
| 		local | ||||
| 			l: detachable LIST [BOOK] | ||||
| 		do | ||||
| 			l := book_index.at (a_book.author.name) | ||||
| 			if l = Void then | ||||
| 				create {LINKED_LIST [BOOK]} l.make | ||||
| 				book_index.put (l, a_book.author.name) | ||||
| 			end | ||||
| 			l.force (a_book) | ||||
| 		end | ||||
|  | ||||
| 	add_books (book_list: like books) | ||||
| 			-- Append collection with `book_list'. | ||||
| 		do | ||||
| 			across | ||||
| 				book_list as it | ||||
| 			loop | ||||
| 				add_book (it.item) | ||||
| 			end | ||||
| 		end | ||||
|  | ||||
| feature {NONE} -- Implementation | ||||
|  | ||||
| 	book_index: HASH_TABLE [LIST [BOOK], STRING_32] | ||||
| 			-- Association of author name and its books. | ||||
|  | ||||
| end -- class BOOK_COLLECTION | ||||
							
								
								
									
										41
									
								
								samples/Eiffel/git_checkout_command.e
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										41
									
								
								samples/Eiffel/git_checkout_command.e
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,41 @@ | ||||
| note | ||||
| 	description: "Git checkout command." | ||||
| 	author: "Olivier Ligot" | ||||
|  | ||||
| class | ||||
| 	GIT_CHECKOUT_COMMAND | ||||
|  | ||||
| inherit | ||||
| 	GIT_COMMAND | ||||
|  | ||||
| create | ||||
| 	make, | ||||
| 	make_master | ||||
|  | ||||
| feature {NONE} -- Initialization | ||||
|  | ||||
| 	make (a_branch: STRING) | ||||
| 			-- Checkout the branch `a_branch'. | ||||
| 		do | ||||
| 			initialize | ||||
| 			arguments.force_last (a_branch) | ||||
| 			branch := a_branch | ||||
| 		ensure | ||||
| 			branch_set: branch = a_branch | ||||
| 		end | ||||
|  | ||||
| 	make_master | ||||
| 			-- Checkout the master branch. | ||||
| 		do | ||||
| 			make ("master") | ||||
| 		end | ||||
|  | ||||
| feature -- Access | ||||
|  | ||||
| 	branch: STRING | ||||
| 			-- Branch to checkout | ||||
|  | ||||
| 	name: STRING = "checkout" | ||||
| 			-- Git subcommand name | ||||
|  | ||||
| end | ||||
							
								
								
									
										10
									
								
								samples/Elixir/filenames/mix.lock
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										10
									
								
								samples/Elixir/filenames/mix.lock
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,10 @@ | ||||
| %{"cowboy": {:hex, :cowboy, "1.0.0"}, | ||||
|   "cowlib": {:hex, :cowlib, "1.0.1"}, | ||||
|   "hackney": {:hex, :hackney, "0.14.3"}, | ||||
|   "hound": {:hex, :hound, "0.6.0"}, | ||||
|   "httpoison": {:hex, :httpoison, "0.5.0"}, | ||||
|   "idna": {:hex, :idna, "1.0.1"}, | ||||
|   "phoenix": {:hex, :phoenix, "0.10.0"}, | ||||
|   "plug": {:hex, :plug, "0.11.1"}, | ||||
|   "poison": {:hex, :poison, "1.3.1"}, | ||||
|   "ranch": {:hex, :ranch, "1.0.0"}} | ||||
							
								
								
									
										260
									
								
								samples/Erlang/filenames/rebar.config
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										260
									
								
								samples/Erlang/filenames/rebar.config
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,260 @@ | ||||
| %% -*- mode: erlang;erlang-indent-level: 4;indent-tabs-mode: nil -*- | ||||
| %% ex: ts=4 sw=4 ft=erlang et | ||||
| %% This is a sample rebar.conf file that shows examples of some of rebar's | ||||
| %% options. | ||||
|  | ||||
| %% == Core == | ||||
|  | ||||
| %% Extend list of always recursive commands | ||||
| {recursive_cmds, []}. | ||||
|  | ||||
| %% Check required ERTS or OTP release version | ||||
| {require_erts_vsn, ".*"}. | ||||
| {require_otp_vsn, ".*"}. | ||||
| {require_min_otp_vsn, ".*"}. | ||||
|  | ||||
| %% Additional library directories to add to the code path | ||||
| {lib_dirs, []}. | ||||
|  | ||||
| %% == Erlang Compiler == | ||||
|  | ||||
| %% Erlang files to compile before the rest. Rebar automatically compiles | ||||
| %% parse_transforms and custom behaviours before anything other than the files | ||||
| %% in this list. | ||||
| {erl_first_files, ["src/mymib1.erl", "src/mymib2.erl"]}. | ||||
|  | ||||
| %% Erlang compiler options | ||||
| {erl_opts, [no_debug_info, | ||||
|             {i, "myinclude"}, | ||||
|             {src_dirs, ["src", "src2", "src3"]}, | ||||
|             {platform_define, | ||||
|              "(linux|solaris|freebsd|darwin)", 'HAVE_SENDFILE'}, | ||||
|             {platform_define, "(linux|freebsd)", 'BACKLOG', 128}, | ||||
|             {platform_define, "R13", 'old_inets'}]}. | ||||
|  | ||||
| %% MIB Options? | ||||
| {mib_opts, []}. | ||||
|  | ||||
| %% SNMP mibs to compile first? | ||||
| {mib_first_files, []}. | ||||
|  | ||||
| %% leex options | ||||
| {xrl_opts, []}. | ||||
|  | ||||
| %% leex files to compile first | ||||
| {xrl_first_files, []}. | ||||
|  | ||||
| %% yecc options | ||||
| {yrl_opts, []}. | ||||
|  | ||||
| %% yecc files to compile first | ||||
| {yrl_first_files, []}. | ||||
|  | ||||
| %% == EDoc == | ||||
|  | ||||
| %% EDoc options | ||||
| {edoc_opts, []}. | ||||
|  | ||||
| %% == Port Compiler == | ||||
|  | ||||
| %% Port compilation environment variables. See rebar_port_compiler.erl for | ||||
| %% more info. Default is `[]' | ||||
| {port_env, [{"CFLAGS", "$CFLAGS -Ifoo"}, | ||||
|             {"freebsd", "LDFLAGS", "$LDFLAGS -lfoo"}]}. | ||||
|  | ||||
| %% port_specs | ||||
| %% List of filenames or wildcards to be compiled. May also contain a tuple | ||||
| %% consisting of a regular expression to be applied against the system | ||||
| %% architecture as a filter. | ||||
| {port_specs, [{"priv/so_name.so", ["c_src/*.c"]}, | ||||
|               {"linux", "priv/hello_linux", ["c_src/hello_linux.c"]}, | ||||
|               {"linux", "priv/hello_linux", ["c_src/*.c"], [{env, []}]}]}. | ||||
|  | ||||
| %% == escriptize == | ||||
| {escript_name, "application"}. | ||||
| {escript_incl_apps, []}. | ||||
| {escript_shebang, "#!/usr/bin/env escript\n"}. | ||||
| {escript_comment, "%%\n"}. | ||||
| {escript_emu_args, "%%! -pa application/application/ebin\n"}. | ||||
|  | ||||
| %% == LFE Compiler == | ||||
|  | ||||
| %% LFE files to compile before the rest | ||||
| {lfe_first_files, []}. | ||||
|  | ||||
| %% Options for the LFE compiler: reuse {erl_opts, []} | ||||
|  | ||||
| %% == ErlyDTL Compiler == | ||||
|  | ||||
| %% Options for the ErlyDTL compiler | ||||
| {erlydtl_opts, []}. | ||||
|  | ||||
| %% == Proto compiler == | ||||
| {proto_opts, [ | ||||
|     {compiler, protobuffs}, | ||||
|     {src_dirs, ["src"]} | ||||
| ]}. | ||||
| %% Available compilers for protocol buffer files (*.proto): | ||||
| %%   protobuffs  (default) | ||||
| %%   gpb | ||||
| %% Optional src_dirs which is a list of directories where | ||||
| %% to look for .proto files, default is src | ||||
|  | ||||
| %% Options for the gpb protocol buffer compiler, | ||||
| %% if selected by the proto_compiler option | ||||
| {gpb_opts, []}. | ||||
|  | ||||
| %% == EUnit == | ||||
|  | ||||
| %% Options for eunit:test() | ||||
| {eunit_opts, []}. | ||||
|  | ||||
| %% Additional compile options for eunit. erl_opts is also used | ||||
| {eunit_compile_opts, []}. | ||||
|  | ||||
| %% Same as erl_first_files, but used only when running 'eunit' | ||||
| {eunit_first_files, []}. | ||||
|  | ||||
| %% == Cover == | ||||
|  | ||||
| %% Whether to enable coverage reporting. Default is `false' | ||||
| {cover_enabled, false}. | ||||
|  | ||||
| %% Whether to print coverage report to console. Default is `false' | ||||
| {cover_print_enabled, false}. | ||||
|  | ||||
| %% Whether to export coverage report to file. Default is `false' | ||||
| {cover_export_enabled, false}. | ||||
|  | ||||
| %% == Common Test == | ||||
|  | ||||
| %% Override the default "test" directory in which SUITEs are located | ||||
| {ct_dir, "itest"}. | ||||
|  | ||||
| %% Override the default "logs" directory in which SUITEs are logged | ||||
| {ct_log_dir, "test/logs"}. | ||||
|  | ||||
| %% Option to pass extra parameters when launching Common Test | ||||
| {ct_extra_params, "-boot start_sasl -s myapp"}. | ||||
|  | ||||
| %% Option to use short names (i.e., -sname test) when starting ct | ||||
| {ct_use_short_names, true}. | ||||
|  | ||||
| %% == QuickCheck == | ||||
|  | ||||
| %% If qc_mod is unspecified, rebar tries to detect Triq or EQC | ||||
| {qc_opts, [{qc_mod, module()}, Options]}. | ||||
|  | ||||
| %% Additional compile options for qc. erl_opts is also used | ||||
| {qc_compile_opts, []}. | ||||
|  | ||||
| %% Same as erl_first_files, but used only when running 'qc' | ||||
| {qc_first_files, []}. | ||||
|  | ||||
| %% == Cleanup == | ||||
|  | ||||
| %% Which files to cleanup | ||||
| {clean_files, ["file", "file2"]}. | ||||
|  | ||||
| %% == OTP Applications == | ||||
|  | ||||
| %% Enable validation of the OTP app module list. Default is 'true' | ||||
| {validate_app_modules, true}. | ||||
|  | ||||
| %% == Dependencies == | ||||
|  | ||||
| %% Where to put any downloaded dependencies. Default is "deps" | ||||
| {deps_dir, "deps"}. | ||||
|  | ||||
| %% What dependencies we have, dependencies can be of 3 forms, an application | ||||
| %% name as an atom, eg. mochiweb, a name and a version (from the .app file), or | ||||
| %% an application name, a version and the SCM details on how to fetch it (SCM | ||||
| %% type, location and revision). | ||||
| %% Rebar currently supports git, hg, bzr, svn, rsync, fossil, and p4. | ||||
| {deps, [app_name, | ||||
|         {rebar, "1.0.*"}, | ||||
|         {rebar, ".*", | ||||
|          {git, "git://github.com/rebar/rebar.git"}}, | ||||
|         {rebar, ".*", | ||||
|          {git, "git://github.com/rebar/rebar.git", "Rev"}}, | ||||
|         {rebar, "1.0.*", | ||||
|          {git, "git://github.com/rebar/rebar.git", {branch, "master"}}}, | ||||
|         {rebar, "1.0.0", | ||||
|          {git, "git://github.com/rebar/rebar.git", {tag, "1.0.0"}}}, | ||||
|         %% Dependencies can be marked as 'raw'. Rebar does not require | ||||
|         %% such dependencies to have a standard Erlang/OTP layout | ||||
|         %% which assumes the presence of either | ||||
|         %% "src/dependency_name.app.src" or "ebin/dependency_name.app" | ||||
|         %% files. | ||||
|         %% | ||||
|         %% 'raw' dependencies can still contain 'rebar.config' and | ||||
|         %% even can have the proper OTP directory layout, but they | ||||
|         %% won't be compiled. | ||||
|         %% | ||||
|         %% Only a subset of rebar commands will be executed on the | ||||
|         %% 'raw' subdirectories: get-deps, update-deps, check-deps, | ||||
|         %% list-deps and delete-deps. | ||||
|         {rebar, "", | ||||
|          {git, "git://github.com/rebar/rebar.git", {branch, "master"}}, | ||||
|          [raw]}, | ||||
|         {app_name, ".*", {hg, "https://www.example.org/url"}}, | ||||
|         {app_name, ".*", {rsync, "Url"}}, | ||||
|         {app_name, ".*", {svn, "https://www.example.org/url"}}, | ||||
|         {app_name, ".*", {svn, "svn://svn.example.org/url"}}, | ||||
|         {app_name, ".*", {bzr, "https://www.example.org/url", "Rev"}}, | ||||
|         {app_name, ".*", {fossil, "https://www.example.org/url"}}, | ||||
|         {app_name, ".*", {fossil, "https://www.example.org/url", "Vsn"}}, | ||||
|         {app_name, ".*", {p4, "//depot/subdir/app_dir"}}]}. | ||||
|  | ||||
| %% == Subdirectories == | ||||
|  | ||||
| %% Subdirectories? | ||||
| {sub_dirs, ["dir1", "dir2"]}. | ||||
|  | ||||
| %% == Plugins == | ||||
|  | ||||
| %% Plugins you wish to include. | ||||
| %% These can include any module on the code path, including deps. | ||||
| %% Alternatively, plugins can be placed as source files in the plugin_dir, in | ||||
| %% which case they will be compiled and loaded dynamically at runtime. | ||||
| {plugins, [plugin1, plugin2]}. | ||||
|  | ||||
| %% Override the directory in which plugin sources can be found. | ||||
| %% Defaults to ./plugins | ||||
| {plugin_dir, "some_other_directory"}. | ||||
|  | ||||
|  | ||||
| %% == Pre/Post Command Hooks == | ||||
|  | ||||
| {pre_hooks, [{clean, "./prepare_package_files.sh"}, | ||||
|              {"linux", compile, "c_src/build_linux.sh"}, | ||||
|              {compile, "escript generate_headers"}, | ||||
|              {compile, "escript check_headers"}]}. | ||||
|  | ||||
| {post_hooks, [{clean, "touch file1.out"}, | ||||
|               {"freebsd", compile, "c_src/freebsd_tweaks.sh"}, | ||||
|               {eunit, "touch file2.out"}, | ||||
|               {compile, "touch postcompile.out"}]}. | ||||
|  | ||||
| %% == xref == | ||||
|  | ||||
| {xref_warnings, false}. | ||||
|  | ||||
| %% optional extra paths to include in xref:set_library_path/2. | ||||
| %% specified relative location of rebar.config. | ||||
| %% e.g. {xref_extra_paths,["../gtknode/src"]} | ||||
| {xref_extra_paths,[]}. | ||||
|  | ||||
| %% xref checks to run | ||||
| {xref_checks, [undefined_function_calls, undefined_functions, | ||||
|                locals_not_used, exports_not_used, | ||||
|                deprecated_function_calls, deprecated_functions]}. | ||||
|  | ||||
| %% Optional custom xref queries (xref manual has details) specified as | ||||
| %%     {xref_queries, [{query_string(), expected_query_result()},...]} | ||||
| %% The following for example removes all references to mod:*foo/4 | ||||
| %% functions from undefined external function calls as those are in a | ||||
| %% generated module | ||||
| {xref_queries, | ||||
|  [{"(XC - UC) || (XU - X - B" | ||||
|    " - (\"mod\":\".*foo\"/\"4\"))",[]}]}. | ||||
							
								
								
									
										158
									
								
								samples/Erlang/filenames/rebar.config.lock
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										158
									
								
								samples/Erlang/filenames/rebar.config.lock
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,158 @@ | ||||
| %% THIS FILE IS GENERATED. DO NOT EDIT IT MANUALLY %% | ||||
|  | ||||
| {sub_dirs,["rel","apps/riak"]}. | ||||
| {require_otp_vsn,"R16|17"}. | ||||
| {cover_enabled,true}. | ||||
| {lib_dirs,["apps/riak"]}. | ||||
| {erl_opts,[debug_info,fail_on_warning]}. | ||||
| {eunit_opts,[verbose]}. | ||||
| {erlydtl_opts,[{compiler_options,[report,return,debug_info]}]}. | ||||
| {deps,[{rebar_lock_deps_plugin,".*", | ||||
|                                {git,"git://github.com/seth/rebar_lock_deps_plugin.git", | ||||
|                                     "7a5835029c42b8138325405237ea7e8516a84800"}}, | ||||
|        {node_package,".*", | ||||
|                      {git,"git://github.com/basho/node_package.git", | ||||
|                           "a829631eccebe3c1d7657a0075584f55bf342977"}}, | ||||
|        {goldrush,".*", | ||||
|                  {git,"git://github.com/DeadZen/goldrush.git", | ||||
|                       "71e63212f12c25827e0c1b4198d37d5d018a7fec"}}, | ||||
|        {lager,".*", | ||||
|               {git,"git://github.com/basho/lager.git", | ||||
|                    "b6b6cebcb27ccff8acc59ae775acebc2f52e4926"}}, | ||||
|        {syslog,".*", | ||||
|                {git,"git://github.com/Vagabond/erlang-syslog.git", | ||||
|                     "918c9b453e0811b24f2c99b35b712b0ef9f29c7e"}}, | ||||
|        {lager_syslog,".*", | ||||
|                      {git,"git://github.com/basho/lager_syslog.git", | ||||
|                           "fa2e7e3daee0d0a59dadb820fd3381eac4a65770"}}, | ||||
|        {cluster_info,".*", | ||||
|                      {git,"git://github.com/basho/cluster_info.git", | ||||
|                           "e231144ca32dc83317be3360a4a259c73826b08a"}}, | ||||
|        {sidejob,".*", | ||||
|                 {git,"git://github.com/basho/sidejob.git", | ||||
|                      "c5aabba2d7daa80c340e110902bbcfcb552ccdcf"}}, | ||||
|        {erlang_js,".*", | ||||
|                   {git,"git://github.com/basho/erlang_js.git", | ||||
|                        "07467d899ab90a2b719ad19ab0be0048c1c8d873"}}, | ||||
|        {meck,".*", | ||||
|              {git,"git://github.com/basho/meck.git", | ||||
|                   "dde759050eff19a1a80fd854d7375174b191665d"}}, | ||||
|        {getopt,".*", | ||||
|                {git,"git://github.com/jcomellas/getopt.git", | ||||
|                     "659a28f4145bc9843598972854299dc4ea77e4cb"}}, | ||||
|        {neotoma,".*", | ||||
|                 {git,"git://github.com/seancribbs/neotoma.git", | ||||
|                      "760928ec8870da02eb11bccb501e2700925d06c6"}}, | ||||
|        {cuttlefish,".*", | ||||
|                    {git,"git://github.com/basho/cuttlefish.git", | ||||
|                         "c92c8325aeaea6b6ba7516bbd434f8e408f87d60"}}, | ||||
|        {bitcask,".*", | ||||
|                 {git,"git://github.com/basho/bitcask.git", | ||||
|                      "c74d0c43fdefdd435f7621ddf1fc2995b5bd123c"}}, | ||||
|        {eper,".*", | ||||
|              {git,"git://github.com/basho/eper.git", | ||||
|                   "7222ecaebceb5422e74a9c1503043bbc6036f6b7"}}, | ||||
|        {edown,".*", | ||||
|               {git,"git://github.com/uwiger/edown.git", | ||||
|                    "d62ec85281e451a46ba30045917c119d65b72a84"}}, | ||||
|        {sext,".*", | ||||
|              {git,"git://github.com/basho/sext.git", | ||||
|                   "846b9cc22456287a572efd4c924203d77778670f"}}, | ||||
|        {poolboy,".*", | ||||
|                 {git,"git://github.com/basho/poolboy.git", | ||||
|                      "8bb45fbc715c5f493642a1cc572ec7017d0d5fa3"}}, | ||||
|        {basho_stats,".*", | ||||
|                     {git,"git://github.com/basho/basho_stats.git", | ||||
|                          "19c532af235ae675439d491b329c55c2f9b02deb"}}, | ||||
|        {riak_sysmon,".*", | ||||
|                     {git,"git://github.com/basho/riak_sysmon.git", | ||||
|                          "26a58bcaba96d07df885f7b3db4d4306f995ce14"}}, | ||||
|        {eleveldb,".*", | ||||
|                  {git,"git://github.com/basho/eleveldb.git", | ||||
|                       "0e4e4e7cf3ddc26523a77f853ea9409c1707b26c"}}, | ||||
|        {riak_ensemble,".*", | ||||
|                       {git,"git://github.com/basho/riak_ensemble", | ||||
|                            "78dc8f623353a212ca3cf12236d1e9ac824bde16"}}, | ||||
|        {pbkdf2,".*", | ||||
|                {git,"git://github.com/basho/erlang-pbkdf2.git", | ||||
|                     "7076584f5377e98600a7e2cb81980b2992fb2f71"}}, | ||||
|        {parse_trans,".*", | ||||
|                     {git,"git://github.com/uwiger/parse_trans.git", | ||||
|                          "82cc00264aa1bad8fc5c0739b7541feb4a843432"}}, | ||||
|        {bear,".*", | ||||
|              {git,"git://github.com/basho/bear.git", | ||||
|                   "da820a13c607c3f816ee8b83c587266da5389761"}}, | ||||
|        {folsom,".*", | ||||
|                {git,"git://github.com/basho/folsom.git", | ||||
|                     "72944523b6467c9f7add5f1c96dd5020424a2681"}}, | ||||
|        {setup,".*", | ||||
|               {git,"git://github.com/uwiger/setup.git", | ||||
|                    "51ee7c9f64d2bbe9dcbb58c278e8fbfd4d0ca5e2"}}, | ||||
|        {exometer_core,".*", | ||||
|                       {git,"git://github.com/basho/exometer_core.git", | ||||
|                            "b47a5d65d9500c2b8f6ccc50e34005503589ef77"}}, | ||||
|        {clique,".*", | ||||
|                {git,"git://github.com/basho/clique.git", | ||||
|                     "3af4db8ea0f74aca42f6713446dcd5915c795a74"}}, | ||||
|        {riak_core,".*", | ||||
|                   {git,"git://github.com/basho/riak_core.git", | ||||
|                        "044c4e7f8dbfe8c49c45f2f7090adff4cd5aba50"}}, | ||||
|        {riak_pipe,".*", | ||||
|                   {git,"git://github.com/basho/riak_pipe.git", | ||||
|                        "3c0abc7ba301d57940c5a9c5de368b70429c28ff"}}, | ||||
|        {protobuffs,".*", | ||||
|                    {git,"git://github.com/basho/erlang_protobuffs.git", | ||||
|                         "f88fc3c6881687432ddd5546b3c7b08009dfb26f"}}, | ||||
|        {riak_pb,".*", | ||||
|                 {git,"git://github.com/basho/riak_pb.git", | ||||
|                      "78c50efa698f33f7d6ab1c7f5fa4666ec03b46b4"}}, | ||||
|        {mochiweb,".*", | ||||
|                  {git,"git://github.com/basho/mochiweb.git", | ||||
|                       "ade2a9b29a11034eb550c1d79b4f991bf5ca05ba"}}, | ||||
|        {webmachine,".*", | ||||
|                    {git,"git://github.com/basho/webmachine.git", | ||||
|                         "7677c240f4a7ed020f4bab48278224966bb42311"}}, | ||||
|        {riak_api,".*", | ||||
|                  {git,"git://github.com/basho/riak_api.git", | ||||
|                       "2781e66796903bc6847bffcf71a6ba7a05d69275"}}, | ||||
|        {riak_dt,".*", | ||||
|                 {git,"git://github.com/basho/riak_dt.git", | ||||
|                      "f7981d4ad7407ddc085f133f204dd71bf9d50c56"}}, | ||||
|        {eunit_formatters,".*", | ||||
|                          {git,"git://github.com/seancribbs/eunit_formatters", | ||||
|                               "96b6ced4d45ba641cbf2c8a8ae9b350dd300bc10"}}, | ||||
|        {riak_kv,".*", | ||||
|                 {git,"git://github.com/basho/riak_kv.git", | ||||
|                      "404619cb57574cd43e2dc0dc0453884ec6732a99"}}, | ||||
|        {merge_index,".*", | ||||
|                     {git,"git://github.com/basho/merge_index.git", | ||||
|                          "b701dde5c28956c3b629411e5ff7e50cbb5cb4b3"}}, | ||||
|        {riak_search,".*", | ||||
|                     {git,"git://github.com/basho/riak_search.git", | ||||
|                          "8fe4a8c020a74c52ee877bf6dd410824b4f79f8b"}}, | ||||
|        {erlydtl,".*", | ||||
|                 {git,"git://github.com/evanmiller/erlydtl.git", | ||||
|                      "d20b53f04837a1053ed18987f645cb60eae82453"}}, | ||||
|        {riak_control,".*", | ||||
|                      {git,"git://github.com/basho/riak_control.git", | ||||
|                           "09073ce672260e1ec0ba3999fabed7f319624ba1"}}, | ||||
|        {riaknostic,".*", | ||||
|                    {git,"git://github.com/basho/riaknostic.git", | ||||
|                         "101d95bddff4b70afcd1dd5442b8c6651887e0a4"}}, | ||||
|        {kvc,".*", | ||||
|             {git,"git://github.com/etrepum/kvc.git", | ||||
|                  "5565fe51857747662410cc3c06362ebcf48a2f04"}}, | ||||
|        {ibrowse,".*", | ||||
|                 {git,"git://github.com/cmullaparthi/ibrowse.git", | ||||
|                      "e8ae353c16d4f0897abb9f80025b52925b974dd1"}}, | ||||
|        {yokozuna,".*", | ||||
|                  {git,"git://github.com/basho/yokozuna.git", | ||||
|                       "5868266b11f131d14c85495e50f899f3fe8158ba"}}, | ||||
|        {canola,".*", | ||||
|                {git,"git://github.com/basho/canola.git", | ||||
|                     "9bdfee88fce20b3a01b7003696b53eb21913d6fb"}}, | ||||
|        {riak_auth_mods,".*", | ||||
|                        {git,"git://github.com/basho/riak_auth_mods.git", | ||||
|                             "31b8b30e6c215418522eaa615264ae9769a87410"}}]}. | ||||
| {plugins,[rebar_lock_deps_plugin]}. | ||||
|  | ||||
							
