Temporarily removing Handlebars highlighting

Add Unity3D Asset and Metadata files

.gitmodules

@@ -96,7 +96,7 @@
 	url = https://github.com/bfad/Sublime-Lasso
 [submodule "vendor/grammars/chapel-tmbundle"]
 	path = vendor/grammars/chapel-tmbundle
-	url = https://github.com/bholt/chapel-tmbundle
+	url = https://github.com/chapel-lang/chapel-tmbundle
 [submodule "vendor/grammars/sublime-nginx"]
 	path = vendor/grammars/sublime-nginx
 	url = https://github.com/brandonwamboldt/sublime-nginx
@@ -118,9 +118,6 @@
 [submodule "vendor/grammars/cucumber-tmbundle"]
 	path = vendor/grammars/cucumber-tmbundle
 	url = https://github.com/cucumber/cucumber-tmbundle
-[submodule "vendor/grammars/Handlebars"]
-	path = vendor/grammars/Handlebars
-	url = https://github.com/daaain/Handlebars
 [submodule "vendor/grammars/powershell"]
 	path = vendor/grammars/powershell
 	url = https://github.com/SublimeText/PowerShell
@@ -169,9 +166,6 @@
 [submodule "vendor/grammars/Textmate-Gosu-Bundle"]
 	path = vendor/grammars/Textmate-Gosu-Bundle
 	url = https://github.com/jpcamara/Textmate-Gosu-Bundle
-[submodule "vendor/grammars/jquery-tmbundle"]
-	path = vendor/grammars/jquery-tmbundle
-	url = https://github.com/kswedberg/jquery-tmbundle
 [submodule "vendor/grammars/fish-tmbundle"]
 	path = vendor/grammars/fish-tmbundle
 	url = https://github.com/l15n/fish-tmbundle
@@ -346,9 +340,6 @@
 [submodule "vendor/grammars/java.tmbundle"]
 	path = vendor/grammars/java.tmbundle
 	url = https://github.com/textmate/java.tmbundle
-[submodule "vendor/grammars/javadoc.tmbundle"]
-	path = vendor/grammars/javadoc.tmbundle
-	url = https://github.com/textmate/javadoc.tmbundle
 [submodule "vendor/grammars/javascript-objective-j.tmbundle"]
 	path = vendor/grammars/javascript-objective-j.tmbundle
 	url = https://github.com/textmate/javascript-objective-j.tmbundle
@@ -397,9 +388,6 @@
 [submodule "vendor/grammars/pascal.tmbundle"]
 	path = vendor/grammars/pascal.tmbundle
 	url = https://github.com/textmate/pascal.tmbundle
-[submodule "vendor/grammars/perl.tmbundle"]
-	path = vendor/grammars/perl.tmbundle
-	url = https://github.com/textmate/perl.tmbundle
 [submodule "vendor/grammars/php-smarty.tmbundle"]
 	path = vendor/grammars/php-smarty.tmbundle
 	url = https://github.com/textmate/php-smarty.tmbundle
@@ -427,9 +415,6 @@
 [submodule "vendor/grammars/ruby-haml.tmbundle"]
 	path = vendor/grammars/ruby-haml.tmbundle
 	url = https://github.com/textmate/ruby-haml.tmbundle
-[submodule "vendor/grammars/ruby-on-rails-tmbundle"]
-	path = vendor/grammars/ruby-on-rails-tmbundle
-	url = https://github.com/textmate/ruby-on-rails-tmbundle
 [submodule "vendor/grammars/scheme.tmbundle"]
 	path = vendor/grammars/scheme.tmbundle
 	url = https://github.com/textmate/scheme.tmbundle
@@ -448,15 +433,6 @@
 [submodule "vendor/grammars/tcl.tmbundle"]
 	path = vendor/grammars/tcl.tmbundle
 	url = https://github.com/textmate/tcl.tmbundle
-[submodule "vendor/grammars/text.tmbundle"]
-	path = vendor/grammars/text.tmbundle
-	url = https://github.com/textmate/text.tmbundle
-[submodule "vendor/grammars/textile.tmbundle"]
-	path = vendor/grammars/textile.tmbundle
-	url = https://github.com/textmate/textile.tmbundle
-[submodule "vendor/grammars/textmate.tmbundle"]
-	path = vendor/grammars/textmate.tmbundle
-	url = https://github.com/textmate/textmate.tmbundle
 [submodule "vendor/grammars/thrift.tmbundle"]
 	path = vendor/grammars/thrift.tmbundle
 	url = https://github.com/textmate/thrift.tmbundle
@@ -490,10 +466,6 @@
 [submodule "vendor/grammars/sublime-nix"]
 	path = vendor/grammars/sublime-nix
 	url = https://github.com/wmertens/sublime-nix
-[submodule "vendor/grammars/ada.tmbundle"]
-	path = vendor/grammars/ada.tmbundle
-	url = https://github.com/aroben/ada.tmbundle
-	branch = better-with-highlighting
 [submodule "vendor/grammars/oz-tmbundle"]
 	path = vendor/grammars/oz-tmbundle
 	url = https://github.com/eregon/oz-tmbundle
@@ -615,6 +587,12 @@
 [submodule "vendor/grammars/mediawiki.tmbundle"]
 	path = vendor/grammars/mediawiki.tmbundle
 	url = https://github.com/textmate/mediawiki.tmbundle
+[submodule "vendor/grammars/SublimeClarion"]
+	path = vendor/grammars/SublimeClarion
+	url = https://github.com/fushnisoft/SublimeClarion
+[submodule "vendor/grammars/oracle.tmbundle"]
+	path = vendor/grammars/oracle.tmbundle
+	url = https://github.com/mulander/oracle.tmbundle.git
 [submodule "vendor/grammars/BrightScript.tmbundle"]
 	path = vendor/grammars/BrightScript.tmbundle
 	url = https://github.com/cmink/BrightScript.tmbundle
@@ -627,3 +605,36 @@
 [submodule "vendor/grammars/sublime-text-pig-latin"]
 	path = vendor/grammars/sublime-text-pig-latin
 	url = https://github.com/goblindegook/sublime-text-pig-latin
+[submodule "vendor/grammars/Lean.tmbundle"]
+	path = vendor/grammars/Lean.tmbundle
+	url = https://github.com/leanprover/Lean.tmbundle
+[submodule "vendor/grammars/ampl"]
+	path = vendor/grammars/ampl
+	url = https://github.com/ampl/sublime-ampl
+[submodule "vendor/grammars/openscad.tmbundle"]
+	path = vendor/grammars/openscad.tmbundle
+	url = https://github.com/tbuser/openscad.tmbundle
+[submodule "vendor/grammars/sublime-varnish"]
+	path = vendor/grammars/sublime-varnish
+	url = https://github.com/brandonwamboldt/sublime-varnish
+[submodule "vendor/grammars/xc.tmbundle"]
+	path = vendor/grammars/xc.tmbundle
+	url = https://github.com/graymalkin/xc.tmbundle
+[submodule "vendor/grammars/perl.tmbundle"]
+	path = vendor/grammars/perl.tmbundle
+	url = https://github.com/textmate/perl.tmbundle
+[submodule "vendor/grammars/sublime-netlinx"]
+	path = vendor/grammars/sublime-netlinx
+	url = https://github.com/amclain/sublime-netlinx
+[submodule "vendor/grammars/Sublime-Red"]
+	path = vendor/grammars/Sublime-Red
+	url = https://github.com/Oldes/Sublime-Red
+[submodule "vendor/grammars/jflex.tmbundle"]
+	path = vendor/grammars/jflex.tmbundle
+	url = https://github.com/jflex-de/jflex.tmbundle.git
+[submodule "vendor/grammars/ada.tmbundle"]
+	path = vendor/grammars/ada.tmbundle
+	url = https://github.com/textmate/ada.tmbundle
+[submodule "vendor/grammars/api-blueprint-sublime-plugin"]
+	path = vendor/grammars/api-blueprint-sublime-plugin
+	url = https://github.com/apiaryio/api-blueprint-sublime-plugin

.travis.yml

@@ -1,4 +1,3 @@
-sudo: false
 before_install: script/travis/before_install
 rvm:
   - 1.9.3

CONTRIBUTING.md

@@ -37,7 +37,7 @@ Assuming your code is being detected as the right language, in most cases this i
 
 You can also try to fix the bug yourself and submit a Pull Request. [TextMate's documentation](http://manual.macromates.com/en/language_grammars) offers a good introduction on how to work with TextMate-compatible grammars. You can test grammars using [Lightshow](https://github-lightshow.herokuapp.com).
 
-Once the bug has been fixed upstream, please let us know and we'll pick it up for GitHub.
+Once the bug has been fixed upstream, we'll pick it up for GitHub in the next release of Linguist.
 
 ## Testing
 

README.md

@@ -26,7 +26,7 @@ Linguist supports a number of different custom overrides strategies for language
 
 ### Using gitattributes
 
-Add a `.gitattributes` file to your project and use standard git-style path matchers for the files you want to override to set `linguist-documentation`, `linguist-language`, and `linguist-vendored`.
+Add a `.gitattributes` file to your project and use standard git-style path matchers for the files you want to override to set `linguist-documentation`, `linguist-language`, and `linguist-vendored`. `.gitattributes` will be used to determine language statistics, but will not be used to syntax highlight files. To manually set syntax highlighting, use [Vim or Emacs modelines](#using-emacs-and-vim-modelines).
 
 ```
 $ cat .gitattributes
@@ -35,7 +35,7 @@ $ cat .gitattributes
 
 Checking code you didn't write, such as JavaScript libraries, into your git repo is a common practice, but this often inflates your project's language stats and may even cause your project to be labeled as another language. By default, Linguist treats all of the paths defined in [lib/linguist/vendor.yml](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml) as vendored and therefore doesn't include them in the language statistics for a repository. Vendored files are also hidden by default in diffs on github.com.
 
-Use the `linguist-vendored` attribute to vendor or un-vendor paths.
+Use the `linguist-vendored` attribute to vendor or un-vendor paths. Please note, overriding the vendored (or un-vendored) status of a file only affects the language statistics for the repository and not the behavior in diffs on github.com.
 
 ```
 $ cat .gitattributes
@@ -53,16 +53,18 @@ project-docs/* linguist-documentation
 docs/formatter.rb linguist-documentation=false
 ```
 
-### Using Emacs and Vim modelines
+### Using Emacs or Vim modelines
 
-Alternatively, you can use Vim and Emacs style modelines to set the language for a single file. Modelines can be placed anywhere within a file and are respected when determining how to syntax-highlight a file on GitHub.com
+Alternatively, you can use Vim or Emacs style modelines to set the language for a single file. Modelines can be placed anywhere within a file and are respected when determining how to syntax-highlight a file on GitHub.com
 
+##### Vim
 ```
-Vim
 vim: set filetype=prolog:
 vim: set ft=cpp:
+```
 