								
								
									
										16
									
								
								samples/Erlang/filenames/rebar.lock
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										16
									
								
								samples/Erlang/filenames/rebar.lock
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,16 @@ | ||||
| [{<<"goldrush">>, | ||||
|   {git,"git://github.com/DeadZen/goldrush.git", | ||||
|        {ref,"71e63212f12c25827e0c1b4198d37d5d018a7fec"}}, | ||||
|   1}, | ||||
|  {<<"riak_dt">>, | ||||
|   {git,"git://github.com/helium/riak_dt.git", | ||||
|        {ref,"15d66cb26c2028c1ad1271c359b1d5da213825c3"}}, | ||||
|   0}, | ||||
|  {<<"lager">>, | ||||
|   {git,"git://github.com/basho/lager.git", | ||||
|        {ref,"d33ccf3b69de09a628fe38b4d7981bb8671b8a4f"}}, | ||||
|   0}, | ||||
|  {<<"eleveldb">>, | ||||
|   {git,"git://github.com/helium/eleveldb.git", | ||||
|        {ref,"29a5360dc0365b3330dd0cd45b0b8166f3b854be"}}, | ||||
|   0}]. | ||||
							
								
								
									
										35
									
								
								samples/Filterscript/colormatrix.fs
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										35
									
								
								samples/Filterscript/colormatrix.fs
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,35 @@ | ||||
| /* | ||||
|  * Copyright (C) 2012 The Android Open Source Project | ||||
|  * | ||||
|  * Licensed under the Apache License, Version 2.0 (the "License"); | ||||
|  * you may not use this file except in compliance with the License. | ||||
|  * You may obtain a copy of the License at | ||||
|  * | ||||
|  *      http://www.apache.org/licenses/LICENSE-2.0 | ||||
|  * | ||||
|  * Unless required by applicable law or agreed to in writing, software | ||||
|  * distributed under the License is distributed on an "AS IS" BASIS, | ||||
|  * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. | ||||
|  * See the License for the specific language governing permissions and | ||||
|  * limitations under the License. | ||||
|  */ | ||||
|  | ||||
| #include "ip.rsh" | ||||
|  | ||||
| static rs_matrix4x4 Mat; | ||||
|  | ||||
| void init() { | ||||
|     rsMatrixLoadIdentity(&Mat); | ||||
| } | ||||
|  | ||||
| void setMatrix(rs_matrix4x4 m) { | ||||
|     Mat = m; | ||||
| } | ||||
|  | ||||
| uchar4 __attribute__((kernel)) root(uchar4 in) { | ||||
|     float4 f = convert_float4(in); | ||||
|     f = rsMatrixMultiply(&Mat, f); | ||||
|     f = clamp(f, 0.f, 255.f); | ||||
|     return convert_uchar4(f); | ||||
| } | ||||
|  | ||||
							
								
								
									
										18
									
								
								samples/Filterscript/fs_kernel.fs
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										18
									
								
								samples/Filterscript/fs_kernel.fs
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,18 @@ | ||||
| #pragma version(1) | ||||
| #pragma rs java_package_name(foo) | ||||
|  | ||||
| int __attribute__((kernel)) root(uint32_t ain) { | ||||
|   return 0; | ||||
| } | ||||
|  | ||||
| void __attribute__((kernel)) in_only(uint32_t ain) { | ||||
| } | ||||
|  | ||||
| int __attribute__((kernel)) out_only() { | ||||
|   return 0; | ||||
| } | ||||
|  | ||||
| int __attribute__((kernel)) everything(uint32_t ain, uint32_t x, uint32_t y) { | ||||
|   return 0; | ||||
| } | ||||
|  | ||||
							
								
								
									
										919
									
								
								samples/Formatted/long_seq.for
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										919
									
								
								samples/Formatted/long_seq.for
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,919 @@ | ||||
| ACCEPTABLE LEFT PRIMERS | ||||
|                                   1-based     #                self   self hair-  qual- | ||||
|    # sequence                       start ln  N   GC%     Tm any_th end_th   pin   lity | ||||
|    0 tgctagctaggcgatgctag             411 20  0 55.00 60.028 23.16 23.16 38.59  0.028 | ||||
|    1 actgatacgcgatgctagct             476 20  0 50.00 59.957 17.69  1.35  0.00  0.043 | ||||
|    2 gatcgatgctagctaggcga             405 20  0 55.00 60.100 16.30 16.30  0.00  0.100 | ||||
|    3 tcgatcgatgctagctaggc             403 20  0 55.00 60.100 18.63  8.45  0.00  0.100 | ||||
|    4 tagctgatcgatcgtagcgg             565 20  0 55.00 60.101 25.02 17.36  0.00  0.101 | ||||
|    5 gctgactgatcgatcgatgc             113 20  0 55.00 59.826 24.08 17.09 35.21  0.174 | ||||
|    6 tatcatctctgcgcgatcga             361 20  0 50.00 59.747 22.07  1.72 38.48  0.253 | ||||
|    7 agctaggcgatgctagctag             415 20  0 55.00 59.742 17.46 17.46 41.54  0.258 | ||||
|    8 ctagctaggcgatgctagct             413 20  0 55.00 59.742 18.68 17.35 43.53  0.258 | ||||
|    9 ggcgatctagctagctgact             583 20  0 55.00 59.671 17.44  7.44 37.58  0.329 | ||||
|   10 tcgatgctagctaggcgatg             407 20  0 55.00 60.382 14.03  0.00  0.00  0.382 | ||||
|   11 gctgatcgatcgatgctagc             398 20  0 55.00 59.618 25.97 24.79 35.21  0.382 | ||||
|   12 gctagctgatcgatcgatgc             394 20  0 55.00 59.618 24.08 21.09 35.21  0.382 | ||||
|   13 atcatctctgcgcgatcgat             362 20  0 50.00 60.382 22.07  5.02 38.48  0.382 | ||||
|   14 gactgatacgcgatgctagc             475 20  0 55.00 59.551  8.61  8.61  0.00  0.449 | ||||
|   15 atcgatgctagctaggcgat             406 20  0 50.00 59.452 18.43 18.43  0.00  0.548 | ||||
|   16 gctagctgactgatacgcga             468 20  0 55.00 60.589 16.29  0.00  0.00  0.589 | ||||
|   17 agctagctgactgatacgcg             467 20  0 55.00 60.590 17.99  3.89  0.00  0.590 | ||||
|   18 atgctagctaggcgatgcta             410 20  0 50.00 59.375 10.59  8.91  0.00  0.625 | ||||
|   19 ctatcatctctgcgcgatcg             360 20  0 55.00 59.347 12.19 12.19 39.07  0.653 | ||||
|   20 gatgctagctaggcgatgct             409 20  0 55.00 60.668  7.01  7.53  0.00  0.668 | ||||
|   21 gctactatcatctctgcgcg             356 20  0 55.00 59.273  0.00  0.00  0.00  0.727 | ||||
|   22 cgtagcggcgatctagctag             577 20  0 60.00 60.791 15.64 15.64 37.58  0.791 | ||||
|   23 cggcgatctagctagctgac             582 20  0 60.00 61.003 14.84  7.25 38.70  1.003 | ||||
|   24 gctagctgatcgatcgtagc             563 20  0 55.00 58.995 23.70 23.70  0.00  1.005 | ||||
|   25 gatcgatcgatgtgcggcta              81 20  0 55.00 61.006 19.16  0.00 41.65  1.006 | ||||
|   26 atcgatcgatgtgcggctag              82 20  0 55.00 61.008 29.65  0.00 41.65  1.008 | ||||
|   27 gctgactgatacgcgatgc              472 19  0 57.89 60.025  0.00  0.00  0.00  1.025 | ||||
|   28 agctagctgatcatcgatgct            190 21  0 47.62 60.035 17.99 11.09  0.00  1.035 | ||||
|   29 gctagctagctgactgatcga            105 21  0 52.38 60.037 34.38  0.00 46.11  1.037 | ||||
|   30 tcatctctgcgcgatcgat              363 19  0 52.63 59.946 22.07  0.12 38.48  1.054 | ||||
|   31 atcatctctgcgcgatcga              362 19  0 52.63 59.946 22.07  1.72 38.48  1.054 | ||||
|   32 atcgatcgatgtgcggcta               82 19  0 52.63 59.945 29.65  0.00 41.65  1.055 | ||||
|   33 gtagcggcgatctagctagc             578 20  0 60.00 61.071 16.97  7.15 39.86  1.071 | ||||
|   34 gctagctgactgatcgatcg             109 20  0 55.00 58.924 16.84 13.89  0.00  1.076 | ||||
|   35 gctgatcgatcgatgtgcg               78 19  0 57.89 60.097 29.87 18.15 42.69  1.097 | ||||
|   36 tatcatctctgcgcgatcgat            361 21  0 47.62 60.172 22.07 11.47 38.48  1.172 | ||||
|   37 gctagctagctgatcgatcga            390 21  0 52.38 60.172 34.38 22.52 46.11  1.172 | ||||
|   38 gctagctagctgatcgatcga             70 21  0 52.38 60.172 34.38 22.52 46.11  1.172 | ||||
|   39 catctctgcgcgatcgatg              364 19  0 57.89 59.810 13.74 13.74 38.48  1.190 | ||||
|   40 tcgtagcggcgatctagcta             576 20  0 55.00 61.231 11.55  9.27 36.40  1.231 | ||||
|   41 actgatacgcgatgctagcta            476 21  0 47.62 59.765 17.69  3.08  0.00  1.235 | ||||
|   42 actgatcgatcgatgctagct            117 21  0 47.62 59.763 23.29 11.70 35.21  1.237 | ||||
|   43 agctagctgatcgatcgatgt             73 21  0 47.62 59.763 17.99  2.62 35.21  1.237 | ||||
|   44 tagcggcgatctagctagct             579 20  0 55.00 61.243 23.74 23.74 46.60  1.243 | ||||
|   45 cgtagcggcgatctagcta              577 19  0 57.89 59.729 11.55  9.27 37.58  1.271 | ||||
|   46 ctagctgatcgatcgtagcg             564 20  0 55.00 58.727 25.02 15.05  0.00  1.273 | ||||
|   47 tagcggcgatctagctagc              579 19  0 57.89 59.725 16.97  9.14 39.86  1.275 | ||||
|   48 catcgatcgatgcatgcatg             442 20  0 50.00 58.722 37.80 23.31 44.93  1.278 | ||||
|   49 tcatctctgcgcgatcgatg             363 20  0 55.00 61.279 18.01 18.01 38.48  1.279 | ||||
|   50 gctagctagctgatcgatcg             559 20  0 55.00 58.714 34.38 11.90 46.11  1.286 | ||||
|   51 gctagctagctgatcgatcg             390 20  0 55.00 58.714 34.38 11.90 46.11  1.286 | ||||
|   52 gctagctagctgatcgatcg              70 20  0 55.00 58.714 34.38 11.90 46.11  1.286 | ||||
|   53 agcatcggattagctagctga              3 21  0 47.62 59.689 28.29 20.88  0.00  1.311 | ||||
|   54 agctgatcgatcgtagcgg              566 19  0 57.89 60.315 25.02 17.36  0.00  1.315 | ||||
|   55 cggcgatctagctagctga              582 19  0 57.89 59.650 21.57 16.66 38.70  1.350 | ||||
|   56 ctagctgatcgatcgatgtgc             75 21  0 52.38 59.643 31.83 30.04 35.21  1.357 | ||||
|   57 gctagctgatcgatcgatgtg             74 21  0 52.38 59.643 12.06  6.93 35.21  1.357 | ||||
|   58 gctagctaggcgatgctagc             412 20  0 60.00 61.357 30.41 30.41 46.19  1.357 | ||||
|   59 tagctagctgactgatacgcg            466 21  0 52.38 60.373 28.29  3.89  0.00  1.373 | ||||
|   60 gctagctgactgatcgatcga            109 21  0 52.38 60.374 22.52 22.52  0.00  1.374 | ||||
|   61 agctagctgactgatcgatcg            108 21  0 52.38 60.374 17.99 13.89  0.00  1.374 | ||||
|   62 cgatcgatgctagctaggcg             404 20  0 60.00 61.409 15.59  9.14  0.00  1.409 | ||||
|   63 gctagctagctgactgatcg             105 20  0 55.00 58.563 34.38  1.84 46.11  1.437 | ||||
|   64 atgctagctaggcgatgct              410 19  0 52.63 59.561 10.59  7.53  0.00  1.439 | ||||
|   65 agctagctgatcgatcgtagc            562 21  0 52.38 60.441 26.87 26.87  0.00  1.441 | ||||
|   66 gctagctagctgatcgatcgt            559 21  0 52.38 60.441 34.38  2.65 46.11  1.441 | ||||
|   67 tagctaggcgatgctagctag            414 21  0 52.38 59.559 18.42 17.46 42.44  1.441 | ||||
|   68 ctagctaggcgatgctagcta            413 21  0 52.38 59.559 18.69 17.64 42.44  1.441 | ||||
|   69 tagctgatcgatcgatgtgc              76 20  0 50.00 58.558 31.83 30.04 35.21  1.442 | ||||
|   70 gatgctagctaggcgatgcta            409 21  0 52.38 60.444  9.82  8.91  0.00  1.444 | ||||
|   71 atgctagctaggcgatgctag            410 21  0 52.38 60.444 23.16 23.16 38.59  1.444 | ||||
|   72 gctagctgatcatcgatgct             191 20  0 50.00 58.539 16.29 12.14  0.00  1.461 | ||||
|   73 agctagctgatcatcgatgc             190 20  0 50.00 58.539 21.42  9.22  0.00  1.461 | ||||
|   74 gctgactgatacgcgatgct             472 20  0 55.00 61.494  2.33  0.00  0.00  1.494 | ||||
|   75 agctgactgatacgcgatgc             471 20  0 55.00 61.494  3.47  0.00  0.00  1.494 | ||||
|   76 ggcgatctagctagctgacta            583 21  0 52.38 59.491 17.44  5.40 37.58  1.509 | ||||
|   77 gatcgatgctagctaggcgat            405 21  0 52.38 60.510 21.61 21.61  0.00  1.510 | ||||
|   78 atcgatcgatgctagctaggc            402 21  0 52.38 60.510 29.65  8.45 33.56  1.510 | ||||
|   79 ctgatcgatcgatgtgcgg               79 19  0 57.89 59.447 15.54  5.83 41.65  1.553 | ||||
|   80 agctgatcgatcgatgtgcg              77 20  0 55.00 61.556 31.92 20.26 42.69  1.556 | ||||
|   81 cgatcatcgatgctagctagc            548 21  0 52.38 59.444 34.89 34.89 46.99  1.556 | ||||
|   82 tagctaggcgatgctagcta             414 20  0 50.00 58.433 19.37 17.81 42.44  1.567 | ||||
|   83 agctagctactgatcgatgct            303 21  0 47.62 59.415 17.56 11.51  0.00  1.585 | ||||
|   84 tcgatcgatgtgcggctag               83 19  0 57.89 60.606 18.63  0.00 41.65  1.606 | ||||
|   85 gactgatcgatcgatgctagc            116 21  0 52.38 59.378 15.86  8.45 35.21  1.622 | ||||
|   86 agctagctgactgatcgatca            260 21  0 47.62 59.347 26.99 26.99 35.44  1.653 | ||||
|   87 ctgactgatacgcgatgctag            473 21  0 52.38 59.312  1.70  0.00  0.00  1.688 | ||||
|   88 ctagctgactgatacgcgatg            469 21  0 52.38 59.312  0.00  0.00  0.00  1.688 | ||||
|   89 gctactatcatctctgcgcga            356 21  0 52.38 60.707  2.71  2.71  0.00  1.707 | ||||
|   90 agctactatcatctctgcgcg            355 21  0 52.38 60.709  0.00  0.00  0.00  1.709 | ||||
|   91 actatcatctctgcgcgatc             359 20  0 50.00 58.270  4.99  0.00  0.00  1.730 | ||||
|   92 actgatcgatcgatgctagc             117 20  0 50.00 58.270 23.29 13.61 35.21  1.730 | ||||
|   93 gctagctgatcgatcgatgt              74 20  0 50.00 58.270 14.29  2.62 35.21  1.730 | ||||
|   94 ctatcatctctgcgcgatcga            360 21  0 52.38 60.771 22.07  1.72 38.48  1.771 | ||||
|   95 atcgatgctagctaggcgatg            406 21  0 52.38 60.779 21.16  4.37  0.00  1.779 | ||||
|   96 tgactgatacgcgatgctag             474 20  0 50.00 58.207  1.70  0.00  0.00  1.793 | ||||
|   97 ctgactgatacgcgatgcta             473 20  0 50.00 58.207  2.33  0.00  0.00  1.793 | ||||
|   98 tagctgactgatacgcgatg             470 20  0 50.00 58.207  0.00  0.00  0.00  1.793 | ||||
|   99 ctgactgatcgatcgatgct             114 20  0 50.00 58.197 26.44 12.40 35.21  1.803 | ||||
|  100 agctgactgatcgatcgatg             112 20  0 50.00 58.197 23.05 13.21 35.21  1.803 | ||||
|  101 tcggattagctagctgatgc               7 20  0 50.00 58.176 17.46 17.46 40.05  1.824 | ||||
|  102 gcatcggattagctagctga               4 20  0 50.00 58.176 28.29 20.88  0.00  1.824 | ||||
|  103 agcatcggattagctagctg               3 20  0 50.00 58.171 28.29 10.80  0.00  1.829 | ||||
|  104 gatgctagctaggcgatgc              409 19  0 57.89 59.141  4.18  0.00  0.00  1.859 | ||||
|  105 ctgatacgcgatgctagctag            477 21  0 52.38 59.113 17.46 17.46  0.00  1.887 | ||||
|  106 gctagctgactgatacgcg              468 19  0 57.89 59.086  8.21  3.89  0.00  1.914 | ||||
|  107 ctctgcgcgatcgatgctag             367 20  0 60.00 61.946 21.94 18.16 38.48  1.946 | ||||
|  108 tctgcgcgatcgatgctag              368 19  0 57.89 60.966 21.94 18.16 38.48  1.966 | ||||
|  109 ctctgcgcgatcgatgcta              367 19  0 57.89 60.966 26.61 17.10 38.48  1.966 | ||||
|  110 cgatgctagctaggcgatgc             408 20  0 60.00 61.968 11.09  0.00  0.00  1.968 | ||||
|  111 gactgatacgcgatgctagct            475 21  0 52.38 60.975 17.69  1.35  0.00  1.975 | ||||
|  112 gctagctgactgatacgcgat            468 21  0 52.38 60.975  8.21  0.00  0.00  1.975 | ||||
|  113 tgatacgcgatgctagctag             478 20  0 50.00 57.994 17.46 17.46  0.00  2.006 | ||||
|  114 ctgatacgcgatgctagcta             477 20  0 50.00 57.994 17.69  3.08  0.00  2.006 | ||||
|  115 cgcgatcgatgctagctagc             372 20  0 60.00 62.011 34.89 34.89 43.67  2.011 | ||||
|  116 gcgcgatcgatgctagctag             371 20  0 60.00 62.011 21.66 17.46 38.48  2.011 | ||||
|  117 ctgatcgatcgatgctagct             399 20  0 50.00 57.983 19.70  2.01 35.21  2.017 | ||||
|  118 agctgatcgatcgatgctag             397 20  0 50.00 57.983 27.33 18.05 34.69  2.017 | ||||
|  119 ctagctgatcgatcgatgct             395 20  0 50.00 57.983 33.87 33.38 38.16  2.017 | ||||
|  120 agctagctgatcgatcgatg             393 20  0 50.00 57.983 21.99 11.03 35.21  2.017 | ||||
|  121 ctgatcgatcgatgctagct             118 20  0 50.00 57.983 19.70  2.01 35.21  2.017 | ||||
|  122 agctagctgatcgatcgatg              73 20  0 50.00 57.983 21.99 11.03 35.21  2.017 | ||||
|  123 catcggattagctagctgatgc             5 22  0 50.00 59.982 24.41 24.41 40.05  2.018 | ||||
|  124 gcatcggattagctagctgatg             4 22  0 50.00 59.982 27.81 27.81 33.28  2.018 | ||||
|  125 tcgatgctagctaggcgat              407 19  0 52.63 58.964 14.03  3.01  0.00  2.036 | ||||
|  126 atcgatgctagctaggcga              406 19  0 52.63 58.964 16.30 16.30  0.00  2.036 | ||||
|  127 actatcatctctgcgcgatcg            359 21  0 52.38 61.037 12.19 12.19 39.07  2.037 | ||||
|  128 gcgcgatcgatgctagcta              371 19  0 57.89 61.037 21.66  3.08 38.48  2.037 | ||||
|  129 gctgatcgatcgatgctagct            398 21  0 52.38 61.044 27.88 12.70 35.21  2.044 | ||||
|  130 agctgatcgatcgatgctagc            397 21  0 52.38 61.044 27.33 27.90 34.69  2.044 | ||||
|  131 gctagctgatcgatcgatgct            394 21  0 52.38 61.044 33.87 33.38 38.16  2.044 | ||||
|  132 agctagctgatcgatcgatgc            393 21  0 52.38 61.044 24.08 21.09 35.21  2.044 | ||||
|  133 cgcgatcgatgctagctag              372 19  0 57.89 58.947 22.07 17.46 38.48  2.053 | ||||
|  134 tcgtagcggcgatctagc               576 18  0 61.11 59.936  4.70  0.00 36.40  2.064 | ||||
|  135 cgtagcggcgatctagct               577 18  0 61.11 59.935 11.03 11.03 37.58  2.065 | ||||
|  136 gcggcgatctagctagct               581 18  0 61.11 59.933 23.74 23.74 38.05  2.067 | ||||
|  137 agcggcgatctagctagc               580 18  0 61.11 59.933 16.97  7.15 39.86  2.067 | ||||
|  138 ctagctgactgatacgcgat             469 20  0 50.00 57.918  1.43  0.00  0.00  2.082 | ||||
|  139 ctagctgatcgatcgtagcgg            564 21  0 57.14 61.096 20.31 16.15  0.00  2.096 | ||||
|  140 agctactatcatctctgcgc             355 20  0 50.00 57.898  0.00  0.00  0.00  2.102 | ||||
|  141 gctagctactgatcgatgct             304 20  0 50.00 57.898 11.51 11.51  0.00  2.102 | ||||
|  142 agctagctactgatcgatgc             303 20  0 50.00 57.898 17.56  1.76  0.00  2.102 | ||||
|  143 agcatcggattagctagctgat             3 22  0 45.45 60.108 17.84 15.13  0.00  2.108 | ||||
|  144 tgctagctaggcgatgcta              411 19  0 52.63 58.881 17.69  8.91  0.00  2.119 | ||||
|  145 aagcatcggattagctagctg              2 21  0 47.62 58.879 28.29 10.80  0.00  2.121 | ||||
|  146 tctgcgcgatcgatgcta               368 18  0 55.56 59.857 26.61 16.13 38.48  2.143 | ||||
|  147 cgatgctagctaggcgatg              408 19  0 57.89 58.856 11.09  0.00  0.00  2.144 | ||||
|  148 agctagctgatcatcgatgcta           190 22  0 45.45 59.845 17.99 13.09  0.00  2.155 | ||||
|  149 tagctagctgatcatcgatgct           189 22  0 45.45 59.845 16.29 15.30  0.00  2.155 | ||||
|  150 atcgatcgatgtgcggct                82 18  0 55.56 60.166 29.65  4.36 41.65  2.166 | ||||
|  151 gctagctgactgatcgatca             261 20  0 50.00 57.829 26.99 26.99 35.44  2.171 | ||||
|  152 tagctagctgactgatcgatcg           107 22  0 50.00 60.174 28.29 13.89  0.00  2.174 | ||||
|  153 agctgatcatcatcgatgct             515 20  0 45.00 57.788 11.25  0.72 40.32  2.212 | ||||
|  154 agctagctgactgatcgatcat           260 22  0 45.45 59.778 26.67 18.02 36.62  2.222 | ||||
|  155 tgactgatacgcgatgctagc            474 21  0 52.38 61.238  8.61  8.61  0.00  2.238 | ||||
|  156 gctgactgatacgcgatgcta            472 21  0 52.38 61.238  2.33  0.00  0.00  2.238 | ||||
|  157 tagctgactgatacgcgatgc            470 21  0 52.38 61.238  3.47  0.00  0.00  2.238 | ||||
|  158 tagctagctgatcgatcgtagc           561 22  0 50.00 60.238 26.87 26.87  0.00  2.238 | ||||
|  159 gctagctagctgatcgatcgta           559 22  0 50.00 60.238 34.38  3.07 46.11  2.238 | ||||
|  160 tgatcgatcgatgctagctagg           400 22  0 50.00 60.239 26.44  6.29 35.21  2.239 | ||||
|  161 gctgactgatcgatcgatgct            113 21  0 52.38 61.244 26.44 12.40 35.21  2.244 | ||||
|  162 agctgactgatcgatcgatgc            112 21  0 52.38 61.244 24.08 19.43 35.21  2.244 | ||||
|  163 gatcgatcgatgtgcggct               81 19  0 57.89 61.263 19.16  0.00 41.65  2.263 | ||||
|  164 gctgatcatcgatgctactagc           195 22  0 50.00 59.727 18.08 16.44 45.61  2.273 | ||||
|  165 gctagctgatcatcgatgctac           191 22  0 50.00 59.727  9.57  5.47  0.00  2.273 | ||||
|  166 gatcgatcgatgtgcggc                81 18  0 61.11 59.714 18.10  0.95 41.65  2.286 | ||||
|  167 ctagctagctgactgatacgc            465 21  0 52.38 58.703 14.90  0.00  0.00  2.297 | ||||
|  168 tagctgatcgatcgatgtgcg             76 21  0 52.38 61.299 31.92 20.26 42.69  2.299 | ||||
|  169 agctgatcgatcgatgtgc               77 19  0 52.63 58.698 31.83 30.04 35.21  2.302 | ||||
|  170 gctgatcatcatcgatgctagc           516 22  0 50.00 60.302 10.80 10.34 40.32  2.302 | ||||
|  171 gctagctgatcatcatcgatgc           512 22  0 50.00 60.302 21.42  7.40 40.32  2.302 | ||||
|  172 aagcatcggattagctagctga             2 22  0 45.45 60.306 28.29 20.88  0.00  2.306 | ||||
|  173 gatcgatcgtagcggcga               570 18  0 61.11 60.318 13.01  8.51 45.59  2.318 | ||||
|  174 atcggattagctagctgatgc              6 21  0 47.62 58.673 17.46 17.46 40.05  2.327 | ||||
|  175 gcatcggattagctagctgat              4 21  0 47.62 58.673 17.84 15.13  0.00  2.327 | ||||
|  176 gcggcgatctagctagctg              581 19  0 63.16 61.329 17.07  8.17 38.05  2.329 | ||||
|  177 tgctagtgatgcatgctagt              24 20  0 45.00 57.636 24.96 11.17 35.89  2.364 | ||||
|  178 ctactatcatctctgcgcga             357 20  0 50.00 57.636  2.71  2.71  0.00  2.364 | ||||
|  179 actagctagctgactgatacgc           464 22  0 50.00 60.368 21.52  0.00  0.00  2.368 | ||||
|  180 gctagctagctgatcatcga             187 20  0 50.00 57.613 34.38  0.24 46.11  2.387 | ||||
|  181 tctctgcgcgatcgatgcta             366 20  0 55.00 62.413 26.61 17.10 38.48  2.413 | ||||
|  182 tgatcgatcgatgctagctagt           119 22  0 45.45 59.586 26.44  5.69 35.21  2.414 | ||||
|  183 actgatcgatcgatgctagcta           117 22  0 45.45 59.586 23.29  7.65 35.21  2.414 | ||||
|  184 tagctagctgatcgatcgatgt            72 22  0 45.45 59.586 14.29  2.62 35.21  2.414 | ||||
|  185 agctaggcgatgctagcta              415 19  0 52.63 58.572 17.69  3.08 41.54  2.428 | ||||
|  186 tagctaggcgatgctagct              414 19  0 52.63 58.572 17.35 17.35 43.53  2.428 | ||||
|  187 gatcgatcgatgctagctagg            401 21  0 52.38 58.567 23.89  6.29 35.21  2.433 | ||||
|  188 gctagctagctgactgatcgat           105 22  0 50.00 60.434 34.38  0.00 46.11  2.434 | ||||
|  189 gatcgatgctagctaggcg              405 19  0 57.89 58.563 15.59  9.02  0.00  2.437 | ||||
|  190 cgatcgatgctagctaggc              404 19  0 57.89 58.563 14.87  8.45  0.00  2.437 | ||||
|  191 tagctagctgactgatacgc             466 20  0 50.00 57.549 28.29  0.00  0.00  2.451 | ||||
|  192 agctagctgactgatcgatc             260 20  0 50.00 57.536 19.32 19.32  0.00  2.464 | ||||
|  193 agctagctgactgatcgatc             108 20  0 50.00 57.536 19.32 19.32  0.00  2.464 | ||||
|  194 aaagcatcggattagctagctg             1 22  0 45.45 59.524 28.29 10.80  0.00  2.476 | ||||
|  195 gctgactgatcgatcatcatgc           265 22  0 50.00 60.493 25.66 25.12 41.77  2.493 | ||||
|  196 tagctactatcatctctgcgcg           354 22  0 50.00 60.495  0.00  0.00  0.00  2.495 | ||||
|  197 ctgatcgatcgatgtgcggc              79 20  0 60.00 62.497 15.54  4.15 41.65  2.497 | ||||
|  198 gctgatcgatcgatgtgcgg              78 20  0 60.00 62.497 29.87 22.23 41.65  2.497 | ||||
|  199 tcgtagcggcgatctagct              576 19  0 57.89 61.503 11.03 11.03 36.40  2.503 | ||||
|  200 agcggcgatctagctagct              580 19  0 57.89 61.519 23.74 23.74 42.96  2.519 | ||||
|  201 ctagctagctgatcatcgatgc           188 22  0 50.00 59.470 21.42  9.22  0.00  2.530 | ||||
|  202 gctagctagctgatcatcgatg           187 22  0 50.00 59.470 34.38 20.23 46.11  2.530 | ||||
|  203 tcatctctgcgcgatcga               363 18  0 55.56 59.468 22.07  0.00 38.48  2.532 | ||||
|  204 tcgatcgatgtgcggcta                83 18  0 55.56 59.465 18.63  0.00 41.65  2.535 | ||||
|  205 tgatcgatcgatgtgcggc               80 19  0 57.89 61.549 21.27  8.44 41.65  2.549 | ||||
|  206 ctagctaggcgatgctagctag           413 22  0 54.55 60.561 22.99 22.99 46.84  2.561 | ||||
|  207 gctagctagctgatcgatcgat           390 22  0 50.00 60.561 34.38 30.53 46.11  2.561 | ||||
|  208 gctagctagctgatcgatcgat            70 22  0 50.00 60.561 34.38 30.53 46.11  2.561 | ||||
|  209 ctgcgcgatcgatgctag               369 18  0 61.11 59.415 19.79 13.97 38.48  2.585 | ||||
|  210 aagcatcggattagctagct               2 20  0 45.00 57.413 23.74 23.74  0.00  2.587 | ||||
|  211 gctagctgatcatcgatgcta            191 21  0 47.62 58.410 16.61 13.09  0.00  2.590 | ||||
|  212 tagctagctgatcatcgatgc            189 21  0 47.62 58.410 21.42  9.22  0.00  2.590 | ||||
|  213 actgatacgcgatgctagc              476 19  0 52.63 58.407  8.61  8.61  0.00  2.593 | ||||
|  214 gctagctgactgatcgatcatc           261 22  0 50.00 59.406 23.93 21.92 36.62  2.594 | ||||
|  215 atcgatcgatgctagctagg             402 20  0 50.00 57.396 29.65  6.29 33.56  2.604 | ||||
|  216 atctctgcgcgatcgatgc              365 19  0 57.89 61.618 22.01 22.01 38.48  2.618 | ||||
|  217 tgatcgatcgtagcggcg               569 18  0 61.11 60.621 20.58  0.86  0.00  2.621 | ||||
|  218 atcatctctgcgcgatcgatg            362 21  0 52.38 61.633 18.01 18.01 38.48  2.633 | ||||
|  219 agctagctgatcgatcgtag             562 20  0 50.00 57.344 17.99 16.86  0.00  2.656 | ||||
|  220 ctagctagctgatcgatcgt             560 20  0 50.00 57.344 16.40  2.65  0.00  2.656 | ||||
|  221 gctagctgactgatcgatcat            261 21  0 47.62 58.339 26.67 18.02 36.62  2.661 | ||||
|  222 ctgatcgatcgtagcggcg              568 19  0 63.16 61.664 14.21  0.86  0.00  2.664 | ||||
|  223 ctgactgatacgcgatgct              473 19  0 52.63 58.330  2.33  0.00  0.00  2.670 | ||||
|  224 agctgactgatacgcgatg              471 19  0 52.63 58.330  0.00  0.00  0.00  2.670 | ||||
|  225 gctagctgatcgatcgtagcg            563 21  0 57.14 61.676 24.18 16.49  0.00  2.676 | ||||