-Emacs
+##### Emacs
+```
 -*- mode: php;-*-
 ```
 

bin/linguist

@@ -2,10 +2,8 @@
 
 # linguist — detect language type for a file, or, given a directory, determine language breakdown
 #     usage: linguist <path> [<--breakdown>]
-
-require 'linguist/file_blob'
-require 'linguist/language'
-require 'linguist/repository'
+#
+require 'linguist'
 require 'rugged'
 
 path = ARGV[0] || Dir.pwd

github-linguist.gemspec

@@ -14,13 +14,14 @@ Gem::Specification.new do |s|
   s.executables << 'linguist'
 
   s.add_dependency 'charlock_holmes', '~> 0.7.3'
-  s.add_dependency 'escape_utils',    '~> 1.0.1'
+  s.add_dependency 'escape_utils',    '~> 1.1.0'
   s.add_dependency 'mime-types',      '>= 1.19'
-  s.add_dependency 'rugged',          '~> 0.22.0b4'
+  s.add_dependency 'rugged',          '~> 0.23.0b1'
 
   s.add_development_dependency 'minitest', '>= 5.0'
   s.add_development_dependency 'mocha'
   s.add_development_dependency 'pry'
   s.add_development_dependency 'rake'
   s.add_development_dependency 'yajl-ruby'
+  s.add_development_dependency 'color-proximity', '~> 0.2.1'
 end

grammars.yml

@@ -50,8 +50,6 @@ vendor/grammars/G-Code/:
 - source.gcode
 vendor/grammars/GDScript-sublime/:
 - source.gdscript
-vendor/grammars/Handlebars:
-- text.html.handlebars
 vendor/grammars/IDL-Syntax:
 - source.webidl
 vendor/grammars/InnoSetup/:
@@ -63,6 +61,8 @@ vendor/grammars/JSyntax/:
 - source.j
 vendor/grammars/Julia.tmbundle:
 - source.julia
+vendor/grammars/Lean.tmbundle:
+- source.lean
 vendor/grammars/LiveScript.tmbundle:
 - source.livescript
 vendor/grammars/Modelica/:
@@ -111,6 +111,8 @@ vendor/grammars/Sublime-QML:
 - source.qml
 vendor/grammars/Sublime-REBOL:
 - source.rebol
+vendor/grammars/Sublime-Red:
+- source.red
 vendor/grammars/Sublime-SQF-Language:
 - source.sqf
 vendor/grammars/Sublime-Text-2-OpenEdge-ABL:
@@ -119,6 +121,8 @@ vendor/grammars/Sublime-VimL:
 - source.viml
 vendor/grammars/SublimeBrainfuck:
 - source.bf
+vendor/grammars/SublimeClarion/:
+- source.clarion
 vendor/grammars/SublimePapyrus/:
 - source.compiled-papyrus
 - source.papyrus
@@ -141,6 +145,8 @@ vendor/grammars/actionscript3-tmbundle:
 - text.xml.flex-config
 vendor/grammars/ada.tmbundle:
 - source.ada
+vendor/grammars/ampl:
+- source.ampl
 vendor/grammars/ant.tmbundle:
 - text.xml.ant
 vendor/grammars/antlr.tmbundle:
@@ -148,6 +154,9 @@ vendor/grammars/antlr.tmbundle:
 vendor/grammars/apache.tmbundle:
 - source.apache-config
 - source.apache-config.mod_perl
+vendor/grammars/api-blueprint-sublime-plugin/:
+- text.html.markdown.source.gfm.apib
+- text.html.markdown.source.gfm.mson
 vendor/grammars/applescript.tmbundle:
 - source.applescript
 vendor/grammars/asciidoc.tmbundle/:
@@ -285,12 +294,10 @@ vendor/grammars/java.tmbundle:
 - source.java-properties
 - text.html.jsp
 - text.junit-test-report
-vendor/grammars/javadoc.tmbundle:
-- text.html.javadoc
 vendor/grammars/javascript-objective-j.tmbundle:
 - source.js.objj
-vendor/grammars/jquery-tmbundle:
-- source.js.jquery
+vendor/grammars/jflex.tmbundle:
+- source.jflex
 vendor/grammars/json.tmbundle:
 - source.json
 vendor/grammars/kotlin-sublime-package:
@@ -381,14 +388,19 @@ vendor/grammars/ooc.tmbundle:
 - source.ooc
 vendor/grammars/opa.tmbundle:
 - source.opa
+vendor/grammars/openscad.tmbundle/:
+- source.scad
+vendor/grammars/oracle.tmbundle:
+- source.plsql.oracle
 vendor/grammars/oz-tmbundle/Syntaxes/Oz.tmLanguage:
 - source.oz
 vendor/grammars/pascal.tmbundle:
 - source.pascal
-vendor/grammars/perl.tmbundle:
+vendor/grammars/perl.tmbundle/:
 - source.perl
+- source.perl.6
 vendor/grammars/php-smarty.tmbundle:
-- source.smarty
+- text.html.smarty
 vendor/grammars/php.tmbundle:
 - text.html.php
 vendor/grammars/pike-textmate:
@@ -415,20 +427,14 @@ vendor/grammars/restructuredtext.tmbundle:
 - text.restructuredtext
 vendor/grammars/ruby-haml.tmbundle:
 - text.haml
-vendor/grammars/ruby-on-rails-tmbundle:
-- source.js.erb.rails
-- source.ruby.rails
-- source.ruby.rails.rjs
-- source.sql.ruby
-- text.html.erb.rails
 vendor/grammars/ruby-slim.tmbundle:
 - text.slim
 vendor/grammars/ruby.tmbundle:
 - source.ruby
 - text.html.erb
 vendor/grammars/sas.tmbundle:
-- source.SASLog
 - source.sas
+- source.sas_log
 vendor/grammars/sass-textmate-bundle:
 - source.sass
 vendor/grammars/scala.tmbundle:
@@ -466,6 +472,9 @@ vendor/grammars/sublime-idris:
 - source.idris
 vendor/grammars/sublime-mask:
 - source.mask
+vendor/grammars/sublime-netlinx:
+- source.netlinx
+- source.netlinx.erb
 vendor/grammars/sublime-nginx:
 - source.nginx
 vendor/grammars/sublime-nix:
@@ -488,9 +497,12 @@ vendor/grammars/sublime-text-ox/:
 - source.ox
 vendor/grammars/sublime-text-pig-latin/:
 - source.pig_latin
+vendor/grammars/sublime-varnish:
+- source.varnish.vcl
 vendor/grammars/sublime_cobol:
 - source.acucobol
 - source.cobol
+- source.jcl
 - source.opencobol
 vendor/grammars/sublime_man_page_support:
 - source.man
@@ -502,13 +514,6 @@ vendor/grammars/swift.tmbundle:
 vendor/grammars/tcl.tmbundle:
 - source.tcl
 - text.html.tcl
-vendor/grammars/text.tmbundle:
-- text.plain
-vendor/grammars/textile.tmbundle:
-- text.html.textile
-vendor/grammars/textmate.tmbundle:
-- source.regexp.oniguruma
-- source.tm-properties
 vendor/grammars/thrift.tmbundle:
 - source.thrift
 vendor/grammars/toml.tmbundle:
@@ -520,6 +525,8 @@ vendor/grammars/verilog.tmbundle:
 - source.verilog
 vendor/grammars/x86-assembly-textmate-bundle:
 - source.asm.x86
+vendor/grammars/xc.tmbundle/:
+- source.xc
 vendor/grammars/xml.tmbundle:
 - text.xml
 - text.xml.xsl

lib/linguist.rb

@@ -6,3 +6,15 @@ require 'linguist/repository'
 require 'linguist/samples'
 require 'linguist/shebang'
 require 'linguist/version'
+
+class << Linguist
+  attr_accessor :instrumenter
+
+  def instrument(*args, &bk)
+    if instrumenter
+      instrumenter.instrument(*args, &bk)
+    else
+      yield if block_given?
+    end
+  end
+end

lib/linguist/blob_helper.rb

@@ -99,7 +99,7 @@ module Linguist
       elsif name.nil?
         "attachment"
       else
-        "attachment; filename=#{EscapeUtils.escape_url(File.basename(name))}"
+        "attachment; filename=#{EscapeUtils.escape_url(name)}"
       end
     end
 
@@ -233,7 +233,7 @@ module Linguist
     #
     # Return true or false
     def vendored?
-      name =~ VendoredRegexp ? true : false
+      path =~ VendoredRegexp ? true : false
     end
 
     documentation_paths = YAML.load_file(File.expand_path("../documentation.yml", __FILE__))