|  226 ctagctgactgatcgatcga             110 20  0 50.00 57.276 22.52 22.52  0.00  2.724 | ||||
|  227 agctagctactgatcgatgcta           303 22  0 45.45 59.252 17.56 12.23  0.00  2.748 | ||||
|  228 tagctagctactgatcgatgct           302 22  0 45.45 59.252 27.80 11.51  0.00  2.748 | ||||
|  229 gactgatacgcgatgctagcta           475 22  0 50.00 60.751 17.69  3.08  0.00  2.751 | ||||
|  230 actgatacgcgatgctagctag           476 22  0 50.00 60.752 17.46 17.46  0.00  2.752 | ||||
|  231 gactgatcgatcgatgctagct           116 22  0 50.00 60.753 18.04  9.56 35.21  2.753 | ||||
|  232 gctagctgactgatcgatcgat           109 22  0 50.00 60.753 30.53 30.53 37.90  2.753 | ||||
|  233 tgcgcgatcgatgctagcta             370 20  0 55.00 62.756 26.61  9.85 38.48  2.756 | ||||
|  234 gcggcgatctagctagctga             581 20  0 60.00 62.765 21.57 16.66 38.70  2.765 | ||||
|  235 agcggcgatctagctagctg             580 20  0 60.00 62.771 17.07  8.17 44.87  2.771 | ||||
|  236 ctactatcatctctgcgcgatc           357 22  0 50.00 59.220  4.99  0.00  0.00  2.780 | ||||
|  237 tatcatctctgcgcgatcg              361 19  0 52.63 58.199 12.19 12.19 39.07  2.801 | ||||
|  238 tactatcatctctgcgcgatcg           358 22  0 50.00 60.811 12.19 12.19 39.07  2.811 | ||||
|  239 tagctagctgactgatcgatca           259 22  0 45.45 59.187 28.29 26.99 35.44  2.813 | ||||
|  240 gctgatcgatcgatgctagcta           398 22  0 50.00 60.816 27.88 12.57 35.21  2.816 | ||||
|  241 tagctgatcgatcgatgctagc           396 22  0 50.00 60.816 30.84 27.90 36.80  2.816 | ||||
|  242 gctagctgatcgatcgatgcta           394 22  0 50.00 60.816 34.11 32.56 36.80  2.816 | ||||
|  243 tagctagctgatcgatcgatgc           392 22  0 50.00 60.816 24.08 21.09 35.21  2.816 | ||||
|  244 gctaggcgatgctagctag              416 19  0 57.89 58.179 17.46 17.46 35.42  2.821 | ||||
|  245 ctagctaggcgatgctagc              413 19  0 57.89 58.179 18.68  9.44 36.95  2.821 | ||||
|  246 gctagctaggcgatgctag              412 19  0 57.89 58.179 23.16 23.16 38.59  2.821 | ||||
|  247 catctctgcgcgatcgatgc             364 20  0 60.00 62.823 22.01 22.01 38.48  2.823 | ||||
|  248 aaagcatcggattagctagct              1 21  0 42.86 58.168 23.74 23.74  0.00  2.832 | ||||
|  249 ctgactgatcgatcgatgctag           114 22  0 50.00 59.155 22.81 19.44 35.21  2.845 | ||||
|  250 ctagctgactgatcgatcgatg           110 22  0 50.00 59.155 23.05 13.21 35.21  2.845 | ||||
|  251 tactatcatctctgcgcgatc            358 21  0 47.62 58.155  4.99  0.00  0.00  2.845 | ||||
|  252 gctagctactgatcgatgctac           304 22  0 50.00 59.151  8.57  4.26  0.00  2.849 | ||||
|  253 ctactatcatctctgcgcgat            357 21  0 47.62 58.150  4.99  2.52  0.00  2.850 | ||||
|  254 agctgatcatcgatgctact             194 20  0 45.00 57.134 17.14  8.95  0.00  2.866 | ||||
|  255 gctagctagctgatcatcgat            187 21  0 47.62 58.132 34.38  0.00 46.11  2.868 | ||||
|  256 ctgatacgcgatgctagct              477 19  0 52.63 58.107 17.69  1.35  0.00  2.893 | ||||
|  257 ggcgatctagctagctgac              583 19  0 57.89 58.106 14.84  7.25 37.58  2.894 | ||||
|  258 tgactgatcgatcgatgctag            115 21  0 47.62 58.084 22.81 19.44 35.21  2.916 | ||||
|  259 ctgactgatcgatcgatgcta            114 21  0 47.62 58.084 26.44 14.64 35.21  2.916 | ||||
|  260 tagctgactgatcgatcgatg            111 21  0 47.62 58.084 23.05 13.21 35.21  2.916 | ||||
|  261 actgatcgatcatcatgctagc           269 22  0 45.45 59.071 26.67  8.61 41.77  2.929 | ||||
|  262 agctgactgatcgatcatca             264 20  0 45.00 57.064 26.49 26.49 39.98  2.936 | ||||
|  263 ctagctagctgatcgatcga             391 20  0 50.00 57.060 22.52 22.52  0.00  2.940 | ||||
|  264 ctagctagctgatcgatcga              71 20  0 50.00 57.060 22.52 22.52  0.00  2.940 | ||||
|  265 gatcgatcgatgtgcggctag             81 21  0 57.14 61.947 19.16  0.00 41.65  2.947 | ||||
|  266 tgctagctaggcgatgct               411 18  0 55.56 59.050 17.69  7.53  0.00  2.950 | ||||
|  267 gctgatcgatcgtagcggc              567 19  0 63.16 61.960 20.49 19.38  0.00  2.960 | ||||
|  268 cgatcgatgtgcggctag                84 18  0 61.11 59.032 10.82  0.00 41.65  2.968 | ||||
|  269 tgatcgatcgatgtgcggct              80 20  0 55.00 62.987 22.21  0.00 41.65  2.987 | ||||
|  270 ctgactgatcgatcatcatgct           266 22  0 45.45 59.004 20.99  6.82 41.77  2.996 | ||||
|  271 agctgactgatcgatcatcatg           264 22  0 45.45 59.004 22.70 19.51 41.77  2.996 | ||||
|  272 agctagctgactgatacgcga            467 21  0 52.38 62.000 17.99  0.00  0.00  3.000 | ||||
|  273 tgactgatcgatcgatgctagc           115 22  0 50.00 61.008 18.17 12.52 35.21  3.008 | ||||
|  274 gctgactgatcgatcgatgcta           113 22  0 50.00 61.008 26.44 14.64 35.21  3.008 | ||||
|  275 tagctgactgatcgatcgatgc           111 22  0 50.00 61.008 24.08 19.43 35.21  3.008 | ||||
|  276 agctagctgatcgatcgatgtg            73 22  0 50.00 61.010 17.99  6.93 35.21  3.010 | ||||
|  277 ctgatcgatcgatgctagctag           399 22  0 50.00 58.963 19.70 17.46 35.21  3.037 | ||||
|  278 ctagctgatcgatcgatgctag           395 22  0 50.00 58.963 37.86 37.86 43.17  3.037 | ||||
|  279 ctagctagctgatcgatcgatg           391 22  0 50.00 58.963 21.99 11.03 35.21  3.037 | ||||
|  280 ctgatcgatcgatgctagctag           118 22  0 50.00 58.963 19.70 17.46 35.21  3.037 | ||||
|  281 ctagctagctgatcgatcgatg            71 22  0 50.00 58.963 21.99 11.03 35.21  3.037 | ||||
|  282 gactgatcgatcatcatgctagc          268 23  0 47.83 60.053 24.51  9.03 41.77  3.053 | ||||
|  283 gctagtgatgcatgctagtagtg           25 23  0 47.83 59.929 24.96 10.54  0.00  3.071 | ||||
|  284 gctactatcatctctgcgcgat           356 22  0 50.00 61.073  4.99  2.52  0.00  3.073 | ||||
|  285 gtagcggcgatctagctag              578 19  0 57.89 57.903 15.64 15.64 37.58  3.097 | ||||
|  286 tgactgatcgatcatcatgct            267 21  0 42.86 57.900 26.79 12.28 41.77  3.100 | ||||
|  287 ctagctactatcatctctgcgc           353 22  0 50.00 58.892  0.00  0.00  0.00  3.108 | ||||
|  288 gctagctactatcatctctgcg           352 22  0 50.00 58.892  8.21  0.00  0.00  3.108 | ||||
|  289 ctagctagctactgatcgatgc           301 22  0 50.00 58.892 14.00  1.76  0.00  3.108 | ||||
|  290 gctagctagctactgatcgatg           300 22  0 50.00 58.892 34.38  7.78 46.11  3.108 | ||||
|  291 catcgatcgatgctagtatgct           325 22  0 45.45 58.885 37.80 10.02 44.93  3.115 | ||||
|  292 tgatcgatcgatgctagctag            400 21  0 47.62 57.879 26.44 17.46 35.21  3.121 | ||||
|  293 ctgatcgatcgatgctagcta            399 21  0 47.62 57.879 19.70  3.77 35.21  3.121 | ||||
|  294 tagctgatcgatcgatgctag            396 21  0 47.62 57.879 34.03 27.12 36.80  3.121 | ||||
|  295 ctagctgatcgatcgatgcta            395 21  0 47.62 57.879 34.11 32.56 36.80  3.121 | ||||
|  296 tagctagctgatcgatcgatg            392 21  0 47.62 57.879 21.99 11.03 35.21  3.121 | ||||
|  297 tgatcgatcgatgctagctag            119 21  0 47.62 57.879 26.44 17.46 35.21  3.121 | ||||
|  298 ctgatcgatcgatgctagcta            118 21  0 47.62 57.879 19.70  3.77 35.21  3.121 | ||||
|  299 tagctagctgatcgatcgatg             72 21  0 47.62 57.879 21.99 11.03 35.21  3.121 | ||||
|  300 gatcgatcgatgctagctagt            120 21  0 47.62 57.878 23.89  3.56 35.21  3.122 | ||||
|  301 ctatcatctctgcgcgatcgat           360 22  0 50.00 61.132 22.07 11.47 38.48  3.132 | ||||
|  302 tgatcgatcgtagcggcga              569 19  0 57.89 62.144 20.58  8.51 45.59  3.144 | ||||
|  303 tcgtagcggcgatctagctag            576 21  0 57.14 62.173 15.64 15.64 36.40  3.173 | ||||
|  304 tactagctagctgactgatacgc          463 23  0 47.83 60.176 13.17  0.00  0.00  3.176 | ||||
|  305 ctgatcatcatcgatgctagct           517 22  0 45.45 58.807 17.69  1.76 40.32  3.193 | ||||
|  306 agctgatcatcatcgatgctag           515 22  0 45.45 58.807  5.93  2.76 40.32  3.193 | ||||
|  307 ctagctgatcatcatcgatgct           513 22  0 45.45 58.807 14.14  8.34 40.32  3.193 | ||||
|  308 agctagctgatcatcatcgatg           511 22  0 45.45 58.807 20.23 20.23 41.48  3.193 | ||||
|  309 ctgatcgatcatcatgctagct           270 22  0 45.45 58.807 26.67  0.00 41.77  3.193 | ||||
|  310 ctagctgactgatcgatcgat            110 21  0 47.62 57.806 30.53 30.53 37.90  3.194 | ||||
|  311 ttagctagctgactgatcgatca          258 23  0 43.48 59.798 28.29 26.99 35.44  3.202 | ||||
|  312 tagctactatcatctctgcgc            354 21  0 47.62 57.798  0.00  0.00  0.00  3.202 | ||||
|  313 gctagctactgatcgatgcta            304 21  0 47.62 57.798 12.99 12.23  0.00  3.202 | ||||
|  314 tagctagctactgatcgatgc            302 21  0 47.62 57.798 27.80  1.76  0.00  3.202 | ||||
|  315 tctctgcgcgatcgatgc               366 18  0 61.11 61.229 22.01 22.01 38.48  3.229 | ||||
|  316 ctctgcgcgatcgatgct               367 18  0 61.11 61.232 26.61  0.00 38.48  3.232 | ||||
|  317 agctagctactatcatctctgcg          351 23  0 47.83 60.238 17.56  0.00  0.00  3.238 | ||||
|  318 ctagctagctactgatcgatgct          301 23  0 47.83 60.238 14.00 11.51  0.00  3.238 | ||||
|  319 ctgatcgatcgtagcggc               568 18  0 61.11 58.727 14.21  0.00  0.00  3.273 | ||||
|  320 gctgatcgatcgtagcgg               567 18  0 61.11 58.727 20.49 15.03  0.00  3.273 | ||||
|  321 agctaggcgatgctagct               415 18  0 55.56 58.725 17.69 13.00 39.84  3.275 | ||||
|  322 tgctagtgatgcatgctagtagt           24 23  0 43.48 60.302 24.96 12.98 35.89  3.302 | ||||
|  323 gcgcgatcgatgctagct               371 18  0 61.11 61.306 21.66  1.35 38.48  3.306 | ||||
|  324 tgatcatcatcgatgctagct            518 21  0 42.86 57.691 17.69  1.76 40.32  3.309 | ||||
|  325 agctgatcatcatcgatgcta            515 21  0 42.86 57.691  0.24  0.00 40.32  3.309 | ||||
|  326 tagctgatcatcatcgatgct            514 21  0 42.86 57.691 14.14  8.34 40.32  3.309 | ||||
|  327 tgatcgatcatcatgctagct            271 21  0 42.86 57.691 27.48  0.00 37.38  3.309 | ||||
|  328 ctagctagctgactgatacgcg           465 22  0 54.55 61.313 14.90  3.89  0.00  3.313 | ||||
|  329 tgctagtgatgcatgctagtag            24 22  0 45.45 58.673 24.96 19.76 35.89  3.327 | ||||
|  330 gctagtgatgcatgctagtagt            25 22  0 45.45 58.672 24.96 12.98  0.00  3.328 | ||||
|  331 tagctagctgatcatcgatgcta          189 23  0 43.48 59.671 17.82 15.89  0.00  3.329 | ||||
|  332 agctagctgactgatacgc              467 19  0 52.63 57.642 17.99  0.00  0.00  3.358 | ||||
|  333 tatcatctctgcgcgatcgatg           361 22  0 50.00 61.383 18.01 18.01 38.48  3.383 | ||||
|  334 agctgactgatcgatcatcat            264 21  0 42.86 57.616 26.31 18.90 41.77  3.384 | ||||
|  335 actagctagctgatcatcatcga          508 23  0 43.48 59.607 22.43  0.00  0.00  3.393 | ||||
|  336 tagctagctgactgatcgatcat          259 23  0 43.48 59.607 28.29 18.02 36.62  3.393 | ||||
|  337 gatgctagctaggcgatgctag           409 22  0 54.55 61.393 23.16 23.16 38.59  3.393 | ||||
|  338 cggcgatctagctagctgact            582 21  0 57.14 62.394 17.44  7.44 38.70  3.394 | ||||
|  339 ctagctagctgatcgatcgat            391 21  0 47.62 57.600 30.53 30.53 37.90  3.400 | ||||
|  340 ctagctagctgatcgatcgat             71 21  0 47.62 57.600 30.53 30.53 37.90  3.400 | ||||
|  341 actgatcgatcatcatgctagct          269 23  0 43.48 60.428 26.67  4.70 41.77  3.428 | ||||
|  342 ctagctagctgactgatcgatc           106 22  0 50.00 58.567 19.32 19.32  0.00  3.433 | ||||
|  343 ctgactgatcgatcatcatgc            266 21  0 47.62 57.562 20.99 12.19 41.77  3.438 | ||||
|  344 gctgactgatcgatcatcatg            265 21  0 47.62 57.562 22.70 19.51 41.77  3.438 | ||||
|  345 gatcgatcgatgctagctaggc           401 22  0 54.55 61.448 23.89  8.45 35.21  3.448 | ||||
|  346 gtgatgcatgctagtagtgatgt           29 23  0 43.48 59.551 11.60  0.00  0.00  3.449 | ||||
|  347 tgctagtgatgcatgctagta             24 21  0 42.86 57.546 24.96 21.25 35.89  3.454 | ||||
|  348 tagcggcgatctagctagctg            579 21  0 57.14 62.457 18.98  9.30 45.57  3.457 | ||||
|  349 gtagcggcgatctagctagct            578 21  0 57.14 62.458 23.74 23.74 46.60  3.458 | ||||
|  350 tagctgatcgatcgtagcg              565 19  0 52.63 57.539 25.02 11.96  0.00  3.461 | ||||
|  351 gctagctagctactgatcgat            300 21  0 47.62 57.517 34.38  0.00 46.11  3.483 | ||||
|  352 agctagctactgatcgatgctac          303 23  0 47.83 60.487 17.56  7.81  0.00  3.487 | ||||
|  353 atcgatcgatgctagtatgct            326 21  0 42.86 57.502 29.65  2.17 33.56  3.498 | ||||
|  354 agctactgatcgatgctacatc           307 22  0 45.45 58.484  7.41  0.00 37.97  3.516 | ||||
|  355 agtgatgcatgctagtagtga             28 21  0 42.86 57.471  0.00  0.00  0.00  3.529 | ||||
|  356 gactgatcgatcgatgctagcta          116 23  0 47.83 60.546 18.04  4.19 35.21  3.546 | ||||
|  357 ctgatcgatcgatgctagctagt          118 23  0 47.83 60.547 22.18  3.56 35.21  3.547 | ||||
|  358 actgatcgatcgatgctagctag          117 23  0 47.83 60.547 23.29 17.46 35.21  3.547 | ||||
|  359 ctagctagctgatcgatcgatgt           71 23  0 47.83 60.547 14.29  2.62 35.21  3.547 | ||||
|  360 catcgatcgatgctagtatgc            325 21  0 47.62 57.452 37.80  0.00 44.93  3.548 | ||||
|  361 tagctagctgactgatcgatc            259 21  0 47.62 57.451 28.29 19.32  0.00  3.549 | ||||
|  362 tagctagctgactgatcgatc            107 21  0 47.62 57.451 28.29 19.32  0.00  3.549 | ||||
|  363 ctagctagctgactgatcgat            106 21  0 47.62 57.445 14.90  0.00  0.00  3.555 | ||||
|  364 tcgatgctagctaggcga               407 18  0 55.56 58.427 15.59 13.52  0.00  3.573 | ||||
|  365 tgatcgatcgatgctagctagta          119 23  0 43.48 59.424 26.44 18.77 35.21  3.576 | ||||
|  366 ctgcgcgatcgatgctagc              369 19  0 63.16 62.586 20.26 12.12 38.48  3.586 | ||||
|  367 agctagctgatcatcatcgat            511 21  0 42.86 57.405 17.99  0.00  0.00  3.595 | ||||
|  368 tgcgcgatcgatgctagc               370 18  0 61.11 61.605 26.61 17.77 38.48  3.605 | ||||
|  369 ctagctagctgatcgatcgtag           560 22  0 50.00 58.387 16.86 16.86  0.00  3.613 | ||||
|  370 actagctagctgactgatacg            464 21  0 47.62 57.384 21.52  2.77  0.00  3.616 | ||||
|  371 ctagctgactgatacgcga              469 19  0 52.63 57.370 16.29  0.00  0.00  3.630 | ||||
|  372 gctactagctagctgactgat            461 21  0 47.62 57.360 15.96  3.00 44.92  3.640 | ||||
|  373 ctgatcatcatcgatgctagc            517 21  0 47.62 57.358  8.61  8.61 40.32  3.642 | ||||
|  374 gctgatcatcatcgatgctag            516 21  0 47.62 57.358  5.93  2.76 40.32  3.642 | ||||
|  375 ctagctgatcatcatcgatgc            513 21  0 47.62 57.358 21.42  7.40 40.32  3.642 | ||||
|  376 gctagctgatcatcatcgatg            512 21  0 47.62 57.358 20.23 20.23 41.48  3.642 | ||||
|  377 ctgatcgatcatcatgctagc            270 21  0 47.62 57.358 26.67  8.61 41.77  3.642 | ||||
|  378 agctactgatcgatgctacat            307 21  0 42.86 57.344  7.41  0.00  0.00  3.656 | ||||
|  379 tgatcgatcgatgtgcggcta             80 21  0 52.38 62.663 22.21  0.24 41.65  3.663 | ||||
|  380 atctctgcgcgatcgatg               365 18  0 55.56 58.327 12.03  4.19 38.48  3.673 | ||||
|  381 catctctgcgcgatcgat               364 18  0 55.56 58.327 22.07  1.26 38.48  3.673 | ||||
|  382 atcatctctgcgcgatcg               362 18  0 55.56 58.327 12.19 12.19 39.07  3.673 | ||||
|  383 aagcatcggattagctagctgat            2 23  0 43.48 60.682 17.84 15.13  0.00  3.682 | ||||
|  384 agtgatgcatgctagtagtgatg           28 23  0 43.48 59.299  7.49  7.49  0.00  3.701 | ||||
|  385 gatcgatgctagctaggcgatg           405 22  0 54.55 61.702 24.26  6.24  0.00  3.702 | ||||
|  386 atctctgcgcgatcgatgcta            365 21  0 52.38 62.723 26.61 17.10 38.48  3.723 | ||||
|  387 tagctagctgactgatacgcga           466 22  0 50.00 61.730 28.29  0.00  0.00  3.730 | ||||
|  388 tagctagctgatcgatcgtag            561 21  0 47.62 57.269 16.86 16.86  0.00  3.731 | ||||
|  389 ctagctagctgatcgatcgta            560 21  0 47.62 57.269 11.68  3.07  0.00  3.731 | ||||
|  390 tcgatcgatgctagctagtag            122 21  0 47.62 57.269 18.63  2.63  0.00  3.731 | ||||
|  391 gctagctactgatcgatgctaca          304 23  0 47.83 60.734 11.21  0.06  0.00  3.734 | ||||
|  392 agctagctgactgatcgatcatc          260 23  0 47.83 60.736 23.93 21.92 36.62  3.736 | ||||
|  393 agctagctgactgatcgatcga           108 22  0 50.00 61.737 22.52 22.52  0.00  3.737 | ||||
|  394 tctctgcgcgatcgatgct              366 19  0 57.89 62.740 26.61  0.00 38.48  3.740 | ||||
|  395 tgatgcatgctagtagtgatgt            30 22  0 40.91 58.256 11.60  0.00  0.00  3.744 | ||||
|  396 tgatcgatcgatgtgcgg                80 18  0 55.56 58.244 21.27  0.00 41.65  3.756 | ||||
|  397 cgatcgatgctagctaggcga            404 21  0 57.14 62.770 16.30 16.30  0.00  3.770 | ||||
|  398 tcgatcgatgctagctaggcg            403 21  0 57.14 62.770 18.63 11.67  0.00  3.770 | ||||
|  399 atcgatcgatgcatgcatg              443 19  0 47.37 57.226 29.65 23.31 37.30  3.774 | ||||
|  400 catcgatcgatgcatgcat              442 19  0 47.37 57.226 37.80 33.45 44.93  3.774 | ||||
|  401 actagctagctgatcatcatcg           508 22  0 45.45 58.219 22.43  3.40  0.00  3.781 | ||||
|  402 ctgatcatcgatgctactagct           196 22  0 45.45 58.219 10.86  0.00 45.92  3.781 | ||||
|  403 agctgatcatcgatgctactag           194 22  0 45.45 58.219 13.67  9.68  0.00  3.781 | ||||
|  404 ctagctgatcatcgatgctact           192 22  0 45.45 58.219 14.85  7.80  0.00  3.781 | ||||
|  405 tttagctagctgactgatcga            257 21  0 42.86 57.216  0.38  0.00  0.00  3.784 | ||||
|  406 tagctagctgatcgatcgatgtg           72 23  0 47.83 60.793 10.14  4.94 35.21  3.793 | ||||
|  407 gctagctagctgatcatcatct           146 22  0 45.45 58.203 34.38  0.00 46.11  3.797 | ||||
|  408 ctagctagctgatcatcgatgct          188 23  0 47.83 60.799 16.29 15.30  0.00  3.799 | ||||
|  409 agctagctactatcatcgatcga          429 23  0 43.48 59.170 22.52 22.52  0.00  3.830 | ||||
|  410 ttagctagctgactgatcgatc           258 22  0 45.45 58.159 28.29 19.32  0.00  3.841 | ||||
|  411 ctagctgactgatcgatcatca           262 22  0 45.45 58.155 26.49 26.49 39.98  3.845 | ||||
|  412 aaagcatcggattagctagctga            1 23  0 43.48 60.870 28.29 20.88  0.00  3.870 | ||||
|  413 agctgactgatacgcgatgct            471 21  0 52.38 62.876  7.57  2.13  0.00  3.876 | ||||
|  414 tagctagctactgatcgatgcta          302 23  0 43.48 59.102 27.80 12.23  0.00  3.898 | ||||
|  415 tcatcatcgatgctagctagt            521 21  0 42.86 57.067 22.18  3.56 40.32  3.933 | ||||
|  416 tcgatcatcatgctagctact            274 21  0 42.86 57.067  0.00  0.00  0.00  3.933 | ||||
|  417 tgatcatcgatgctactagct            197 21  0 42.86 57.067 17.14  0.00 45.92  3.933 | ||||
|  418 agctgatcatcgatgctacta            194 21  0 42.86 57.067 17.14  4.89  0.00  3.933 | ||||
|  419 tagctgatcatcgatgctact            193 21  0 42.86 57.067 14.85  7.80  0.00  3.933 | ||||
|  420 tcgatcgatgctagtatgctag           327 22  0 45.45 58.044 18.63 13.77 46.09  3.956 | ||||
|  421 gcgatctagctagctgact              584 19  0 52.63 57.034 17.44  7.44  0.00  3.966 | ||||
|  422 gctactgatcgatgctacatc            308 21  0 47.62 57.028  2.44  0.00 37.97  3.972 | ||||
|  423 cggcgatctagctagctg               582 18  0 61.11 58.018 17.07  8.17 37.58  3.982 | ||||
|  424 gctagctgactgatcgatcatca          261 23  0 47.83 60.983 26.49 26.49 39.98  3.983 | ||||
|  425 actatcatctctgcgcgat              359 19  0 47.37 57.015  4.99  2.52  0.00  3.985 | ||||
|  426 catcggattagctagctgatg              5 21  0 47.62 57.003 23.69 23.29  0.00  3.997 | ||||
|  427 tagctgactgatcgatcatca            263 21  0 42.86 57.000 26.49 26.49 39.98  4.000 | ||||
|  428 actagctagctgatcatcatcgat         508 24  0 41.67 59.995 22.43  0.00  0.00  4.005 | ||||
|  429 agtgatgcatgctagtagtgat            28 22  0 40.91 57.984  0.00  0.00  0.00  4.016 | ||||
|  430 ctagctagctgatcatcatcga           509 22  0 45.45 57.958 11.68  0.00  0.00  4.042 | ||||
|  431 gctgatcatcgatgctactagct          195 23  0 47.83 61.046 20.91  5.24 45.92  4.046 | ||||
|  432 agctgatcatcgatgctactagc          194 23  0 47.83 61.046 20.78 20.78 45.61  4.046 | ||||
|  433 gctagctgatcatcgatgctact          191 23  0 47.83 61.046 12.59  8.92  0.00  4.046 | ||||
|  434 agctagctgatcatcgatgctac          190 23  0 47.83 61.046 17.99  7.99  0.00  4.046 | ||||
|  435 tagctagctactatcatctctgcg         350 24  0 45.83 60.058 27.80  0.00  0.00  4.058 | ||||
|  436 ctagctagctactgatcgatgcta         301 24  0 45.83 60.058 14.00 12.23  0.00  4.058 | ||||
|  437 agctactatcatctctgcgcga           355 22  0 50.00 62.058  2.71  2.71  0.00  4.058 | ||||
|  438 gctatttagctagctgactgatcg         253 24  0 45.83 60.060  7.27  0.00 46.11  4.060 | ||||
|  439 tgatcgatcatcatgctagctac          271 23  0 43.48 58.931 27.48  0.00 37.38  4.069 | ||||
|  440 gtgatgcatgctagtagtgatg            29 22  0 45.45 57.921  7.49  7.49  0.00  4.079 | ||||
|  441 ctagctagctgactgatcgatcg          106 23  0 52.17 61.091 16.84 13.89  0.00  4.091 | ||||
|  442 ctagctactgatcgatgctaca           305 22  0 45.45 57.898 13.79  1.61  0.00  4.102 | ||||
|  443 cggcgatctagctagctgacta           582 22  0 54.55 62.109 17.44  5.40 38.70  4.109 | ||||
|  444 atgctagctaggcgatgc               410 18  0 55.56 57.890 10.59  0.00  0.00  4.110 | ||||
|  445 ctgatcgatcatcatgctagctac         270 24  0 45.83 59.882 26.67  0.00 41.77  4.118 | ||||
|  446 gctactagctagctgatcatca           505 22  0 45.45 57.879 14.37  0.00 44.92  4.121 | ||||
|  447 gctactagctagctgatcatca           208 22  0 45.45 57.879 14.37  0.00 44.92  4.121 | ||||
|  448 ctgactgatacgcgatgctagc           473 22  0 54.55 62.128  8.61  8.61  0.00  4.128 | ||||
|  449 gctgactgatacgcgatgctag           472 22  0 54.55 62.128  1.70  0.00  0.00  4.128 | ||||
|  450 ctagctgactgatacgcgatgc           469 22  0 54.55 62.128  3.47  0.00  0.00  4.128 | ||||
|  451 gctagctgactgatacgcgatg           468 22  0 54.55 62.128  8.21  0.00  0.00  4.128 | ||||
|  452 tgactgatcgatcatcatgctag          267 23  0 43.48 58.866 26.79 18.40 41.77  4.134 | ||||
|  453 ctgactgatcgatcatcatgcta          266 23  0 43.48 58.866 20.99  8.89 41.77  4.134 | ||||
|  454 tagctgactgatcgatcatcatg          263 23  0 43.48 58.866 22.70 19.51 41.77  4.134 | ||||
|  455 ctagctagctgatcgatcgtagc          560 23  0 52.17 61.151 26.87 26.87  0.00  4.151 | ||||
|  456 gctagctagctgatcgatcgtag          559 23  0 52.17 61.151 34.38 16.86 46.11  4.151 | ||||
|  457 ctgatcgatcgatgctagctagg          399 23  0 52.17 61.158 22.67  6.29 35.21  4.158 | ||||
|  458 gatcgatcgatgctagctagtag          120 23  0 47.83 58.829 23.89  2.63 35.21  4.171 | ||||
|  459 ttagctagctgactgatcgatcat         258 24  0 41.67 60.177 28.29 18.02 36.62  4.177 | ||||
|  460 ctgactgatcgatcatcatgctag         266 24  0 45.83 59.822 20.99 12.80 41.77  4.178 | ||||
|  461 ctagctgactgatcgatcatcatg         262 24  0 45.83 59.822 22.70 19.51 41.77  4.178 | ||||
|  462 ctagctgatcgatcgatgtgcg            75 22  0 54.55 62.180 31.92 20.85 42.69  4.180 | ||||
|  463 tttagctagctgactgatcgatc          257 23  0 43.48 58.807 19.32 19.32  0.00  4.193 | ||||
|  464 tgactgatcgatcatcatgcta           267 22  0 40.91 57.803 26.79 13.11 41.77  4.197 | ||||
|  465 gctagctactatcatcgatcga           430 22  0 45.45 57.783 22.52 22.52  0.00  4.217 | ||||
|  466 gatcgatcgatgctagctagta           120 22  0 45.45 57.783 23.89 18.77 35.21  4.217 | ||||
|  467 agctagctactatcatcgatcg           429 22  0 45.45 57.777 17.56  9.87  0.00  4.223 | ||||
|  468 atcgatcgatgctagctagtag           121 22  0 45.45 57.777 29.65  2.63 33.56  4.223 | ||||
|  469 tgatcatcatcgatgctagctagt         518 24  0 41.67 60.238 22.18  3.56 40.32  4.238 | ||||
|  470 tgatcgatcatcatgctagctact         271 24  0 41.67 60.238 27.48  0.00 37.38  4.238 | ||||
|  471 actgatcgatcatcatgctagcta         269 24  0 41.67 60.238 26.67  2.76 41.77  4.238 | ||||
|  472 catcgatcgatgctagtatgcta          325 23  0 43.48 58.753 37.80  6.23 44.93  4.247 | ||||
|  473 tttagctagctgactgatcgat           257 22  0 40.91 57.736  0.38  0.00  0.00  4.264 | ||||
|  474 atttagctagctgactgatcga           256 22  0 40.91 57.736  4.16  0.00  0.00  4.264 | ||||
|  475 cgcgatcgatgctagcta               372 18  0 55.56 57.717 22.07  3.08 38.48  4.283 | ||||
|  476 catcgatcgatgctagtatgctag         325 24  0 45.83 59.708 37.80 16.01 44.93  4.292 | ||||
|  477 tagctagctactgatcgatgctac         302 24  0 45.83 60.297 27.80  7.81  0.00  4.297 | ||||
|  478 agcatcggattagctagctgatg            3 23  0 47.83 61.299 27.81 27.81 33.28  4.299 | ||||
|  479 agctagctgactgatacgcgat           467 22  0 50.00 62.317 17.99  0.00  0.00  4.317 | ||||
|  480 tgatcatcatcgatgctagctag          518 23  0 43.48 58.678 17.46 17.46 40.32  4.322 | ||||
|  481 ctgatcatcatcgatgctagcta          517 23  0 43.48 58.678 17.69  2.41 40.32  4.322 | ||||
|  482 tagctgatcatcatcgatgctag          514 23  0 43.48 58.678  9.90  2.76 40.32  4.322 | ||||
|  483 ctagctgatcatcatcgatgcta          513 23  0 43.48 58.678 14.58  9.63 40.32  4.322 | ||||
|  484 tagctagctgatcatcatcgatg          510 23  0 43.48 58.678 20.23 20.23 41.48  4.322 | ||||
|  485 ctgatcgatcatcatgctagcta          270 23  0 43.48 58.678 26.67  2.76 41.77  4.322 | ||||
|  486 gatcatcatcgatgctagctagt          519 23  0 43.48 58.677 22.18  3.56 40.32  4.323 | ||||
|  487 gatcgatcatcatgctagctact          272 23  0 43.48 58.677 21.11  0.00  0.00  4.323 | ||||
|  488 gctagctagctgactgatcgatc          105 23  0 52.17 61.341 34.38 19.32 46.11  4.341 | ||||
|  489 tgatcgatcgatgctagctagtag         119 24  0 45.83 60.356 26.44  2.63 35.21  4.356 | ||||
|  490 ctgatcgatcgatgctagctagta         118 24  0 45.83 60.356 22.18 18.77 35.21  4.356 | ||||
|  491 ctgatcatcatcgatgctagctag         517 24  0 45.83 59.644 17.46 17.46 40.32  4.356 | ||||
|  492 ctagctgatcatcatcgatgctag         513 24  0 45.83 59.644 19.54 18.30 42.07  4.356 | ||||
|  493 ctagctagctgatcatcatcgatg         509 24  0 45.83 59.644 20.23 20.23 41.48  4.356 | ||||
|  494 tttagctagctgactgatcgatca         257 24  0 41.67 60.358 26.99 26.99 35.44  4.358 | ||||
|  495 actatcatctctgcgcgatcga           359 22  0 50.00 62.365 22.07  1.72 38.48  4.365 | ||||
|  496 agctgatcgatcgtagcg               566 18  0 55.56 57.634 25.02 11.96  0.00  4.366 | ||||
|  497 gctactagctagctgactgatac          461 23  0 47.83 58.626 15.96  1.42 44.92  4.374 | ||||
|  498 agctgatcgatcgatgctagct           397 22  0 50.00 62.388 30.32 30.32 38.42  4.388 | ||||
|  499 agctagctgatcgatcgatgct           393 22  0 50.00 62.388 33.87 33.38 38.16  4.388 | ||||
|  500 ctagctgactgatcgatcatcat          262 23  0 43.48 58.612 26.31 20.43 41.77  4.388 | ||||
|  501 agctagctactatcatctctgc           351 22  0 45.45 57.608 17.56  0.00  0.00  4.392 | ||||
|  502 ctagctactatcatctctgcgcg          353 23  0 52.17 61.393  0.00  0.00  0.00  4.393 | ||||
|  503 tgatcatcatcgatgctagcta           518 22  0 40.91 57.602 17.69  3.08 40.32  4.398 | ||||
|  504 tagctgatcatcatcgatgcta           514 22  0 40.91 57.602 15.95  9.16 40.32  4.398 | ||||
|  505 tgatcgatcatcatgctagcta           271 22  0 40.91 57.602 27.48  3.08 37.38  4.398 | ||||
|  506 atcatcatcgatgctagctagt           520 22  0 40.91 57.595 22.18  3.56 40.32  4.405 | ||||
|  507 atcgatcatcatgctagctact           273 22  0 40.91 57.595  0.00  0.00  0.00  4.405 | ||||
|  508 agctagctactatcatcgatcgat         429 24  0 41.67 59.573 25.37 25.37 35.13  4.427 | ||||
|  509 gctagctgatcgatcgatgtgc            74 22  0 54.55 62.443 31.83 30.04 35.21  4.443 | ||||
|  510 tagctgactgatcgatcatcat           263 22  0 40.91 57.531 26.31 20.43 41.77  4.469 | ||||
|  511 tagctagctgactgatcgatcga          107 23  0 47.83 61.487 28.29 22.52  0.00  4.487 | ||||
|  512 atcgatcgatgctagtatgctag          326 23  0 43.48 58.501 29.65 13.77 46.09  4.499 | ||||
|  513 ctagtgatgcatgctagtagtga           26 23  0 43.48 58.483 20.00  1.46  0.00  4.517 | ||||
|  514 tagctagctgactgatcgatcatc         259 24  0 45.83 60.536 28.29 21.92 36.62  4.536 | ||||
|  515 tactagctagctgatcatcatcga         507 24  0 41.67 59.449  0.00  0.00  0.00  4.551 | ||||
|  516 gctagctagctactatcatcga           426 22  0 45.45 57.437 34.38  0.00 46.11  4.563 | ||||
|  517 tgactgatacgcgatgctagct           474 22  0 50.00 62.569 17.69  1.35  0.00  4.569 | ||||
|  518 agctgactgatacgcgatgcta           471 22  0 50.00 62.569  7.57  0.00  0.00  4.569 | ||||
|  519 tagctgactgatacgcgatgct           470 22  0 50.00 62.569 10.87  8.44  0.00  4.569 | ||||
|  520 atcgatcgatgctagtatgcta           326 22  0 40.91 57.423 29.65  0.00 33.56  4.577 | ||||
|  521 ctagctagctgatcatcatcgat          509 23  0 43.48 58.422 11.68  0.00  0.00  4.578 | ||||
|  522 agctgactgatcgatcgatgct           112 22  0 50.00 62.580 26.44 23.13 35.21  4.580 | ||||
|  523 ctagctagctgatcatcgatgcta         188 24  0 45.83 60.596 16.78 15.81  0.00  4.596 | ||||
|  524 gtgatgcatgctagtagtgatgta          29 24  0 41.67 59.398 11.60  8.84  0.00  4.602 | ||||
|  525 gctgatcatcatcgatgctagct          516 23  0 47.83 61.603 20.15  8.14 40.32  4.603 | ||||
|  526 agctgatcatcatcgatgctagc          515 23  0 47.83 61.603 20.04 19.26 40.32  4.603 | ||||
|  527 gctagctgatcatcatcgatgct          512 23  0 47.83 61.603 14.14  8.34 40.32  4.603 | ||||
|  528 agctagctgatcatcatcgatgc          511 23  0 47.83 61.603 21.42  7.40 40.32  4.603 | ||||
|  529 tagtgatgcatgctagtagtga            27 22  0 40.91 57.391  0.01  0.00  0.00  4.609 | ||||
|  530 ctactagctagctgactgatacg          462 23  0 47.83 58.387  3.12  0.00  0.00  4.613 | ||||
|  531 tagctactgatcgatgctacatc          306 23  0 43.48 58.368 13.79  0.00 37.97  4.632 | ||||
|  532 gactgatacgcgatgctagctag          475 23  0 52.17 61.633 17.46 17.46  0.00  4.633 | ||||
|  533 ctagctactgatcgatgctacat          305 23  0 43.48 58.364 13.79  0.09  0.00  4.636 | ||||
|  534 gctagctactatcatctctgcgc          352 23  0 52.17 61.644  8.21  0.00  0.00  4.644 | ||||
|  535 gctagctagctactgatcgatgc          300 23  0 52.17 61.644 34.38 12.71 46.11  4.644 | ||||
|  536 gctactagctagctgatcatcat          505 23  0 43.48 58.350 14.37  0.00 44.92  4.650 | ||||
|  537 gctactagctagctgatcatcat          208 23  0 43.48 58.350 14.37  0.00 44.92  4.650 | ||||
|  538 ctagctactgatcgatgctacatc         305 24  0 45.83 59.349 13.79  0.00 37.97  4.651 | ||||
|  539 gctactagctagctgatcatcatc         505 24  0 45.83 59.343 14.37  0.00 44.92  4.657 | ||||
|  540 gctactagctagctgatcatcatc         208 24  0 45.83 59.343 14.37  0.00 44.92  4.657 | ||||
|  541 gctgatcatcatctagctagtagc         154 24  0 45.83 59.343 15.25 15.25 45.79  4.657 | ||||
|  542 tagctagctgatcatcatcgat           510 22  0 40.91 57.329 10.14  0.00  0.00  4.671 | ||||
|  543 ctactatcatctctgcgcgatcg          357 23  0 52.17 61.686 12.19 12.19 39.07  4.686 | ||||
|  544 tactagctagctgactgatacg           463 22  0 45.45 57.310 13.17  0.00  0.00  4.690 | ||||
|  545 gctgatcgatcgatgctagctag          398 23  0 52.17 61.697 27.88 18.22 35.21  4.697 | ||||
|  546 ctagctgatcgatcgatgctagc          395 23  0 52.17 61.697 38.64 35.38 43.05  4.697 | ||||
|  547 gctagctgatcgatcgatgctag          394 23  0 52.17 61.697 41.07 41.07 46.89  4.697 | ||||
|  548 ctagctagctgatcgatcgatgc          391 23  0 52.17 61.697 24.08 21.09 35.21  4.697 | ||||
|  549 gctagctagctgatcgatcgatg          390 23  0 52.17 61.697 34.38 11.03 46.11  4.697 | ||||
|  550 gctagctagctgatcgatcgatg           70 23  0 52.17 61.697 34.38 11.03 46.11  4.697 | ||||
|  551 gctactagctagctgactgata           461 22  0 45.45 57.286 15.96  3.69 44.92  4.714 | ||||
|  552 gatcgatcatcatgctagctac           272 22  0 45.45 57.284 21.11  0.00  0.00  4.716 | ||||
|  553 cgatgctagctaggcgat               408 18  0 55.56 57.277 10.81  3.01  0.00  4.723 | ||||
|  554 atcgatgctagctaggcg               406 18  0 55.56 57.277 15.59  9.02  0.00  4.723 | ||||
|  555 tagctactgatcgatgctacat           306 22  0 40.91 57.270 13.79  0.09  0.00  4.730 | ||||
|  556 gctagctactatcatcgatcgat          430 23  0 43.48 58.251 25.37 25.37 35.13  4.749 | ||||
|  557 tgcatgctagtagtgatgtatacg          33 24  0 41.67 59.224 20.79  0.00  0.00  4.776 | ||||
|  558 gcatgctagtagtgatgtatacgt          34 24  0 41.67 59.223 11.60  0.00  0.00  4.777 | ||||
|  559 atttagctagctgactgatcgatc         256 24  0 41.67 59.219 19.32 19.32  0.00  4.781 | ||||
|  560 gactgatcgatcatcatgctag           268 22  0 45.45 57.215 24.51 15.87 41.77  4.785 | ||||
|  561 atttagctagctgactgatcgat          256 23  0 39.13 58.215  4.16  0.00  0.00  4.785 | ||||
|  562 gctgactgatcgatcatcatgct          265 23  0 47.83 61.788 27.72 15.10 41.77  4.788 | ||||
|  563 agctgactgatcgatcatcatgc          264 23  0 47.83 61.788 27.74 27.74 41.77  4.788 | ||||
|  564 tagctactatcatctctgcgcga          354 23  0 47.83 61.796  2.71  2.71  0.00  4.796 | ||||
|  565 gctgatcatcgatgctactagcta         195 24  0 45.83 60.834 20.91  7.37 45.92  4.834 | ||||
|  566 tagctgatcatcgatgctactagc         193 24  0 45.83 60.834 20.78 20.78 45.61  4.834 | ||||
|  567 gctagctgatcatcgatgctacta         191 24  0 45.83 60.834 11.65  8.83  0.00  4.834 | ||||
|  568 tagctagctgatcatcgatgctac         189 24  0 45.83 60.834 17.82 12.06  0.00  4.834 | ||||
|  569 tagtgatgcatgctagtagtgatg          27 24  0 41.67 59.155 11.56  7.49  0.00  4.845 | ||||
|  570 agtgatgcatgctagtagtgatgt          28 24  0 41.67 60.846 11.60  0.00  0.00  4.846 | ||||
|  571 tgatgcatgctagtagtgatgta           30 23  0 39.13 58.147 11.60  8.84  0.00  4.853 | ||||
|  572 ctgactgatcgatcgatgctagc          114 23  0 52.17 61.878 18.17 12.52 35.21  4.878 | ||||
|  573 gctgactgatcgatcgatgctag          113 23  0 52.17 61.878 22.81 19.44 35.21  4.878 | ||||
|  574 ctagctgactgatcgatcgatgc          110 23  0 52.17 61.878 24.08 19.43 35.21  4.878 | ||||
|  575 gctagctgactgatcgatcgatg          109 23  0 52.17 61.878 23.05 13.21 35.21  4.878 | ||||
|  576 tcatcatcgatgctagctagtag          521 23  0 43.48 58.114  2.81  0.00 40.32  4.886 | ||||
|  577 tactagctagctgatcatcatcg          507 23  0 43.48 58.114  0.00  0.00  0.00  4.886 | ||||
|  578 tcgatcatcatgctagctactag          274 23  0 43.48 58.114  0.00  0.00 37.62  4.886 | ||||
|  579 tgatcatcgatgctactagctag          197 23  0 43.48 58.114 20.04 20.04 45.92  4.886 | ||||
|  580 ctgatcatcgatgctactagcta          196 23  0 43.48 58.114 10.86  0.00 45.92  4.886 | ||||
|  581 tagctgatcatcgatgctactag          193 23  0 43.48 58.114 13.67  9.68  0.00  4.886 | ||||
|  582 ctagctgatcatcgatgctacta          192 23  0 43.48 58.114 11.65  8.83  0.00  4.886 | ||||
|  583 ctactagctagctgatcatcatcg         506 24  0 45.83 59.110  1.08  0.00  0.00  4.890 | ||||
|  584 ctgatcatcgatgctactagctag         196 24  0 45.83 59.110 20.04 20.04 45.92  4.890 | ||||
|  585 ctagctgatcatcgatgctactag         192 24  0 45.83 59.110 15.68 15.68  0.00  4.890 | ||||
|  586 gctagctagctgatcatcatctag         146 24  0 45.83 59.102 34.38 13.13 44.71  4.898 | ||||
|  587 gctagctagctgatcatcatcta          146 23  0 43.48 58.097 34.38  0.00 46.11  4.903 | ||||
|  588 ctagtgatgcatgctagtagtg            26 22  0 45.45 57.072 20.00  3.96  0.00  4.928 | ||||
|  589 gctactatcatctctgcgcgatc          356 23  0 52.17 61.936  4.99  0.00  0.00  4.936 | ||||
|  590 gctgatcgatcgatgtgc                78 18  0 55.56 57.052 29.71 26.38 35.21  4.948 | ||||
|  591 tagctagctactatcatcgatcga         428 24  0 41.67 59.031 27.80 22.52  0.00  4.969 | ||||
|  592 agctagctgatcgatcgtagcg           562 22  0 54.55 62.971 27.20 18.31  0.00  4.971 | ||||
|  593 tgactgatacgcgatgct               474 18  0 50.00 57.028  2.33  0.00  0.00  4.972 | ||||
|  594 gatcatcatcgatgctagctag           519 22  0 45.45 57.019 17.46 17.46 40.32  4.981 | ||||
|  595 tcatcatcgatgctagctagta           521 22  0 40.91 57.005 22.18 18.77 40.32  4.995 | ||||
|  596 tcgatcatcatgctagctacta           274 22  0 40.91 57.005  0.00  0.00  0.00  4.995 | ||||
|  597 tgatcatcgatgctactagcta           197 22  0 40.91 57.005 17.14  1.01 45.92  4.995 | ||||
|  598 tagctgatcatcgatgctacta           193 22  0 40.91 57.005 12.62  8.42  0.00  4.995 | ||||
|  599 tagctagctgactgatacgcgat          466 23  0 47.83 62.044 28.29  0.00  0.00  5.044 | ||||
|  600 ctagctagctactatcatcgatcga        427 25  0 44.00 59.949 27.80 22.52  0.00  5.051 | ||||
|  601 agctagctgactgatcgatcgat          108 23  0 47.83 62.053 30.53 30.53 37.90  5.053 | ||||
|  602 ctactagctagctgactgatacgc         462 24  0 50.00 61.062  3.61  0.00  0.00  5.062 | ||||
|  603 gctactagctagctgactgatacg         461 24  0 50.00 61.062 14.37  0.00 44.92  5.062 | ||||
|  604 tgatcatcatcgatgctagctagta        518 25  0 40.00 60.062 22.18 18.77 40.32  5.062 | ||||
|  605 tgatcgatcatcatgctagctacta        271 25  0 40.00 60.062 27.48  0.00 37.38  5.062 | ||||
|  606 ctagtgatgcatgctagtagtgatg         26 25  0 44.00 60.064 20.00  7.49  0.00  5.064 | ||||
|  607 gctagctagctactatcatcgatc         426 24  0 45.83 58.932 34.38  4.20 46.11  5.068 | ||||
|  608 gctagctactgatcgatgctacat         304 24  0 45.83 61.072 11.21  0.00  0.00  5.072 | ||||
|  609 gctagctagctactatcatcgat          426 23  0 43.48 57.922 34.38  0.00 46.11  5.078 | ||||
|  610 ctagtgatgcatgctagtagtgat          26 24  0 41.67 58.911 20.00  4.64  0.00  5.089 | ||||
|  611 tactatcatctctgcgcgatcga          358 23  0 47.83 62.092 22.07  1.72 38.48  5.092 | ||||
|  612 agctgatcgatcgatgctagcta          397 23  0 47.83 62.111 31.26 14.51 40.03  5.111 | ||||
|  613 tagctgatcgatcgatgctagct          396 23  0 47.83 62.111 33.22 33.22 42.08  5.111 | ||||
|  614 agctagctgatcgatcgatgcta          393 23  0 47.83 62.111 34.11 32.56 36.80  5.111 | ||||
|  615 tagctagctgatcgatcgatgct          392 23  0 47.83 62.111 33.87 33.38 38.16  5.111 | ||||
|  616 tagtgatgcatgctagtagtgat           27 23  0 39.13 57.886 11.56  0.00  0.00  5.114 | ||||
|  617 tactagctagctgatcatcatcgat        507 25  0 40.00 59.828  0.00  0.00  0.00  5.172 | ||||
|  618 gctagctagctgatcatcgatgc          187 23  0 52.17 62.193 34.38  9.22 46.11  5.193 | ||||
|  619 gctagtgatgcatgctagtagtga          25 24  0 45.83 61.195 24.96  4.57  0.00  5.195 | ||||
|  620 aaagcatcggattagctagctgat           1 24  0 41.67 61.209 17.84 15.13  0.00  5.209 | ||||
|  621 gtgatgcatgctagtagtgatgtat         29 25  0 40.00 59.774  1.07  1.07  0.00  5.226 | ||||
|  622 ctatcatctctgcgcgatcgatg          360 23  0 52.17 62.227 18.01 18.01 38.48  5.227 | ||||
|  623 tgactgatacgcgatgctagcta          474 23  0 47.83 62.287 17.69  3.08  0.00  5.287 | ||||
|  624 tagctgactgatacgcgatgcta          470 23  0 47.83 62.287 12.64  9.09  0.00  5.287 | ||||
|  625 tgctagtagtgatgtatacgtagct         37 25  0 40.00 59.713  9.37  8.73  0.00  5.287 | ||||
|  626 tgactgatcgatcgatgctagct          115 23  0 47.83 62.296 20.19 11.59 35.21  5.296 | ||||
|  627 agctgactgatcgatcgatgcta          112 23  0 47.83 62.296 26.44 14.64 35.21  5.296 | ||||
|  628 tagctgactgatcgatcgatgct          111 23  0 47.83 62.296 31.98 30.27 35.21  5.296 | ||||
|  629 ctagctagctactatcatcgatcg         427 24  0 45.83 58.703 12.49  9.87  0.00  5.297 | ||||
|  630 tagctagctactatcatcgatcg          428 23  0 43.48 57.691 27.80  9.87  0.00  5.309 | ||||
|  631 gactgatcgatcatcatgctagct         268 24  0 45.83 61.313 24.51  7.81 41.77  5.313 | ||||
|  632 gctagctgactgatcgatcatcat         261 24  0 45.83 61.313 26.31 20.43 41.77  5.313 | ||||
|  633 ctatttagctagctgactgatcga         254 24  0 41.67 58.679  0.00  0.00  0.00  5.321 | ||||
|  634 gcatgctagtagtgatgtatacg           34 23  0 43.48 57.659 11.60  0.00  0.00  5.341 | ||||
|  635 tatttagctagctgactgatcga          255 23  0 39.13 57.650  0.00  0.00  0.00  5.350 | ||||
|  636 ctactagctagctgatcatcatcga        506 25  0 44.00 60.352  1.08  0.00  0.00  5.352 | ||||
|  637 agctactatcatctctgcgcgat          355 23  0 47.83 62.360  4.99  2.52  0.00  5.360 | ||||
|  638 gctgatcatcatcgatgctagcta         516 24  0 45.83 61.370 20.15  8.49 40.32  5.370 | ||||
|  639 tagctgatcatcatcgatgctagc         514 24  0 45.83 61.370 20.04 19.26 40.32  5.370 | ||||
|  640 gctagctgatcatcatcgatgcta         512 24  0 45.83 61.370 14.58  9.63 40.32  5.370 | ||||
|  641 tagctagctgatcatcatcgatgc         510 24  0 45.83 61.370 21.42  7.40 40.32  5.370 | ||||
|  642 atgcatgctagtagtgatgtatacg         32 25  0 40.00 59.604 11.70  0.00  0.00  5.396 | ||||
|  643 tgatgcatgctagtagtgatgtat          30 24  0 37.50 58.592 12.66 12.66  0.00  5.408 | ||||
|  644 gactgatcgatcgatgctagctag         116 24  0 50.00 61.409 18.04 17.46 35.21  5.409 | ||||
|  645 gctatttagctagctgactgatc          253 23  0 43.48 57.572  7.27  0.00 46.11  5.428 | ||||
|  646 tgctagtgatgcatgctagtagtg          24 24  0 45.83 61.434 24.96 10.54 35.89  5.434 | ||||
|  647 ctagctagctactatcatctctgc         349 24  0 45.83 58.562 27.80  0.00  0.00  5.438 | ||||
|  648 gctagctagctactatcatctctg         348 24  0 45.83 58.562 34.38  6.79 46.11  5.438 | ||||
|  649 gatcatcatcgatgctagctagta         519 24  0 41.67 58.557 22.18 18.77 40.32  5.443 | ||||
|  650 gatcgatcatcatgctagctacta         272 24  0 41.67 58.557 21.11  0.00  0.00  5.443 | ||||
|  651 atcatcatcgatgctagctagtag         520 24  0 41.67 58.554  2.13  0.00 40.32  5.446 | ||||
|  652 atcgatcatcatgctagctactag         273 24  0 41.67 58.554  0.00  0.00 37.62  5.446 | ||||
|  653 tagctagctactatcatctctgc          350 23  0 43.48 57.527 27.80  0.00  0.00  5.473 | ||||
|  654 atcatcatcgatgctagctagta          520 23  0 39.13 57.514 22.18 18.77 40.32  5.486 | ||||
|  655 atcgatcatcatgctagctacta          273 23  0 39.13 57.514  0.00  0.00  0.00  5.486 | ||||
|  656 gatcatcatcgatgctagctagtag        519 25  0 44.00 59.494  0.21  0.00 40.32  5.506 | ||||
|  657 gatcgatcatcatgctagctactag        272 25  0 44.00 59.494 21.11  0.00 37.62  5.506 | ||||
|  658 actagctagctgatcatcatctact        211 25  0 40.00 59.471 22.43  6.99  0.00  5.529 | ||||
|  659 tgactgatcgatcatcatgctagc         267 24  0 45.83 61.547 26.79 14.13 41.77  5.547 | ||||
|  660 gctgactgatcgatcatcatgcta         265 24  0 45.83 61.547 27.72 16.42 41.77  5.547 | ||||
|  661 tagctgactgatcgatcatcatgc         263 24  0 45.83 61.547 27.74 27.74 41.77  5.547 | ||||
|  662 tgctagtagtgatgtatacgtagc          37 24  0 41.67 58.446  4.93  4.93  0.00  5.554 | ||||
|  663 ctagctagctgactgatacgcga          465 23  0 52.17 62.571 14.90  0.00  0.00  5.571 | ||||
|  664 tagctagctactatcatcgatcgat        428 25  0 40.00 59.423 27.80 25.37 35.13  5.577 | ||||
|  665 gctactagctagctgatcatcatct        208 25  0 44.00 60.585 14.37  0.00 44.92  5.585 | ||||
|  666 agctgatcatcatctagctagtagc        153 25  0 44.00 60.585 15.25 15.25 40.45  5.585 | ||||
|  667 ctagctagctgatcgatcgatgtg          71 24  0 50.00 61.642 11.68  4.94 35.21  5.642 | ||||
|  668 agtgatgcatgctagtagtgatgta         28 25  0 40.00 60.646 11.60  8.84  0.00  5.646 | ||||
|  669 tagtgatgcatgctagtagtgatgt         27 25  0 40.00 60.646 11.60  0.00  0.00  5.646 | ||||
|  670 actatcatctctgcgcgatcgat          359 23  0 47.83 62.652 22.07 11.47 38.48  5.652 | ||||
|  671 ctatttagctagctgactgatcg          254 23  0 43.48 57.339  0.00  0.00  0.00  5.661 | ||||
|  672 tagctagctgatcgatcgtagcg          561 23  0 52.17 62.677 27.20 18.31  0.00  5.677 | ||||
|  673 gcatcggattagctagctgatgc            4 23  0 52.17 62.687 34.10 34.10 41.15  5.687 | ||||
|  674 tgcatgctagtagtgatgtatacgt         33 25  0 40.00 60.700 20.79  0.00  0.00  5.700 | ||||
|  675 tttagctagctgactgatcgatcat        257 25  0 40.00 60.702 26.67 18.02 36.62  5.702 | ||||
|  676 atttagctagctgactgatcgatca        256 25  0 40.00 60.702 26.99 26.99 35.44  5.702 | ||||
|  677 gctagctagctactatcatctct          348 23  0 43.48 57.266 34.38  0.00 46.11  5.734 | ||||
|  678 aagcatcggattagctagctgatg           2 24  0 45.83 61.794 27.81 27.81 33.28  5.794 | ||||
|  679 agtgatgtatacgtagctagtagc          44 24  0 41.67 58.201 15.25 15.25 45.79  5.799 | ||||
|  680 gctagtagtgatgtatacgtagct          38 24  0 41.67 58.201  5.92  5.92  0.00  5.799 | ||||
|  681 tagctagctgactgatcgatcgat         107 24  0 45.83 61.800 30.53 30.53 37.90  5.800 | ||||
|  682 actagctagctgactgatacgcg          464 23  0 52.17 62.816 21.52  3.89  0.00  5.816 | ||||
|  683 actagctagctgatcatcatctac         211 24  0 41.67 58.178 22.43  0.00  0.00  5.822 | ||||
|  684 tagctgatcgatcgatgctagcta         396 24  0 45.83 61.857 34.98 33.55 41.05  5.857 | ||||
|  685 tagctagctgatcgatcgatgcta         392 24  0 45.83 61.857 34.11 32.56 36.80  5.857 | ||||