@@ -248,7 +248,7 @@ module Linguist
     #
     # Return true or false
     def documentation?
-      name =~ DocumentationRegexp ? true : false
+      path =~ DocumentationRegexp ? true : false
     end
 
     # Public: Get each line of data
@@ -316,7 +316,7 @@ module Linguist
     #
     # Return true or false
     def generated?
-      @_generated ||= Generated.generated?(name, lambda { data })
+      @_generated ||= Generated.generated?(path, lambda { data })
     end
 
     # Public: Detects the Language of the blob.

lib/linguist/documentation.yml

@@ -7,10 +7,14 @@
 # Please add additional test coverage to
 # `test/test_blob.rb#test_documentation` if you make any changes.
 
-## Documentation Conventions ##
+## Documentation directories ##
 
 - ^docs?/
-- ^Documentation/
+- (^|/)[Dd]ocumentation/
+- (^|/)javadoc/
+- ^man/
+
+## Documentation files ##
 
 - (^|/)CONTRIBUTING(\.|$)
 - (^|/)COPYING(\.|$)

lib/linguist/file_blob.rb

@@ -3,7 +3,7 @@ require 'linguist/blob_helper'
 module Linguist
   # A FileBlob is a wrapper around a File object to make it quack
   # like a Grit::Blob. It provides the basic interface: `name`,
-  # `data`, and `size`.
+  # `data`, `path` and `size`.
   class FileBlob
     include BlobHelper
 
@@ -14,43 +14,50 @@ module Linguist
     #
     # Returns a FileBlob.
     def initialize(path, base_path = nil)
-      @path = path
-      @name = base_path ? path.sub("#{base_path}/", '') : path
+      @fullpath = path
+      @path = base_path ? path.sub("#{base_path}/", '') : path
     end
 
     # Public: Filename
     #
     # Examples
     #
-    #   FileBlob.new("/path/to/linguist/lib/linguist.rb").name
+    #   FileBlob.new("/path/to/linguist/lib/linguist.rb").path
     #   # =>  "/path/to/linguist/lib/linguist.rb"
     #
     #   FileBlob.new("/path/to/linguist/lib/linguist.rb",
-    #                "/path/to/linguist").name
+    #                "/path/to/linguist").path
     #   # =>  "lib/linguist.rb"
     #
     # Returns a String
-    attr_reader :name
+    attr_reader :path
 
     # Public: Read file permissions
     #
     # Returns a String like '100644'
     def mode
-      File.stat(@path).mode.to_s(8)
+      File.stat(@fullpath).mode.to_s(8)
+    end
+
+    # Public: File name
+    #
+    # Returns a String
+    def name
+      File.basename(@fullpath)
     end
 
     # Public: Read file contents.
     #
     # Returns a String.
     def data
-      File.read(@path)
+      File.read(@fullpath)
     end
 
     # Public: Get byte size
     #
     # Returns an Integer.
     def size
-      File.size(@path)
+      File.size(@fullpath)
     end
 
     # Public: Get file extension.
@@ -67,7 +74,7 @@ module Linguist
     #
     # Returns an Array
     def extensions
-      basename, *segments = File.basename(name).split(".")
+      basename, *segments = name.downcase.split(".")
 
       segments.map.with_index do |segment, index|
         "." + segments[index..-1].join(".")

lib/linguist/generated.rb

@@ -53,17 +53,22 @@ module Linguist
     def generated?
       xcode_file? ||
       generated_net_designer_file? ||
+      generated_net_specflow_feature_file? ||
       composer_lock? ||
       node_modules? ||
       godeps? ||
       generated_by_zephir? ||
       minified_files? ||
+      source_map? ||
       compiled_coffeescript? ||
       generated_parser? ||
       generated_net_docfile? ||
       generated_postscript? ||
+      compiled_cython_file? ||
+      generated_protocol_buffer_go? ||
       generated_protocol_buffer? ||
       generated_jni_header? ||
+      generated_unity3d_meta? ||
       vcr_cassette?
     end
 
@@ -94,6 +99,20 @@ module Linguist
       end
     end
 
+    # Internal: Is the blob a generated source map?
+    #
+    # Source Maps usually have .css.map or .js.map extensions. In case they
+    # are not following the name convention, detect them based on the content.
+    #
+    # Returns true or false.
+    def source_map?
+      return false unless extname.downcase == '.map'
+
+      name =~ /(\.css|\.js)\.map$/i ||                 # Name convention
+      lines[0] =~ /^{"version":\d+,/ ||                # Revision 2 and later begin with the version number
+      lines[0] =~ /^\/\*\* Begin line maps\. \*\*\/{/  # Revision 1 begins with a magic comment
+    end
+
     # Internal: Is the blob of JS generated by CoffeeScript?
     #
     # CoffeeScript is meant to output JS that would be difficult to
@@ -161,6 +180,17 @@ module Linguist
     def generated_net_designer_file?
       name.downcase =~ /\.designer\.cs$/
     end
+    
+    # Internal: Is this a codegen file for Specflow feature file?
+    #
+    # Visual Studio's SpecFlow extension generates *.feature.cs files
+    # from *.feature files, they are not meant to be consumed by humans. 
+    # Let's hide them.
+    #
+    # Returns true or false
+    def generated_net_specflow_feature_file?
+      name.downcase =~ /\.feature\.cs$/
+    end
 
     # Internal: Is the blob of JS a parser generated by PEG.js?
     #
@@ -202,6 +232,13 @@ module Linguist
         creator.include?("ImageMagick")
     end
 
+    def generated_protocol_buffer_go?
+      return false unless extname == '.go'
+      return false unless lines.count > 1
+
+      return lines[0].include?("Code generated by protoc-gen-go")
+    end
+
     # Internal: Is the blob a C++, Java or Python source file generated by the
     # Protocol Buffer compiler?
     #
@@ -262,5 +299,31 @@ module Linguist
       # VCR Cassettes have "recorded_with: VCR" in the second last line.
       return lines[-2].include?("recorded_with: VCR")
     end
+
+    # Internal: Is this a compiled C/C++ file from Cython?
+    #
+    # Cython-compiled C/C++ files typically contain:
+    # /* Generated by Cython x.x.x on ... */
+    # on the first line.
+    #
+    # Return true or false
+    def compiled_cython_file?
+      return false unless ['.c', '.cpp'].include? extname
+      return false unless lines.count > 1
+      return lines[0].include?("Generated by Cython")
+    end
+
+    # Internal: Is this a metadata file from Unity3D?
+    #
+    # Unity3D Meta files start with:
+    #   fileFormatVersion: X
+    #   guid: XXXXXXXXXXXXXXX
+    #
+    # Return true or false
+    def generated_unity3d_meta?
+      return false unless extname == '.meta'
+      return false unless lines.count > 1
+      return lines[0].include?("fileFormatVersion: ")
+    end
   end
 end

lib/linguist/heuristics.rb