|  686 tatttagctagctgactgatcgat         255 24  0 37.50 58.112  1.68  0.00  0.00  5.888 | ||||
|  687 gcatgctagtagtgatgtatacgta         34 25  0 40.00 59.089 11.60  0.00  0.00  5.911 | ||||
|  688 tatttagctagctgactgatcgatc        255 25  0 40.00 59.084 19.32 19.32  0.00  5.916 | ||||
|  689 ctatttagctagctgactgatcgat        254 25  0 40.00 59.082  0.00  0.00  0.00  5.918 | ||||
|  690 ctagctagctactatcatctctgcg        349 25  0 48.00 60.920 27.80  5.75  0.00  5.920 | ||||
|  691 tgatcgatcgatgctagctaggc          400 23  0 52.17 62.955 26.44 12.49 35.21  5.955 | ||||
|  692 agctagctactgatcgatgctaca         303 24  0 45.83 61.988 17.56  3.03  0.00  5.988 | ||||
|  693 tgactgatcgatcgatgctagcta         115 24  0 45.83 62.034 20.19 11.16 35.21  6.034 | ||||
|  694 tagctgactgatcgatcgatgcta         111 24  0 45.83 62.034 33.43 30.74 35.21  6.034 | ||||
|  695 catgctagtagtgatgtatacgtagc        35 26  0 42.31 59.961  4.93  4.93  0.00  6.039 | ||||
|  696 gcatgctagtagtgatgtatacgtag        34 26  0 42.31 59.961 11.60  0.00  0.00  6.039 | ||||
|  697 actgatcgatcgatgctagctagt         117 24  0 45.83 62.039 23.29 15.07 35.21  6.039 | ||||
|  698 ctatttagctagctgactgatcgatc       254 26  0 42.31 59.960 19.32 19.32  0.00  6.040 | ||||
|  699 ttagctagctgactgatcgatcatc        258 25  0 44.00 61.041 28.29 21.92 36.62  6.041 | ||||
|  700 atgctagtagtgatgtatacgtagct        36 26  0 38.46 60.068  9.37  8.73  0.00  6.068 | ||||
|  701 ctagctagctgatcatcatctact         212 24  0 41.67 57.930 11.68  6.99  0.00  6.070 | ||||
|  702 ctactagctagctgatcatcatct         209 24  0 41.67 57.930  1.08  0.00  0.00  6.070 | ||||
|  703 agctgatcatcatctagctagtag         153 24  0 41.67 57.930  7.49  3.73 40.45  6.070 | ||||
|  704 ctagctgatcatcatctagctagt         151 24  0 41.67 57.930 21.70  5.56 46.15  6.070 | ||||
|  705 tagctactatcatctctgcgcgat         354 24  0 45.83 62.096  4.99  2.52  0.00  6.096 | ||||
|  706 gactgatcgatcatcatgctagcta        268 25  0 44.00 61.099 24.51  4.57 41.77  6.099 | ||||
|  707 ctgatcatcatcgatgctagctagt        517 25  0 44.00 61.101 22.18  3.56 40.32  6.101 | ||||
|  708 actagctagctgatcatcatcgatg        508 25  0 44.00 61.101 22.43 20.23 41.48  6.101 | ||||
|  709 ctgatcgatcatcatgctagctact        270 25  0 44.00 61.101 26.67  0.00 41.77  6.101 | ||||
|  710 atgctagtagtgatgtatacgtagc         36 25  0 40.00 58.855  4.93  4.93  0.00  6.145 | ||||
|  711 ctagctagctactgatcgatgctac        301 25  0 48.00 61.145 14.00  7.81  0.00  6.145 | ||||
|  712 gctagctagctactatcatctctgc        348 25  0 48.00 61.152 34.38 11.74 46.11  6.152 | ||||
|  713 agctagctgatcatcatctactatca       214 26  0 38.46 59.840 17.99  0.00  0.00  6.160 | ||||
|  714 ctgatcgatcgatgctagctagtag        118 25  0 48.00 61.197 19.70  5.49 35.21  6.197 | ||||
|  715 agctagctgactgatcgatcatca         260 24  0 45.83 62.232 26.49 26.49 39.98  6.232 | ||||
|  716 gctagctagctactatcatcgatcg        426 25  0 48.00 61.252 34.38  9.87 46.11  6.252 | ||||
|  717 gctatttagctagctgactgatcga        253 25  0 44.00 61.268  7.27  0.00 46.11  6.268 | ||||
|  718 ctagctagctactatcatcgatcgat       427 26  0 42.31 60.291 27.80 25.37 35.13  6.291 | ||||
|  719 agctgatcatcgatgctactagct         194 24  0 45.83 62.294 24.11 23.60 45.92  6.294 | ||||
|  720 agctagctgatcatcgatgctact         190 24  0 45.83 62.294 17.99 10.88  0.00  6.294 | ||||
|  721 ctagctagctgactgatcgatcga         106 24  0 50.00 62.312 22.52 22.52  0.00  6.312 | ||||
|  722 actgatcgatcatcatgctagctac        269 25  0 44.00 61.328 26.67  0.00 41.77  6.328 | ||||
|  723 tgatgcatgctagtagtgatgtatac        30 26  0 38.46 59.623  9.19  6.43  0.00  6.377 | ||||
|  724 gtgatgcatgctagtagtgatgtata        29 26  0 38.46 59.623  4.23  0.00  0.00  6.377 | ||||
|  725 tactatcatctctgcgcgatcgat         358 24  0 45.83 62.379 22.07 11.47 38.48  6.379 | ||||
|  726 gctagctgatcatcatctactatca        215 25  0 40.00 58.607  8.21  0.00  0.00  6.393 | ||||
|  727 gctactagctagctgatcatcatcta       208 26  0 42.31 60.404 14.37  0.00 44.92  6.404 | ||||
|  728 tagctgatcatcatctagctagtagc       152 26  0 42.31 60.404 15.25 15.25 41.48  6.404 | ||||
|  729 tgctagtagtgatgtatacgtagcta        37 26  0 38.46 59.564 10.00  8.05  0.00  6.436 | ||||
|  730 gatgcatgctagtagtgatgtatacg        31 26  0 42.31 60.453  7.40  0.00  0.00  6.453 | ||||
|  731 tagtgatgcatgctagtagtgatgta        27 26  0 38.46 60.461 11.60  8.84  0.00  6.461 | ||||
|  732 gctagtgatgcatgctagtagtgat         25 25  0 44.00 61.506 24.96  8.51  0.00  6.506 | ||||
|  733 tgcatgctagtagtgatgtatacgta        33 26  0 38.46 60.515 20.79  0.00  0.00  6.515 | ||||
|  734 tatttagctagctgactgatcgatca       255 26  0 38.46 60.516 26.99 26.99 35.44  6.516 | ||||
|  735 tgatgcatgctagtagtgatgtata         30 25  0 36.00 58.479  4.13  0.00  0.00  6.521 | ||||
|  736 tactagctagctgactgatacgcg         463 24  0 50.00 62.538 13.17  3.89  0.00  6.538 | ||||
|  737 ctagctactatcatctctgcgcga         353 24  0 50.00 62.603  2.71  2.71  0.00  6.603 | ||||
|  738 agctagctgatcatcatctactatc        214 25  0 40.00 58.369 17.99  0.00  0.00  6.631 | ||||
|  739 agctagctgatcatcatctactat         214 24  0 37.50 57.345 17.99  0.00  0.00  6.655 | ||||
|  740 gctactagctagctgatcatcatcg        505 25  0 48.00 61.656 14.37  0.00 44.92  6.656 | ||||
|  741 gctgatcatcgatgctactagctag        195 25  0 48.00 61.656 20.91 20.04 45.92  6.656 | ||||
|  742 ctagctgatcatcgatgctactagc        192 25  0 48.00 61.656 20.78 20.78 45.61  6.656 | ||||
|  743 gctagctgatcatcgatgctactag        191 25  0 48.00 61.656 20.13 20.13  0.00  6.656 | ||||
|  744 ctagctagctgatcatcgatgctac        188 25  0 48.00 61.656 17.82 12.06  0.00  6.656 | ||||
|  745 actagctagctgatcatcatctacta       211 26  0 38.46 59.328 22.43  8.11  0.00  6.672 | ||||
|  746 tactagctagctgatcatcatctact       210 26  0 38.46 59.328  6.99  6.99  0.00  6.672 | ||||
|  747 ctactagctagctgatcatcatcgat       506 26  0 42.31 60.681  1.08  0.00  0.00  6.681 | ||||
|  748 tagctagctactgatcgatgctaca        302 25  0 44.00 61.746 27.80  5.02  0.00  6.746 | ||||
|  749 gtagtgatgtatacgtagctagtagc        42 26  0 42.31 59.249 15.25 15.25 45.79  6.751 | ||||
|  750 actgatcgatcgatgctagctagta        117 25  0 44.00 61.797 23.29 18.77 35.21  6.797 | ||||
|  751 gatgcatgctagtagtgatgtatac         31 25  0 40.00 58.175 20.79  1.70  0.00  6.825 | ||||
|  752 agctgatcatcatcgatgctagct         515 24  0 45.83 62.835 23.00 22.41 41.74  6.835 | ||||
|  753 agctagctgatcatcatcgatgct         511 24  0 45.83 62.835 17.99  8.34 40.32  6.835 | ||||
|  754 ctagctagctgactgatacgcgat         465 24  0 50.00 62.838 14.90  0.00  0.00  6.838 | ||||
|  755 atgcatgctagtagtgatgtatac          32 24  0 37.50 57.161 11.70  0.53  0.00  6.839 | ||||
|  756 agctagctactatcatctctgcgc         351 24  0 50.00 62.858 17.56  0.00  0.00  6.858 | ||||
|  757 gctagctagctactgatcgatgct         300 24  0 50.00 62.858 34.38 11.51 46.11  6.858 | ||||
|  758 ctactatcatctctgcgcgatcga         357 24  0 50.00 62.878 22.07  1.72 38.48  6.878 | ||||
|  759 gctagctactgatcgatgctacatc        304 25  0 48.00 61.879 11.21  4.40 37.97  6.879 | ||||
|  760 tagtgatgtatacgtagctagtagc         43 25  0 40.00 58.104 15.25 15.25 45.79  6.896 | ||||
|  761 gctagtagtgatgtatacgtagcta         38 25  0 40.00 58.104  7.24  5.34  0.00  6.896 | ||||
|  762 tgatcatcatcgatgctagctagtag       518 26  0 42.31 60.902 14.93  0.00 40.32  6.902 | ||||
|  763 ctgatcatcatcgatgctagctagta       517 26  0 42.31 60.902 22.18 18.77 40.32  6.902 | ||||
|  764 tactagctagctgatcatcatcgatg       507 26  0 42.31 60.902 20.23 20.23 41.48  6.902 | ||||
|  765 tgatcgatcatcatgctagctactag       271 26  0 42.31 60.902 27.48  0.00 37.38  6.902 | ||||
|  766 ctgatcgatcatcatgctagctacta       270 26  0 42.31 60.902 26.67  1.37 41.77  6.902 | ||||
|  767 agctgatcgatcgatgctagctag         397 24  0 50.00 62.904 31.26 19.90 40.03  6.904 | ||||
|  768 ctagctgatcgatcgatgctagct         395 24  0 50.00 62.904 35.51 33.22 43.05  6.904 | ||||
|  769 agctagctgatcgatcgatgctag         393 24  0 50.00 62.904 41.07 41.07 46.89  6.904 | ||||
|  770 ctagctagctgatcgatcgatgct         391 24  0 50.00 62.904 33.87 33.38 38.16  6.904 | ||||
|  771 tactagctagctgatcatcatctac        210 25  0 40.00 58.081  0.00  0.00  0.00  6.919 | ||||
|  772 gctagctgatcatcatctactatc         215 24  0 41.67 57.062  8.21  0.00  0.00  6.938 | ||||
|  773 agtgatgcatgctagtagtgatgtat        28 26  0 38.46 60.969  1.07  1.07  0.00  6.969 | ||||
|  774 gctagtagtgatgtatacgtagctag        38 26  0 42.31 59.027  8.99  8.99  0.00  6.973 | ||||
|  775 tagctagctgactgatcgatcatca        259 25  0 44.00 61.981 28.29 26.49 39.98  6.981 | ||||
|  776 ctactagctagctgatcatcatctac       209 26  0 42.31 59.015  1.08  0.00  0.00  6.985 | ||||
|  777 agtagtgatgtatacgtagctagt          41 24  0 37.50 57.012  8.68  8.68  0.00  6.988 | ||||
|  778 gctagctgatcatcatctactatcat       215 26  0 38.46 59.001  8.21  0.00  0.00  6.999 | ||||
|  779 agctgatcatcatctactatcatca        218 25  0 36.00 57.993  0.00  0.00  0.00  7.007 | ||||
|  780 atgcatgctagtagtgatgtatacgt        32 26  0 38.46 61.018 11.70  0.00  0.00  7.018 | ||||
|  781 atttagctagctgactgatcgatcat       256 26  0 38.46 61.022 26.67 18.02 36.62  7.022 | ||||
|  782 agctgatcatcgatgctactagcta        194 25  0 44.00 62.040 24.59  9.79 45.92  7.040 | ||||
|  783 tagctgatcatcgatgctactagct        193 25  0 44.00 62.040 27.00 27.00 45.92  7.040 | ||||
|  784 agctagctgatcatcgatgctacta        190 25  0 44.00 62.040 17.99 11.59  0.00  7.040 | ||||
|  785 tagctagctgatcatcgatgctact        189 25  0 44.00 62.040 17.55 15.53  0.00  7.040 | ||||
|  786 atgctagtagtgatgtatacgtagcta       36 27  0 37.04 59.911 10.00  8.05  0.00  7.089 | ||||
|  787 gctagctgatcatcatctactatcatc      215 27  0 40.74 59.861  8.21  0.00  0.00  7.139 | ||||
|  788 ctagctagctgatcatcatctacta        212 25  0 40.00 57.842 11.68  8.11  0.00  7.158 | ||||
|  789 ctactagctagctgatcatcatcta        209 25  0 40.00 57.842  1.08  0.00  0.00  7.158 | ||||
|  790 tagctgatcatcatctagctagtag        152 25  0 40.00 57.842 13.40  3.73 41.48  7.158 | ||||
|  791 ctagctgatcatcatctagctagta        151 25  0 40.00 57.842 21.70  7.13 46.15  7.158 | ||||
|  792 gctgatcatcatcgatgctagctag        516 25  0 48.00 62.165 20.15 17.46 40.32  7.165 | ||||
|  793 ctagctgatcatcatcgatgctagc        513 25  0 48.00 62.165 19.27 19.26 41.96  7.165 | ||||
|  794 gctagctgatcatcatcgatgctag        512 25  0 48.00 62.165 23.70 23.70 45.51  7.165 | ||||
|  795 ctagctagctgatcatcatcgatgc        509 25  0 48.00 62.165 21.42  7.40 40.32  7.165 | ||||
|  796 agctagctgatcatcatctactatcat      214 27  0 37.04 60.181 17.99  0.00  0.00  7.181 | ||||
|  797 ctactagctagctgatcatcatctact      209 27  0 40.74 60.181  6.99  6.99  0.00  7.181 | ||||
|  798 ctagctgatcatcatctagctagtag       151 26  0 42.31 58.789 21.70 10.73 46.15  7.211 | ||||
|  799 aaagcatcggattagctagctgatg          1 25  0 44.00 62.249 27.81 27.81 33.28  7.249 | ||||
|  800 agctagctactgatcgatgctacat        303 25  0 44.00 62.272 17.56  6.16  0.00  7.272 | ||||
|  801 tagctagctgatcatcatctactatca      213 27  0 37.04 59.689  8.31  0.00  0.00  7.311 | ||||
|  802 actagctagctgatcatcatctactat      211 27  0 37.04 59.688 22.43  2.36  0.00  7.312 | ||||
|  803 ctgactgatcgatcatcatgctagc        266 25  0 48.00 62.333 20.99  8.86 41.77  7.333 | ||||
|  804 gctgactgatcgatcatcatgctag        265 25  0 48.00 62.333 27.72 21.73 41.77  7.333 | ||||
|  805 ctagctgactgatcgatcatcatgc        262 25  0 48.00 62.333 27.74 27.74 41.77  7.333 | ||||
|  806 gctagctgactgatcgatcatcatg        261 25  0 48.00 62.333 22.70 19.51 41.77  7.333 | ||||
|  807 tgctagtagtgatgtatacgtagctag       37 27  0 40.74 60.395  8.99  8.99  0.00  7.395 | ||||
|  808 agtagtgatgtatacgtagctagtagc       41 27  0 40.74 60.395 15.25 15.25 45.79  7.395 | ||||
|  809 gctagtagtgatgtatacgtagctagt       38 27  0 40.74 60.395 15.55 15.55  0.00  7.395 | ||||
|  810 ctagtgatgcatgctagtagtgatgt        26 26  0 42.31 61.460 20.00  0.00  0.00  7.460 | ||||
|  811 gctgatcatcatctactatcatcatca      219 27  0 37.04 59.533  0.00  0.00  0.00  7.467 | ||||
|  812 agctagctgactgatcgatcatcat        260 25  0 44.00 62.507 26.31 20.43 41.77  7.507 | ||||
|  813 tttagctagctgactgatcgatcatc       257 26  0 42.31 61.507 23.93 21.92 36.62  7.507 | ||||
|  814 catgctagtagtgatgtatacgtag         35 25  0 40.00 57.441  4.74  0.00  0.00  7.559 | ||||
|  815 agctgatcatcatcgatgctagcta        515 25  0 44.00 62.561 23.50 10.90 43.19  7.561 | ||||
|  816 tagctgatcatcatcgatgctagct        514 25  0 44.00 62.561 26.21 26.21 44.79  7.561 | ||||
|  817 agctagctgatcatcatcgatgcta        511 25  0 44.00 62.561 17.99  9.63 40.32  7.561 | ||||
|  818 tagctagctgatcatcatcgatgct        510 25  0 44.00 62.561 14.14 10.38 40.32  7.561 | ||||
|  819 gctatttagctagctgactgatcgat       253 26  0 42.31 61.564  7.27  0.00 46.11  7.564 | ||||
|  820 ctagctagctgactgatcgatcgat        106 25  0 48.00 62.579 30.53 30.53 37.90  7.579 | ||||
|  821 agctgatcatcatctactatcatcat       218 26  0 34.62 58.415  0.00  0.00  0.00  7.585 | ||||
|  822 tagctagctactatcatctctgcgc        350 25  0 48.00 62.587 27.80  0.00  0.00  7.587 | ||||
|  823 gctagctagctactgatcgatgcta        300 25  0 48.00 62.587 34.38 12.23 46.11  7.587 | ||||
|  824 tgctagtgatgcatgctagtagtga         24 25  0 44.00 62.622 24.96 13.57 35.89  7.622 | ||||
|  825 tagctgatcgatcgatgctagctag        396 25  0 48.00 62.632 33.71 21.46 41.05  7.632 | ||||
|  826 ctagctgatcgatcgatgctagcta        395 25  0 48.00 62.632 35.51 32.61 43.05  7.632 | ||||
|  827 tagctagctgatcgatcgatgctag        392 25  0 48.00 62.632 41.07 41.07 46.89  7.632 | ||||
|  828 ctagctagctgatcgatcgatgcta        391 25  0 48.00 62.632 34.11 32.56 36.80  7.632 | ||||
|  829 gtgatgcatgctagtagtgatgtatac       29 27  0 40.74 60.659  9.56  7.17  0.00  7.659 | ||||
|  830 agctgatcatcatctactatcatcatc      218 27  0 37.04 59.314  0.00  0.00  0.00  7.686 | ||||
|  831 tagctagctgatcatcatctactat        213 25  0 36.00 57.279  8.31  0.00  0.00  7.721 | ||||
|  832 tagctagctgatcatcatctactatc       213 26  0 38.46 58.269  8.31  0.00  0.00  7.731 | ||||
|  833 tgactgatcgatcatcatgctagct        267 25  0 44.00 62.733 26.79 10.55 41.77  7.733 | ||||
|  834 agctgactgatcgatcatcatgcta        264 25  0 44.00 62.733 30.60 18.10 41.77  7.733 | ||||
|  835 tagctgactgatcgatcatcatgct        263 25  0 44.00 62.733 32.31 32.31 41.77  7.733 | ||||
|  836 ctagctagctgatcatcatctactat       212 26  0 38.46 58.265  9.41  0.00  0.00  7.735 | ||||
|  837 agtgatgcatgctagtagtgatgtata       28 27  0 37.04 60.779  4.23  0.00  0.00  7.779 | ||||
|  838 tagtgatgcatgctagtagtgatgtat       27 27  0 37.04 60.779 11.56  0.00  0.00  7.779 | ||||
|  839 tgactgatcgatcgatgctagctag        115 25  0 48.00 62.800 20.19 17.46 35.21  7.800 | ||||
|  840 ctgactgatcgatcgatgctagcta        114 25  0 48.00 62.800 20.19 11.97 35.21  7.800 | ||||
|  841 tagctgactgatcgatcgatgctag        111 25  0 48.00 62.800 31.45 26.34 35.21  7.800 | ||||
|  842 ctagctgactgatcgatcgatgcta        110 25  0 48.00 62.800 31.54 29.68 35.21  7.800 | ||||
|  843 tagctagctgactgatcgatcgatg        107 25  0 48.00 62.800 28.29 13.21 35.21  7.800 | ||||
|  844 gactgatcgatcgatgctagctagt        116 25  0 48.00 62.802 22.18 12.64 35.21  7.802 | ||||
|  845 tactagctagctgatcatcatctacta      210 27  0 37.04 59.196  8.79  8.11  0.00  7.804 | ||||
|  846 tagctgatcatcgatgctactagcta       193 26  0 42.31 61.805 28.86 27.39 45.92  7.805 | ||||
|  847 tagctagctgatcatcgatgctacta       189 26  0 42.31 61.805 18.93 16.03  0.00  7.805 | ||||
|  848 atgcatgctagtagtgatgtatacgta       32 27  0 37.04 60.828 11.70  0.00  0.00  7.828 | ||||
|  849 tatttagctagctgactgatcgatcat      255 27  0 37.04 60.831 26.67 18.02 36.62  7.831 | ||||
|  850 ctagctagctgatcatcatctactatc      212 27  0 40.74 59.162  9.41  0.06  0.00  7.838 | ||||
|  851 tagctactatcatctctgcgcgatc        354 25  0 48.00 62.854  0.00  0.00  0.00  7.854 | ||||
|  852 gctgatcatcatctactatcatcat        219 25  0 36.00 57.142  0.00  0.00  0.00  7.858 | ||||
|  853 ctagctactatcatctctgcgcgat        353 25  0 48.00 62.859  4.99  2.52  0.00  7.859 | ||||
|  854 gctgatcatcatctactatcatcatc       219 26  0 38.46 58.126  0.00  0.00  0.00  7.874 | ||||
|  855 tagctagctactgatcgatgctacat       302 26  0 42.31 62.028 27.80  3.08  0.00  8.028 | ||||
|  856 agtagtgatgtatacgtagctagtag        41 26  0 38.46 57.950  9.92  1.30  0.00  8.050 | ||||
|  857 ctagtagtgatgtatacgtagctagt        39 26  0 38.46 57.950 15.52 15.52  0.00  8.050 | ||||
|  858 catgctagtagtgatgtatacgtagct       35 27  0 40.74 61.089  9.37  8.73  0.00  8.089 | ||||
|  859 gactgatcgatcatcatgctagctac       268 26  0 46.15 62.094 24.51  8.36 41.77  8.094 | ||||
|  860 tagctgatcatcatctactatcatca       217 26  0 34.62 57.906  0.00  0.00  0.00  8.094 | ||||
|  861 ctagctgatcatcatctactatcatca      216 27  0 37.04 58.826  0.00  0.00  0.00  8.174 | ||||
|  862 ctagctgatcatcatctagctagtagc      151 27  0 44.44 61.196 21.70 15.25 46.15  8.196 | ||||
|  863 tagctagctgactgatcgatcatcat       259 26  0 42.31 62.255 28.29 20.43 41.77  8.255 | ||||
|  864 ctagtgatgcatgctagtagtgatgta       26 27  0 40.74 61.255 20.00  8.84  0.00  8.255 | ||||
|  865 tgcatgctagtagtgatgtatacgtag       33 27  0 40.74 61.300 20.79  0.00  0.00  8.300 | ||||
|  866 ctatttagctagctgactgatcgatca      254 27  0 40.74 61.304 26.99 26.99 35.44  8.304 | ||||
|  867 tagctgatcatcatcgatgctagcta       514 26  0 42.31 62.307 28.23 26.63 43.19  8.307 | ||||
|  868 tagctagctgatcatcatcgatgcta       510 26  0 42.31 62.307 14.58 11.03 40.32  8.307 | ||||
|  869 gctagctagctactatcatcgatcga       426 26  0 46.15 62.381 34.38 22.52 46.11  8.381 | ||||
|  870 gctactagctagctgatcatcatctac      208 27  0 44.44 61.407 14.37  0.00 44.92  8.407 | ||||
|  871 ttagctagctgactgatcgatcatca       258 26  0 42.31 62.416 28.29 26.49 39.98  8.416 | ||||
|  872 tgactgatcgatcatcatgctagcta       267 26  0 42.31 62.472 26.79 11.24 41.77  8.472 | ||||
|  873 tagctgactgatcgatcatcatgcta       263 26  0 42.31 62.472 33.83 32.61 41.77  8.472 | ||||
|  874 actgatcgatcatcatgctagctact       269 26  0 42.31 62.478 26.67  0.00 41.77  8.478 | ||||
|  875 gctagtgatgcatgctagtagtgatg        25 26  0 46.15 62.484 24.96  9.07  0.00  8.484 | ||||
|  876 ctagctagctactgatcgatgctaca       301 26  0 46.15 62.503 14.00  5.87  0.00  8.503 | ||||
|  877 gactgatcgatcgatgctagctagta       116 26  0 46.15 62.543 22.18 18.77 35.21  8.543 | ||||
|  878 actgatcgatcgatgctagctagtag       117 26  0 46.15 62.548 23.29 12.42 35.21  8.548 | ||||
|  879 ctagctgatcatcatctactatcatc       216 26  0 38.46 57.395  0.00  0.00  0.00  8.605 | ||||
|  880 ctgatcatcatcgatgctagctagtag      517 27  0 44.44 61.665 10.30  1.36 40.32  8.665 | ||||
|  881 ctactagctagctgatcatcatcgatg      506 27  0 44.44 61.665 20.23 20.23 41.48  8.665 | ||||
|  882 ctgatcgatcatcatgctagctactag      270 27  0 44.44 61.665 26.67  8.14 41.77  8.665 | ||||
|  883 tagctgatcatcatctactatcatcat      217 27  0 33.33 58.315  0.00  0.00  0.00  8.685 | ||||
|  884 tgatgcatgctagtagtgatgtatacg       30 27  0 40.74 61.778  9.81  0.00  0.00  8.778 | ||||
|  885 gatgcatgctagtagtgatgtatacgt       31 27  0 40.74 61.779  7.40  0.00  0.00  8.779 | ||||
|  886 gctactagctagctgatcatcatcga       505 26  0 46.15 62.779 14.37  0.00 44.92  8.779 | ||||
|  887 agctgatcatcgatgctactagctag       194 26  0 46.15 62.784 24.59 20.04 45.92  8.784 | ||||
|  888 ctagctgatcatcgatgctactagct       192 26  0 46.15 62.784 27.00 27.00 45.92  8.784 | ||||
|  889 agctagctgatcatcgatgctactag       190 26  0 46.15 62.784 20.13 20.13  0.00  8.784 | ||||
|  890 ctagctagctgatcatcgatgctact       188 26  0 46.15 62.784 17.55 15.53  0.00  8.784 | ||||
|  891 atttagctagctgactgatcgatcatc      256 27  0 40.74 61.785 23.93 21.92 36.62  8.785 | ||||
|  892 tctactatcatcatcatctactagct       230 26  0 34.62 57.155  0.00  0.00  0.00  8.845 | ||||
|  893 tgctagtgatgcatgctagtagtgat        24 26  0 42.31 62.874 24.96  8.51 35.89  8.874 | ||||
|  894 ctgatcatcatctactatcatcatca       220 26  0 34.62 57.026  0.00  0.00  0.00  8.974 | ||||
|  895 agctagctactgatcgatgctacatc       303 26  0 46.15 62.999 17.56  7.89 37.97  8.999 | ||||
|  896 tagtagtgatgtatacgtagctagtag       40 27  0 37.04 57.869 16.78  1.30  0.00  9.131 | ||||
|  897 ctagtagtgatgtatacgtagctagta       39 27  0 37.04 57.869 16.85 15.97  0.00  9.131 | ||||
|  898 actgatcgatcatcatgctagctacta      269 27  0 40.74 62.236 26.67  1.37 41.77  9.236 | ||||
|  899 gcatgctagtagtgatgtatacgtagc       34 27  0 44.44 62.283 11.60  4.93  0.00  9.283 | ||||
|  900 gctatttagctagctgactgatcgatc      253 27  0 44.44 62.291 19.32 19.32 46.11  9.291 | ||||
|  901 atctactatcatcatcatctactagct      229 27  0 33.33 57.592  0.00  0.00  0.00  9.408 | ||||
|  902 catctactatcatcatcatctactagc      228 27  0 37.04 57.549  0.00  0.00  0.00  9.451 | ||||
|  903 tgatcatcatctactatcatcatcatc      221 27  0 33.33 57.467  0.00  0.00  0.00  9.533 | ||||
|  904 tagctgatcatcgatgctactagctag      193 27  0 44.44 62.534 27.70 20.04 45.92  9.534 | ||||
|  905 ctagctgatcatcgatgctactagcta      192 27  0 44.44 62.534 27.76 26.73 45.92  9.534 | ||||
|  906 tagctagctgatcatcgatgctactag      189 27  0 44.44 62.534 20.13 20.13  0.00  9.534 | ||||
|  907 ctagctagctgatcatcgatgctacta      188 27  0 44.44 62.534 17.74 15.95  0.00  9.534 | ||||
|  908 ctgatcatcatctactatcatcatcat      220 27  0 33.33 57.462  0.00  0.00  0.00  9.538 | ||||
|  909 gctagctagctactatcatcgatcgat      426 27  0 44.44 62.627 34.38 25.37 46.11  9.627 | ||||
|  910 ttagctagctgactgatcgatcatcat      258 27  0 40.74 62.665 28.29 20.43 41.77  9.665 | ||||
|  911 tagctagctactgatcgatgctacatc      302 27  0 44.44 62.742 27.80  7.89 37.97  9.742 | ||||
|  912 ctagctagctactgatcgatgctacat      301 27  0 44.44 62.747 14.00  2.51  0.00  9.747 | ||||
|  913 gatcatcatctactatcatcatcatct      222 27  0 33.33 57.242  0.00  0.00  0.00  9.758 | ||||
|  914 tttagctagctgactgatcgatcatca      257 27  0 40.74 62.820 26.49 26.49 39.98  9.820 | ||||
|  915 tctactatcatcatcatctactagcta      230 27  0 33.33 57.100  0.00  0.00  0.00  9.900 | ||||
							
								
								
									
										1317
									
								
								samples/Formatted/wksst8110.for
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										1317
									
								
								samples/Formatted/wksst8110.for
									
									
									
									
									
										Normal file
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										25912
									
								
								samples/G-code/lm.g
									
									
									
									
									
								
							
							
						
						
									
										25912
									
								
								samples/G-code/lm.g
									
									
									
									
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										29735
									
								
								samples/G-code/rm.g
									
									
									
									
									
								
							
							
						
						
									
										29735
									
								
								samples/G-code/rm.g
									
									
									
									
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										91
									
								
								samples/GAS/hello.ms
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										91
									
								
								samples/GAS/hello.ms
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,91 @@ | ||||
| # output(): Hello, world.\n | ||||
| # mach(): all | ||||
|  | ||||
| # Emit hello world while switching back and forth between arm/thumb. | ||||
| # ??? Unfinished | ||||
|  | ||||
| 	.macro invalid | ||||
| # This is "undefined" but it's not properly decoded yet. | ||||
| 	.word 0x07ffffff | ||||
| # This is stc which isn't recognized yet. | ||||
| 	stc 0,cr0,[r0] | ||||
| 	.endm | ||||
|  | ||||
| 	.global _start | ||||
| _start: | ||||
| # Run some simple insns to confirm the engine is at least working. | ||||
| 	nop | ||||
|  | ||||
| # Skip over output text. | ||||
|  | ||||
| 	bl skip_output | ||||
|  | ||||
| hello_text: | ||||
| 	.asciz "Hello, world.\n" | ||||
|  | ||||
| 	.p2align 2 | ||||
| skip_output: | ||||
|  | ||||
| # Prime loop. | ||||
|  | ||||
| 	mov r4, r14 | ||||
|  | ||||
| output_next: | ||||
|  | ||||
| # Switch arm->thumb to output next chacter. | ||||
| # At this point r4 must point to the next character to output. | ||||
|  | ||||
| 	adr r0, into_thumb + 1 | ||||
| 	bx r0 | ||||
|  | ||||
| into_thumb: | ||||
| 	.thumb | ||||
|  | ||||
| # Output a character. | ||||
|  | ||||
| 	mov r0,#3 @ writec angel call | ||||
| 	mov r1,r4 | ||||
| 	swi 0xab @ ??? Confirm number. | ||||
|  | ||||
| # Switch thumb->arm. | ||||
|  | ||||
| 	adr r5, back_to_arm | ||||
| 	bx r5 | ||||
|  | ||||
| 	.p2align 2 | ||||
| back_to_arm: | ||||
| 	.arm | ||||
|  | ||||
| # Load next character, see if done. | ||||
|  | ||||
| 	add r4,r4,#1 | ||||
| 	sub r3,r3,r3 | ||||
| 	ldrb r5,[r4,r3] | ||||
| 	teq r5,#0 | ||||
| 	beq done | ||||
|  | ||||
| # Output a character (in arm mode). | ||||
|  | ||||
| 	mov r0,#3 | ||||
| 	mov r1,r4 | ||||
| 	swi #0x123456 | ||||
|  | ||||
| # Load next character, see if done. | ||||
|  | ||||
| 	add r4,r4,#1 | ||||
| 	sub r3,r3,r3 | ||||
| 	ldrb r5,[r4,r3] | ||||
| 	teq r5,#0 | ||||
| 	bne output_next | ||||
|  | ||||
| done: | ||||
| 	mov r0,#0x18 | ||||
| 	ldr r1,exit_code | ||||
| 	swi #0x123456 | ||||
|  | ||||
| # If that fails, try to die with an invalid insn. | ||||
|  | ||||
| 	invalid | ||||
|  | ||||
| exit_code: | ||||
| 	.word 0x20026 | ||||
							
								
								
									
										1157
									
								
								samples/Go/api.pb.go
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										1157
									
								
								samples/Go/api.pb.go
									
									
									
									
									
										Normal file
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										852
									
								
								samples/Go/embedded.go
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										852
									
								
								samples/Go/embedded.go
									
									
									
									
									
										Normal file
									
								
							
										
											
												File diff suppressed because one or more lines are too long
											
										
									
								
							
							
								
								
									
										18
									
								
								samples/Go/gen-go-linguist-thrift.go
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										18
									
								
								samples/Go/gen-go-linguist-thrift.go
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,18 @@ | ||||
| // Autogenerated by Thrift Compiler (1.0.0-dev) | ||||
| // DO NOT EDIT UNLESS YOU ARE SURE THAT YOU KNOW WHAT YOU ARE DOING | ||||
|  | ||||
| package linguist | ||||
|  | ||||
| import ( | ||||
| 	"bytes" | ||||
| 	"fmt" | ||||
| 	"git.apache.org/thrift.git/lib/go/thrift" | ||||
| ) | ||||
|  | ||||
| // (needed to ensure safety because of naive import list construction.) | ||||
| var _ = thrift.ZERO | ||||
| var _ = fmt.Printf | ||||
| var _ = bytes.Equal | ||||
|  | ||||
| func init() { | ||||
| } | ||||
							
								
								