@@ -33,7 +33,7 @@ module Linguist
     #     disambiguate "Perl", "Prolog" do |data|
     #       if data.include?("use strict")
     #         Language["Perl"]
-    #       elsif data.include?(":-")
+    #       elsif /^[^#]+:-/.match(data)
     #         Language["Prolog"]
     #       end
     #     end
@@ -94,23 +94,27 @@ module Linguist
         Language["Perl6"]
       elsif data.match(/use strict|use\s+v?5\./)
         Language["Perl"]
-      elsif data.include?(":-")
+      elsif /^[^#]+:-/.match(data)
         Language["Prolog"]
       end
     end
 
     disambiguate "ECL", "Prolog" do |data|
-      if data.include?(":-")
+      if /^[^#]+:-/.match(data)
         Language["Prolog"]
       elsif data.include?(":=")
         Language["ECL"]
       end
     end
 
-    disambiguate "IDL", "Prolog" do |data|
-      if data.include?(":-")
+    disambiguate "IDL", "Prolog", "INI", "QMake" do |data|
+      if /^[^#]+:-/.match(data)
         Language["Prolog"]
-      else
+      elsif data.include?("last_client=")
+        Language["INI"]
+      elsif data.include?("HEADERS") && data.include?("SOURCES")
+        Language["QMake"]
+      elsif /^\s*function[ \w,]+$/.match(data)
         Language["IDL"]
       end
     end
@@ -125,7 +129,7 @@ module Linguist
     end
 
     disambiguate "Common Lisp", "OpenCL", "Cool" do |data|
-      if data.include?("(defun ")
+      if /^\s*\((defun|in-package|defpackage) /i.match(data)
         Language["Common Lisp"]
       elsif /^class/x.match(data)
         Language["Cool"]
@@ -151,16 +155,16 @@ module Linguist
     end
 
     disambiguate "AsciiDoc", "AGS Script", "Public Key" do |data|
-      if /^[=-]+(\s|\n)|{{[A-Za-z]/.match(data)
+      if /^(----[- ]BEGIN|ssh-(rsa|dss)) /.match(data)
+        Language["Public Key"]
+      elsif /^[=-]+(\s|\n)|{{[A-Za-z]/.match(data)
         Language["AsciiDoc"]
       elsif /^(\/\/.+|((import|export)\s+)?(function|int|float|char)\s+((room|repeatedly|on|game)_)?([A-Za-z]+[A-Za-z_0-9]+)\s*[;\(])/.match(data)
         Language["AGS Script"]
-      elsif /^-----BEGIN/.match(data)
-        Language["Public Key"]
       end
     end
 
-    disambiguate "FORTRAN", "Forth" do |data|
+    disambiguate "FORTRAN", "Forth", "Formatted" do |data|
       if /^: /.match(data)
         Language["Forth"]
       elsif /^([c*][^a-z]|      (subroutine|program)\s|\s*!)/i.match(data)
@@ -168,27 +172,33 @@ module Linguist
       end
     end
 
-    disambiguate "F#", "Forth", "GLSL" do |data|
+    disambiguate "F#", "Forth", "GLSL", "Filterscript" do |data|
       if /^(: |new-device)/.match(data)
         Language["Forth"]
       elsif /^\s*(#light|import|let|module|namespace|open|type)/.match(data)
         Language["F#"]
-      elsif /^\s*(#include|#pragma|precision|uniform|varying|void)/.match(data)
+      elsif /^\s*(#version|precision|uniform|varying|vec[234])/.match(data)
         Language["GLSL"]
+      elsif /#include|#pragma\s+(rs|version)|__attribute__/.match(data)
+        Language["Filterscript"]
       end
     end
 
-    disambiguate "M", "Mathematica", "Matlab", "Mercury", "Objective-C" do |data|
+    disambiguate "Limbo", "M", "MUF", "Mathematica", "Matlab", "Mercury", "Objective-C" do |data|
       if ObjectiveCRegex.match(data)
         Language["Objective-C"]
       elsif data.include?(":- module")
         Language["Mercury"]
+      elsif /^: /.match(data)
+        Language["MUF"]
       elsif /^\s*;/.match(data)
         Language["M"]
       elsif /^\s*\(\*/.match(data)
         Language["Mathematica"]
       elsif /^\s*%/.match(data)
         Language["Matlab"]
+      elsif /^\w+\s*:\s*module\s*{/.match(data)
+        Language["Limbo"]
       end
     end
 
@@ -205,7 +215,7 @@ module Linguist
     end
 
     disambiguate "Common Lisp", "NewLisp" do |data|
-      if /^\s*\((defun|in-package|defpackage) /.match(data)
+      if /^\s*\((defun|in-package|defpackage) /i.match(data)
         Language["Common Lisp"]
       elsif /^\s*\(define /.match(data)
         Language["NewLisp"]
@@ -229,5 +239,55 @@ module Linguist
         Language["Text"]
       end
     end
+
+    disambiguate "PLSQL", "SQLPL", "PLpgSQL", "SQL" do |data|
+      if /^\\i\b|AS \$\$|LANGUAGE '+plpgsql'+/i.match(data) || /SECURITY (DEFINER|INVOKER)/i.match(data) || /BEGIN( WORK| TRANSACTION)?;/i.match(data)
+        #Postgres
+        Language["PLpgSQL"]
+      elsif /(alter module)|(language sql)|(begin( NOT)+ atomic)/i.match(data)  || /signal SQLSTATE '[0-9]+'/i.match(data)
+        #IBM db2
+        Language["SQLPL"]
+      elsif /pragma|\$\$PLSQL_|XMLTYPE|sysdate|systimestamp|\.nextval|connect by|AUTHID (DEFINER|CURRENT_USER)/i.match(data) || /constructor\W+function/i.match(data)
+        #Oracle
+        Language["PLSQL"]
+      elsif ! /begin|boolean|package|exception/i.match(data)
+        #Generic SQL
+        Language["SQL"]
+      end
+    end
+
+    disambiguate "D", "DTrace", "Makefile" do |data|
+      if /^module /.match(data)
+        Language["D"]
+      elsif /^((dtrace:::)?BEGIN|provider |#pragma (D (option|attributes)|ident)\s)/.match(data)
+        Language["DTrace"]
+      elsif /(\/.*:( .* \\)$| : \\$|^ : |: \\$)/.match(data)
+        Language["Makefile"]
+      end
+    end
+
+    disambiguate "OCaml", "Standard ML" do |data|
+      if /(^\s*module)|let rec |match\s+(\S+\s)+with/.match(data)
+        Language["OCaml"]
+      elsif /=> |case\s+(\S+\s)+of/.match(data)
+        Language["Standard ML"]
+      end
+    end
+
+    disambiguate "NL", "NewLisp" do |data|
+      if /^(b|g)[0-9]+ /.match(data)
+        Language["NL"]
+      else
+        Language["NewLisp"]
+      end
+    end
+
+    disambiguate "Rust", "RenderScript" do |data|
+      if data.include?("^(use |fn |mod |pub |macro_rules|impl|#!?\[)")
+        Language["Rust"]
+      elsif /#include|#pragma\s+(rs|version)|__attribute__/.match(data)
+        Language["RenderScript"]
+      end
+    end
   end
 end

lib/linguist/language.rb

@@ -73,7 +73,7 @@ module Linguist
           raise ArgumentError, "Extension is missing a '.': #{extension.inspect}"
         end
 
-        @extension_index[extension] << language
+        @extension_index[extension.downcase] << language
       end
 
       language.interpreters.each do |interpreter|
@@ -105,19 +105,31 @@ module Linguist
       # Bail early if the blob is binary or empty.
       return nil if blob.likely_binary? || blob.binary? || blob.empty?
 