									
										275
									
								
								samples/Groff/Tcl.n
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										275
									
								
								samples/Groff/Tcl.n
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,275 @@ | ||||
| '\" | ||||
| '\" Copyright (c) 1993 The Regents of the University of California. | ||||
| '\" Copyright (c) 1994-1996 Sun Microsystems, Inc. | ||||
| '\" | ||||
| '\" See the file "license.terms" for information on usage and redistribution | ||||
| '\" of this file, and for a DISCLAIMER OF ALL WARRANTIES. | ||||
| '\" | ||||
| .TH Tcl n "8.6" Tcl "Tcl Built-In Commands" | ||||
| .so man.macros | ||||
| .BS | ||||
| .SH NAME | ||||
| Tcl \- Tool Command Language | ||||
| .SH SYNOPSIS | ||||
| Summary of Tcl language syntax. | ||||
| .BE | ||||
| .SH DESCRIPTION | ||||
| .PP | ||||
| The following rules define the syntax and semantics of the Tcl language: | ||||
| .IP "[1] \fBCommands.\fR" | ||||
| A Tcl script is a string containing one or more commands. | ||||
| Semi-colons and newlines are command separators unless quoted as | ||||
| described below. | ||||
| Close brackets are command terminators during command substitution | ||||
| (see below) unless quoted. | ||||
| .IP "[2] \fBEvaluation.\fR" | ||||
| A command is evaluated in two steps. | ||||
| First, the Tcl interpreter breaks the command into \fIwords\fR | ||||
| and performs substitutions as described below. | ||||
| These substitutions are performed in the same way for all | ||||
| commands. | ||||
| Secondly, the first word is used to locate a command procedure to | ||||
| carry out the command, then all of the words of the command are | ||||
| passed to the command procedure. | ||||
| The command procedure is free to interpret each of its words | ||||
| in any way it likes, such as an integer, variable name, list, | ||||
| or Tcl script. | ||||
| Different commands interpret their words differently. | ||||
| .IP "[3] \fBWords.\fR" | ||||
| Words of a command are separated by white space (except for | ||||
| newlines, which are command separators). | ||||
| .IP "[4] \fBDouble quotes.\fR" | ||||
| If the first character of a word is double-quote | ||||
| .PQ \N'34' | ||||
| then the word is terminated by the next double-quote character. | ||||
| If semi-colons, close brackets, or white space characters | ||||
| (including newlines) appear between the quotes then they are treated | ||||
| as ordinary characters and included in the word. | ||||
| Command substitution, variable substitution, and backslash substitution | ||||
| are performed on the characters between the quotes as described below. | ||||
| The double-quotes are not retained as part of the word. | ||||
| .IP "[5] \fBArgument expansion.\fR" | ||||
| If a word starts with the string | ||||
| .QW {*} | ||||
| followed by a non-whitespace character, then the leading | ||||
| .QW {*} | ||||
| is removed and the rest of the word is parsed and substituted as any other | ||||
| word. After substitution, the word is parsed as a list (without command or | ||||
| variable substitutions; backslash substitutions are performed as is normal for | ||||
| a list and individual internal words may be surrounded by either braces or | ||||
| double-quote characters), and its words are added to the command being | ||||
| substituted. For instance, | ||||
| .QW "cmd a {*}{b [c]} d {*}{$e f {g h}}" | ||||
| is equivalent to | ||||
| .QW "cmd a b {[c]} d {$e} f {g h}" . | ||||
| .IP "[6] \fBBraces.\fR" | ||||
| If the first character of a word is an open brace | ||||
| .PQ { | ||||
| and rule [5] does not apply, then | ||||
| the word is terminated by the matching close brace | ||||
| .PQ } "" . | ||||
| Braces nest within the word: for each additional open | ||||
| brace there must be an additional close brace (however, | ||||
| if an open brace or close brace within the word is | ||||
| quoted with a backslash then it is not counted in locating the | ||||
| matching close brace). | ||||
| No substitutions are performed on the characters between the | ||||
| braces except for backslash-newline substitutions described | ||||
| below, nor do semi-colons, newlines, close brackets, | ||||
| or white space receive any special interpretation. | ||||
| The word will consist of exactly the characters between the | ||||
| outer braces, not including the braces themselves. | ||||
| .IP "[7] \fBCommand substitution.\fR" | ||||
| If a word contains an open bracket | ||||
| .PQ [ | ||||
| then Tcl performs \fIcommand substitution\fR. | ||||
| To do this it invokes the Tcl interpreter recursively to process | ||||
| the characters following the open bracket as a Tcl script. | ||||
| The script may contain any number of commands and must be terminated | ||||
| by a close bracket | ||||
| .PQ ] "" . | ||||
| The result of the script (i.e. the result of its last command) is | ||||
| substituted into the word in place of the brackets and all of the | ||||
| characters between them. | ||||
| There may be any number of command substitutions in a single word. | ||||
| Command substitution is not performed on words enclosed in braces. | ||||
| .IP "[8] \fBVariable substitution.\fR" | ||||
| If a word contains a dollar-sign | ||||
| .PQ $ | ||||
| followed by one of the forms | ||||
| described below, then Tcl performs \fIvariable | ||||
| substitution\fR:  the dollar-sign and the following characters are | ||||
| replaced in the word by the value of a variable. | ||||
| Variable substitution may take any of the following forms: | ||||
| .RS | ||||
| .TP 15 | ||||
| \fB$\fIname\fR | ||||
| . | ||||
| \fIName\fR is the name of a scalar variable;  the name is a sequence | ||||
| of one or more characters that are a letter, digit, underscore, | ||||
| or namespace separators (two or more colons). | ||||
| Letters and digits are \fIonly\fR the standard ASCII ones (\fB0\fR\(en\fB9\fR, | ||||
| \fBA\fR\(en\fBZ\fR and \fBa\fR\(en\fBz\fR). | ||||
| .TP 15 | ||||
| \fB$\fIname\fB(\fIindex\fB)\fR | ||||
| . | ||||
| \fIName\fR gives the name of an array variable and \fIindex\fR gives | ||||
| the name of an element within that array. | ||||
| \fIName\fR must contain only letters, digits, underscores, and | ||||
| namespace separators, and may be an empty string. | ||||
| Letters and digits are \fIonly\fR the standard ASCII ones (\fB0\fR\(en\fB9\fR, | ||||
| \fBA\fR\(en\fBZ\fR and \fBa\fR\(en\fBz\fR). | ||||
| Command substitutions, variable substitutions, and backslash | ||||
| substitutions are performed on the characters of \fIindex\fR. | ||||
| .TP 15 | ||||
| \fB${\fIname\fB}\fR | ||||
| . | ||||
| \fIName\fR is the name of a scalar variable or array element.  It may contain | ||||
| any characters whatsoever except for close braces.  It indicates an array | ||||
| element if \fIname\fR is in the form | ||||
| .QW \fIarrayName\fB(\fIindex\fB)\fR | ||||
| where \fIarrayName\fR does not contain any open parenthesis characters, | ||||
| .QW \fB(\fR , | ||||
| or close brace characters, | ||||
| .QW \fB}\fR , | ||||
| and \fIindex\fR can be any sequence of characters except for close brace | ||||
| characters.  No further | ||||
| substitutions are performed during the parsing of \fIname\fR. | ||||
| .PP | ||||
| There may be any number of variable substitutions in a single word. | ||||
| Variable substitution is not performed on words enclosed in braces. | ||||
| .PP | ||||
| Note that variables may contain character sequences other than those listed | ||||
| above, but in that case other mechanisms must be used to access them (e.g., | ||||
| via the \fBset\fR command's single-argument form). | ||||
| .RE | ||||
| .IP "[9] \fBBackslash substitution.\fR" | ||||
| If a backslash | ||||
| .PQ \e | ||||
| appears within a word then \fIbackslash substitution\fR occurs. | ||||
| In all cases but those described below the backslash is dropped and | ||||
| the following character is treated as an ordinary | ||||
| character and included in the word. | ||||
| This allows characters such as double quotes, close brackets, | ||||
| and dollar signs to be included in words without triggering | ||||
| special processing. | ||||
| The following table lists the backslash sequences that are | ||||
| handled specially, along with the value that replaces each sequence. | ||||
| .RS | ||||
| .TP 7 | ||||
| \e\fBa\fR | ||||
| Audible alert (bell) (Unicode U+000007). | ||||
| .TP 7 | ||||
| \e\fBb\fR | ||||
| Backspace (Unicode U+000008). | ||||
| .TP 7 | ||||
| \e\fBf\fR | ||||
| Form feed (Unicode U+00000C). | ||||
| .TP 7 | ||||
| \e\fBn\fR | ||||
| Newline (Unicode U+00000A). | ||||
| .TP 7 | ||||
| \e\fBr\fR | ||||
| Carriage-return (Unicode U+00000D). | ||||
| .TP 7 | ||||
| \e\fBt\fR | ||||
| Tab (Unicode U+000009). | ||||
| .TP 7 | ||||
| \e\fBv\fR | ||||
| Vertical tab (Unicode U+00000B). | ||||
| .TP 7 | ||||
| \e\fB<newline>\fIwhiteSpace\fR | ||||
| . | ||||
| A single space character replaces the backslash, newline, and all spaces | ||||
| and tabs after the newline.  This backslash sequence is unique in that it | ||||
| is replaced in a separate pre-pass before the command is actually parsed. | ||||
| This means that it will be replaced even when it occurs between braces, | ||||
| and the resulting space will be treated as a word separator if it is not | ||||
| in braces or quotes. | ||||
| .TP 7 | ||||
| \e\e | ||||
| Backslash | ||||
| .PQ \e "" . | ||||
| .TP 7 | ||||
| \e\fIooo\fR  | ||||
| . | ||||
| The digits \fIooo\fR (one, two, or three of them) give a eight-bit octal  | ||||
| value for the Unicode character that will be inserted, in the range | ||||
| \fI000\fR\(en\fI377\fR (i.e., the range U+000000\(enU+0000FF). | ||||
| The parser will stop just before this range overflows, or when | ||||
| the maximum of three digits is reached.  The upper bits of the Unicode | ||||
| character will be 0. | ||||
| .TP 7 | ||||
| \e\fBx\fIhh\fR  | ||||
| . | ||||
| The hexadecimal digits \fIhh\fR (one or two of them) give an eight-bit | ||||
| hexadecimal value for the Unicode character that will be inserted.  The upper | ||||
| bits of the Unicode character will be 0 (i.e., the character will be in the | ||||
| range U+000000\(enU+0000FF). | ||||
| .TP 7 | ||||
| \e\fBu\fIhhhh\fR  | ||||
| . | ||||
| The hexadecimal digits \fIhhhh\fR (one, two, three, or four of them) give a | ||||
| sixteen-bit hexadecimal value for the Unicode character that will be | ||||
| inserted.  The upper bits of the Unicode character will be 0 (i.e., the | ||||
| character will be in the range U+000000\(enU+00FFFF). | ||||
| .TP 7 | ||||
| \e\fBU\fIhhhhhhhh\fR  | ||||
| . | ||||
| The hexadecimal digits \fIhhhhhhhh\fR (one up to eight of them) give a | ||||
| twenty-one-bit hexadecimal value for the Unicode character that will be | ||||
| inserted, in the range U+000000\(enU+10FFFF.  The parser will stop just | ||||
| before this range overflows, or when the maximum of eight digits | ||||
| is reached.  The upper bits of the Unicode character will be 0. | ||||
| .RS | ||||
| .PP | ||||
| The range U+010000\(enU+10FFFD is reserved for the future. | ||||
| .RE | ||||
| .PP | ||||
| Backslash substitution is not performed on words enclosed in braces, | ||||
| except for backslash-newline as described above. | ||||
| .RE | ||||
| .IP "[10] \fBComments.\fR" | ||||
| If a hash character | ||||
| .PQ # | ||||
| appears at a point where Tcl is | ||||
| expecting the first character of the first word of a command, | ||||
| then the hash character and the characters that follow it, up | ||||
| through the next newline, are treated as a comment and ignored. | ||||
| The comment character only has significance when it appears | ||||
| at the beginning of a command. | ||||
| .IP "[11] \fBOrder of substitution.\fR" | ||||
| Each character is processed exactly once by the Tcl interpreter | ||||
| as part of creating the words of a command. | ||||
| For example, if variable substitution occurs then no further | ||||
| substitutions are performed on the value of the variable;  the | ||||
| value is inserted into the word verbatim. | ||||
| If command substitution occurs then the nested command is | ||||
| processed entirely by the recursive call to the Tcl interpreter; | ||||
| no substitutions are performed before making the recursive | ||||
| call and no additional substitutions are performed on the result | ||||
| of the nested script. | ||||
| .RS | ||||
| .PP | ||||
| Substitutions take place from left to right, and each substitution is | ||||
| evaluated completely before attempting to evaluate the next.  Thus, a | ||||
| sequence like | ||||
| .PP | ||||
| .CS | ||||
| set y [set x 0][incr x][incr x] | ||||
| .CE | ||||
| .PP | ||||
| will always set the variable \fIy\fR to the value, \fI012\fR. | ||||
| .RE | ||||
| .IP "[12] \fBSubstitution and word boundaries.\fR" | ||||
| Substitutions do not affect the word boundaries of a command, | ||||
| except for argument expansion as specified in rule [5]. | ||||
| For example, during variable substitution the entire value of | ||||
| the variable becomes part of a single word, even if the variable's | ||||
| value contains spaces. | ||||
| .SH KEYWORDS | ||||
| backslash, command, comment, script, substitution, variable | ||||
| '\" Local Variables: | ||||
| '\" mode: nroff | ||||
| '\" fill-column: 78 | ||||
| '\" End: | ||||
							
								
								
									
										135
									
								
								samples/Groff/create_view.l
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										135
									
								
								samples/Groff/create_view.l
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,135 @@ | ||||
| .\\" auto-generated by docbook2man-spec $Revision: 1.1.1.1 $ | ||||
| .TH "CREATE VIEW" "" "2005-11-05" "SQL - Language Statements" "SQL Commands" | ||||
| .SH NAME | ||||
| CREATE VIEW \- define a new view | ||||
|  | ||||
| .SH SYNOPSIS | ||||
| .sp | ||||
| .nf | ||||
| CREATE [ OR REPLACE ] [ TEMP | TEMPORARY ] VIEW \fIname\fR [ ( \fIcolumn_name\fR [, ...] ) ] | ||||
|     AS \fIquery\fR | ||||
| .sp | ||||
| .fi | ||||
| .SH "DESCRIPTION" | ||||
| .PP | ||||
| \fBCREATE VIEW\fR defines a view of a query. The view | ||||
| is not physically materialized. Instead, the query is run every time | ||||
| the view is referenced in a query. | ||||
| .PP | ||||
| \fBCREATE OR REPLACE VIEW\fR is similar, but if a view | ||||
| of the same name already exists, it is replaced. You can only replace | ||||
| a view with a new query that generates the identical set of columns | ||||
| (i.e., same column names and data types). | ||||
| .PP | ||||
| If a schema name is given (for example, CREATE VIEW | ||||
| myschema.myview ...) then the view is created in the specified | ||||
| schema. Otherwise it is created in the current schema. Temporary | ||||
| views exist in a special schema, so a schema name may not be given | ||||
| when creating a temporary view. The name of the view must be | ||||
| distinct from the name of any other view, table, sequence, or index | ||||
| in the same schema. | ||||
| .SH "PARAMETERS" | ||||
| .TP | ||||
| \fBTEMPORARY or TEMP\fR | ||||
| If specified, the view is created as a temporary view. | ||||
| Temporary views are automatically dropped at the end of the | ||||
| current session. Existing | ||||
| permanent relations with the same name are not visible to the | ||||
| current session while the temporary view exists, unless they are | ||||
| referenced with schema-qualified names. | ||||
|  | ||||
| If any of the tables referenced by the view are temporary, | ||||
| the view is created as a temporary view (whether | ||||
| TEMPORARY is specified or not). | ||||
| .TP | ||||
| \fB\fIname\fB\fR | ||||
| The name (optionally schema-qualified) of a view to be created. | ||||
| .TP | ||||
| \fB\fIcolumn_name\fB\fR | ||||
| An optional list of names to be used for columns of the view. | ||||
| If not given, the column names are deduced from the query. | ||||
| .TP | ||||
| \fB\fIquery\fB\fR | ||||
| A query (that is, a \fBSELECT\fR statement) which will | ||||
| provide the columns and rows of the view. | ||||
|  | ||||
| Refer to SELECT [\fBselect\fR(l)] | ||||
| for more information about valid queries. | ||||
| .SH "NOTES" | ||||
| .PP | ||||
| Currently, views are read only: the system will not allow an insert, | ||||
| update, or delete on a view. You can get the effect of an updatable | ||||
| view by creating rules that rewrite inserts, etc. on the view into | ||||
| appropriate actions on other tables. For more information see | ||||
| CREATE RULE [\fBcreate_rule\fR(l)]. | ||||
| .PP | ||||
| Use the DROP VIEW [\fBdrop_view\fR(l)] | ||||
| statement to drop views. | ||||
| .PP | ||||
| Be careful that the names and types of the view's columns will be | ||||
| assigned the way you want. For example, | ||||
| .sp | ||||
| .nf | ||||
| CREATE VIEW vista AS SELECT 'Hello World'; | ||||
| .sp | ||||
| .fi | ||||
| is bad form in two ways: the column name defaults to ?column?, | ||||
| and the column data type defaults to \fBunknown\fR. If you want a | ||||
| string literal in a view's result, use something like | ||||
| .sp | ||||
| .nf | ||||
| CREATE VIEW vista AS SELECT text 'Hello World' AS hello; | ||||
| .sp | ||||
| .fi | ||||
| .PP | ||||
| Access to tables referenced in the view is determined by permissions of | ||||
| the view owner. However, functions called in the view are treated the | ||||
| same as if they had been called directly from the query using the view. | ||||
| Therefore the user of a view must have permissions to call all functions | ||||
| used by the view. | ||||
| .SH "EXAMPLES" | ||||
| .PP | ||||
| Create a view consisting of all comedy films: | ||||
| .sp | ||||
| .nf | ||||
| CREATE VIEW comedies AS | ||||
|     SELECT * | ||||
|     FROM films | ||||
|     WHERE kind = 'Comedy'; | ||||
| .sp | ||||
| .fi | ||||
| .SH "COMPATIBILITY" | ||||
| .PP | ||||
| The SQL standard specifies some additional capabilities for the | ||||
| \fBCREATE VIEW\fR statement: | ||||
| .sp | ||||
| .nf | ||||
| CREATE VIEW \fIname\fR [ ( \fIcolumn_name\fR [, ...] ) ] | ||||
|     AS \fIquery\fR | ||||
|     [ WITH [ CASCADED | LOCAL ] CHECK OPTION ] | ||||
| .sp | ||||
| .fi | ||||
| .PP | ||||
| The optional clauses for the full SQL command are: | ||||
| .TP | ||||
| \fBCHECK OPTION\fR | ||||
| This option has to do with updatable views. All | ||||
| \fBINSERT\fR and \fBUPDATE\fR commands on the view | ||||
| will be checked to ensure data satisfy the view-defining | ||||
| condition (that is, the new data would be visible through the | ||||
| view). If they do not, the update will be rejected. | ||||
| .TP | ||||
| \fBLOCAL\fR | ||||
| Check for integrity on this view. | ||||
| .TP | ||||
| \fBCASCADED\fR | ||||
| Check for integrity on this view and on any dependent | ||||
| view. CASCADED is assumed if neither | ||||
| CASCADED nor LOCAL is specified. | ||||
| .PP | ||||
| .PP | ||||
| \fBCREATE OR REPLACE VIEW\fR is a | ||||
| PostgreSQL language extension. | ||||
| So is the concept of a temporary view. | ||||
| .SH "SEE ALSO" | ||||
| DROP VIEW [\fBdrop_view\fR(l)] | ||||
							
								
								
									
										1174
									
								
								samples/Groff/fsinterface.ms
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										1174
									
								
								samples/Groff/fsinterface.ms
									
									
									
									
									
										Normal file
									
								
							
										
											
												File diff suppressed because it is too large
												Load Diff
											
										
									
								
							
							
								
								
									
										6
									
								
								samples/HCL/example.hcl
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										6
									
								
								samples/HCL/example.hcl
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,6 @@ | ||||
| consul = "1.2.3.4" | ||||
|  | ||||
| // This is a comment | ||||
| template "foo" { | ||||
|   bar = "zip" | ||||
| } | ||||
							
								
								
									
										13
									
								
								samples/HCL/example.tf
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										13
									
								
								samples/HCL/example.tf
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,13 @@ | ||||
| resource "aws_instance" "web" { | ||||
|   // Copies the myapp.conf file to /etc/myapp.conf | ||||
|   provisioner "file" { | ||||
|     source = "conf/myapp.conf" | ||||
|     destination = "/etc/myapp.conf" | ||||
|   } | ||||
|  | ||||
|   // Copies the configs.d folder to /etc/configs.d | ||||
|   provisioner "file" { | ||||
|     source = "conf/configs.d" | ||||
|     destination = "/etc" | ||||
|   } | ||||
| } | ||||
							
								
								
									
										31
									
								
								samples/HTML/rpanel.inc
									
									
									
									
									
										Normal file
									
								
							
							
						
						
									
										31
									
								
								samples/HTML/rpanel.inc
									
									
									
									
									
										Normal file
									
								
							| @@ -0,0 +1,31 @@ | ||||
| <!DOCTYPE html> | ||||
| <html> | ||||
| <head> | ||||
| <link rel="stylesheet" charset="UTF-8" type="text/css" href="main.css"> | ||||
| <meta charset="UTF-8"> | ||||
| </head> | ||||
| <body> | ||||
|     <div id="panel_header_main_form"> | ||||
|         <p id="panel_header_main_form_title">Поддержка:</p> | ||||
|     </div> | ||||
|     <table> | ||||
|         <tbody> | ||||
|             <tr> | ||||
|                 <td>     | ||||
|                     <p>Москва:</p> | ||||
|                 </td> | ||||
|                 <td>     | ||||
|                     <p>+7-902-7-800-807</p> | ||||
|                 </td> | ||||
|             </tr> | ||||
|             <tr> | ||||
|                 <td>     | ||||
|                     <p>Регионы:</p> | ||||
|                 </td> | ||||
|                 <td>     | ||||
|                     <p>+7-902-7-800-807</p> | ||||
|                 </td> | ||||
|             </tr> | ||||
|         </tbody> | ||||
|     </table> | ||||
| </body> | ||||
Some files were not shown because too many files have changed in this diff Show More
		Reference in New Issue
	
	Block a user