-      # Call each strategy until one candidate is returned.
-      STRATEGIES.reduce([]) do |languages, strategy|
-        candidates = strategy.call(blob, languages)
-        if candidates.size == 1
-          return candidates.first
-        elsif candidates.size > 1
-          # More than one candidate was found, pass them to the next strategy.
-          candidates
-        else
-          # No candiates were found, pass on languages from the previous strategy.
-          languages
+      Linguist.instrument("linguist.detection", :blob => blob) do
+        # Call each strategy until one candidate is returned.
+        languages = []
+        returning_strategy = nil
+
+        STRATEGIES.each do |strategy|
+          returning_strategy = strategy
+          candidates = Linguist.instrument("linguist.strategy", :blob => blob, :strategy => strategy, :candidates => languages) do
+            strategy.call(blob, languages)
+          end
+          if candidates.size == 1
+            languages = candidates
+            break
+          elsif candidates.size > 1
+            # More than one candidate was found, pass them to the next strategy.
+            languages = candidates
+          else
+            # No candidates, try the next strategy
+          end
         end
-      end.first
+
+        Linguist.instrument("linguist.detected", :blob => blob, :strategy => returning_strategy, :language => languages.first)
+
+        languages.first
+      end
     end
 
     # Public: Get all Languages
@@ -191,7 +203,7 @@ module Linguist
     # Returns all matching Languages or [] if none were found.
     def self.find_by_extension(extname)
       extname = ".#{extname}" unless extname.start_with?(".")
-      @extension_index[extname]
+      @extension_index[extname.downcase]
     end
 
     # DEPRECATED
@@ -528,8 +540,8 @@ module Linguist
 
     if extnames = extensions[name]
       extnames.each do |extname|
-        if !options['extensions'].index { |x| x.end_with? extname }
-          warn "#{name} has a sample with extension (#{extname}) that isn't explicitly defined in languages.yml" unless extname == '.script!'
+        if !options['extensions'].index { |x| x.downcase.end_with? extname.downcase }
+          warn "#{name} has a sample with extension (#{extname.downcase}) that isn't explicitly defined in languages.yml"
           options['extensions'] << extname
         end
       end

lib/linguist/lazy_blob.rb

@@ -14,13 +14,15 @@ module Linguist
 
     attr_reader :repository
     attr_reader :oid
-    attr_reader :name
+    attr_reader :path
     attr_reader :mode
 
-    def initialize(repo, oid, name, mode = nil)
+    alias :name :path
+
+    def initialize(repo, oid, path, mode = nil)
       @repository = repo
       @oid = oid
-      @name = name
+      @path = path
       @mode = mode
     end
 
@@ -49,7 +51,7 @@ module Linguist
       return @language if defined?(@language)
 
       @language = if lang = git_attributes['linguist-language']
-        Language.find_by_name(lang)
+        Language.find_by_alias(lang)
       else
         super
       end

lib/linguist/popular.yml

@@ -9,21 +9,21 @@
 - CSS
 - Clojure
 - CoffeeScript
-- Common Lisp
-- Diff
-- Emacs Lisp
-- Erlang
+- Go
 - HTML
 - Haskell
 - Java
 - JavaScript
 - Lua
+- Matlab
 - Objective-C
 - PHP
 - Perl
 - Python
+- R
 - Ruby
-- SQL
 - Scala
-- Scheme
 - Shell
+- Swift
+- TeX
+- VimL

lib/linguist/samples.rb

@@ -50,16 +50,13 @@ module Linguist
             end
           else
             path = File.join(dirname, filename)
-
-            if File.extname(filename) == ""
-              raise "#{path} is missing an extension, maybe it belongs in filenames/ subdir"
-            end
+            extname = File.extname(filename)
 
             yield({
               :path     => path,
               :language => category,
               :interpreter => Shebang.interpreter(File.read(path)),
-              :extname  => File.extname(filename)
+              :extname  => extname.empty? ? nil : extname
             })
           end
         end

lib/linguist/shebang.rb

@@ -23,17 +23,20 @@ module Linguist
       # First line must start with #!
       return unless shebang && shebang.start_with?("#!")
 
-      # Get the parts of the shebang without the #!
-      tokens = shebang.sub(/^#!\s*/, '').strip.split(' ')
+      s = StringScanner.new(shebang)
 
       # There was nothing after the #!
-      return if tokens.empty?
+      return unless path = s.scan(/^#!\s*\S+/)
 
-      # Get the name of the interpreter
-      script = File.basename(tokens.first)
+      # Keep going
+      script = path.split('/').last
 
-      # Get next argument if interpreter was /usr/bin/env
-      script = tokens[1] if script == 'env'
+      # if /usr/bin/env type shebang then walk the string
+      if script == 'env'
+        s.scan(/\s+/)
+        s.scan(/.*=[^\s]+\s+/) # skip over variable arguments e.g. foo=bar
+        script = s.scan(/\S+/)
+      end
 
       # Interpreter was /usr/bin/env with no arguments
       return unless script
@@ -41,6 +44,9 @@ module Linguist
       # "python2.6" -> "python2"
       script.sub! /(\.\d+)$/, ''
 
+      # #! perl -> perl
+      script.sub! /^#!\s*/, ''
+
       # Check for multiline shebang hacks that call `exec`
       if script == 'sh' &&
         data.lines.first(5).any? { |l| l.match(/exec (\w+).+\$0.+\$@/) }

lib/linguist/strategy/filename.rb

@@ -3,17 +3,7 @@ module Linguist
     # Detects language based on filename and/or extension
     class Filename
       def self.call(blob, _)
-        name = blob.name.to_s
-
-        # A bit of an elegant hack. If the file is executable but extensionless,
-        # append a "magic" extension so it can be classified with other
-        # languages that have shebang scripts.
-        extensions = FileBlob.new(name).extensions
-        if extensions.empty? && blob.mode && (blob.mode.to_i(8) & 05) == 05
-          name += ".script!"
-        end
-
-        Language.find_by_filename(name)
+        Language.find_by_filename(blob.name.to_s)
       end
     end
   end

lib/linguist/strategy/modeline.rb

@@ -1,8 +1,8 @@
 module Linguist
   module Strategy
     class Modeline
-      EmacsModeline = /-\*-\s*mode:\s*(\w+);?\s*-\*-/i
-      VimModeline = /\/\*\s*vim:\s*set\s*(?:ft|filetype)=(\w+):\s*\*\//i
+      EmacsModeline = /-\*-\s*(?:(?!mode)[\w-]+\s*:\s*(?:[\w+-]+)\s*;?\s*)*(?:mode\s*:)?\s*([\w+-]+)\s*(?:;\s*(?!mode)[\w-]+\s*:\s*[\w+-]+\s*)*;?\s*-\*-/i
+      VimModeline = /vim:\s*set\s*(?:ft|filetype)=(\w+):/i
 
       # Public: Detects language based on Vim and Emacs modelines
       #

lib/linguist/tokenizer.rb

@@ -22,8 +22,10 @@ module Linguist
     # Start state on token, ignore anything till the next newline
     SINGLE_LINE_COMMENTS = [
       '//', # C
+      '--', # Ada, Haskell, AppleScript
       '#',  # Ruby
       '%',  # Tex
+      '"',  # Vim
     ]
 
     # Start state on opening token, ignore anything until the closing
@@ -130,6 +132,9 @@ module Linguist
     #   extract_shebang("#!/usr/bin/env node")
     #   # => "node"
     #
+    #   extract_shebang("#!/usr/bin/env A=B foo=bar awk -f")
+    #   # => "awk"
+    #
     # Returns String token or nil it couldn't be parsed.
     def extract_shebang(data)
       s = StringScanner.new(data)
@@ -138,6 +143,7 @@ module Linguist
         script = path.split('/').last
         if script == 'env'
           s.scan(/\s+/)
+          s.scan(/.*=[^\s]+\s+/)
           script = s.scan(/\S+/)
         end
         script = script[/[^\d]+/, 0] if script

lib/linguist/vendor.yml

@@ -24,6 +24,9 @@
 - (^|/)config.guess$
 - (^|/)config.sub$
 
+# Linters
+- cpplint.py
+
 # Node dependencies
 - node_modules/
 
@@ -143,6 +146,9 @@
 
 ## Python ##
 
+# Sphinx
+- (^|/)docs?/_?(build|themes?|templates?|static)/
+
 # django
 - (^|/)admin_media/
 
@@ -221,7 +227,7 @@
 - ^readme$
 
 # Test fixtures
-- ^[Tt]est/fixtures/
+- ^[Tt]ests?/fixtures/
 
 # PhoneGap/Cordova
 - (^|/)cordova([^.]*)\.js$
@@ -233,7 +239,7 @@
 # Vagrant
 - ^Vagrantfile$
 
-# .DS_Store's
+# .DS_Stores
 - .[Dd][Ss]_[Ss]tore$
 
 # R packages
@@ -251,3 +257,9 @@
 # ProGuard
 - proguard.pro
 - proguard-rules.pro
+
+# PuPHPet
+- ^puphpet/
+
+# Android Google APIs
+- (^|/)\.google_apis/

lib/linguist/version.rb

@@ -1,3 +1,3 @@
 module Linguist
-  VERSION = "4.4.1"
+  VERSION = "4.5.5"
 end

samples/AMPL/toy.ampl

@@ -0,0 +1,25 @@
+# A toy knapsack problem from the LocalSolver docs written in AMPL.
+
+set I;
+param Value{I};
+param Weight{I};
+param KnapsackBound;
+var Take{I} binary;
+
+maximize TotalValue: sum{i in I} Take[i] * Value[i];
+s.t. WeightLimit: sum{i in I} Take[i] * Weight[i] <= KnapsackBound;
+
+data;
+
+param:
+I: Weight Value :=
+0    10     1
+1    60    10
+2    30    15
+3    40    40
+4    30    60
+5    20    90
+6    20   100
+7     2    15;
+
+param KnapsackBound := 102;

samples/API Blueprint/actions.apib

@@ -0,0 +1,55 @@
+FORMAT: 1A
+
+# Advanced Action API
+A resource action is – in fact – a state transition. This API example demonstrates an action - state transition - to another resource.
+
+## API Blueprint
++ [Previous: Resource Model](11.%20Resource%20Model.md)
++ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/11.%20Advanced%20Action.md)
+
+# Tasks [/tasks/tasks{?status,priority}]
+
++ Parameters
+    + status (string)
+    + priority (number)
+
+## List All Tasks [GET]
+
++ Response 200 (application/json)
+
+        [
+            {
+                "id": 123,
+                "name": "Exercise in gym",
+                "done": false,
+                "type": "task"
+            },
+            {
+                "id": 124,
+                "name": "Shop for groceries",
+                "done": true,
+                "type": "task"
+            }
+        ]
+
+## Retrieve Task [GET /task/{id}]
+This is a state transition to another resource
+
++ Parameters
+    + id (string)
+
++ Response 200 (application/json)
+
+        {
+            "id": 123,
+            "name": "Go to gym",
+            "done": false,
+            "type": "task"
+        }
+
+## Delete Task [DELETE /task/{id}]
+
++ Parameters
+    + id (string)
+
++ Response 204

samples/API Blueprint/attributes.apib

@@ -0,0 +1,39 @@
+FORMAT: 1A
+
+# Attributes API
+This API example demonstrates how to describe body attributes of a request or response message.
+
+In this case, the description is complementary (and duplicate!) to the provided JSON example in the body section. The [Advanced Attributes](09.%20Advanced%20Attributes.md) API example will demonstrate how to avoid duplicates and how to reuse attributes descriptions.
+
+## API Blueprint
++ [Previous: Parameters](07.%20Parameters.md)
++ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/08.%20Attributes.md)
++ [Next: Advanced Attributes](09.%20Advanced%20Attributes.md)
+
+# Group Coupons
+
+## Coupon [/coupons/{id}]
+A coupon contains information about a percent-off or amount-off discount you might want to apply to a customer.
+
+### Retrieve a Coupon [GET]
+Retrieves the coupon with the given ID.
+
++ Response 200 (application/json)
+
+    + Attributes (object)
+        + id: 250FF (string)
+        + created: 1415203908 (number) - Time stamp
+        + percent_off: 25 (number)
+
+            A positive integer between 1 and 100 that represents the discount the coupon will apply.
+
+        + redeem_by (number) - Date after which the coupon can no longer be redeemed
+
+    + Body
+
+            {
+                "id": "250FF",
+                "created": 1415203908,
+                "percent_off": 25,
+                "redeem_by:" null
+            }

samples/API Blueprint/simple.apib

@@ -0,0 +1,18 @@
+FORMAT: 1A
+
+# The Simplest API
+This is one of the simplest APIs written in the **API Blueprint**.
+One plain resource combined with a method and that's it! We will explain what is going on in the next installment - [Resource and Actions](02.%20Resource%20and%20Actions.md).
+
+**Note:** As we progress through the examples, do not also forget to view the [Raw](https://raw.github.com/apiaryio/api-blueprint/master/examples/01.%20Simplest%20API.md) code to see what is really going on in the API Blueprint, as opposed to just seeing the output of the Github Markdown parser.
+
+Also please keep in mind that every single example in this course is a **real API Blueprint** and as such you can **parse** it with the [API Blueprint parser](https://github.com/apiaryio/drafter) or one of its [bindings](https://github.com/apiaryio/drafter#bindings).
+
+## API Blueprint
++ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/01.%20Simplest%20API.md)
++ [Next: Resource and Actions](02.%20Resource%20and%20Actions.md)
+
+# GET /message
++ Response 200 (text/plain)
+
+        Hello World!

samples/AsciiDoc/list.asc

@@ -1,6 +1,9 @@
 AsciiDoc Home Page
 ==================
 
+Title
+-----
+
 Example Articles
 ~~~~~~~~~~~~~~~~
 - Item 1

samples/Brainfuck/factor.b

@@ -0,0 +1,195 @@
+* factor an arbitrarily large positive integer
+*
+* Copyright (C) 1999 by Brian Raiter
+* under the GNU General Public License
+
+>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-
+
+*
+* read in the number
+*
+
+<<<<<<<<<+
+[-[>>>>>>>>>>][-]<<<<<<<<<<[[->>>>>>>>>>+<<<<<<<<<<]<<<<<<<<<<]
+  >>>>>>>>>>,----------]
+>>>>>>>>>>[------------------------------------->>>>>>>>>->]
+<[+>[>>>>>>>>>+>]<-<<<<<<<<<<]-
+
+*
+* display the number and initialize the loop variable to two
+*
+
+[>++++++++++++++++++++++++++++++++++++++++++++++++.
+  ------------------------------------------------<<<<<<<<<<<]
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.
+--------------------------.[-]
+>>>>>>>>>>>>++<<<<+
+
+*
+* the main loop
+*
+
+[ [-]>>
+
+  *
+  * make copies of the number and the loop variable
+  *
+
+  [>>>>[-]>[-]>[-]>[-]
+    >[-]>[-]
+    <<<<<<<[->>>+>+<<<<]>>>>>>>>]
+  <<<<<<<<<<[>>>>>>[-<<<<+>>>>]<<<<<<<<<<<<<<<<]>>>>>>>>>>
+  [>[->>>+>>+<<<<<]>>>>>>>>>]
+  <<<<<<<<<<[>>>>>>[-<<<<<+>>>>>]<<<<<<<<<<<<<<<<]>>>>>>>>>>
+
+  *
+  * divide the number by the loop variable
+  *
+
+  [>>>[-]>>>[-]>[-]>>>]                                  initialize
+  <<<<<<<<<<[<<<<<<<<<<]
+  >>>>>>>>>[-]>>>>>>>+<<<<<<<<[+]+
+  [ ->>                               double divisor until above dividend
+    [>>>>>>[->++<]>>>>]<<<<<<<<<<
+    [>>>>>>>>[-]>[-]
+       <<<<[->>>++<<<]<<<<<<<<<<<<<<<]>>>>>>>>>>
+    [>>>>>>>>[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<
+            [->--------->>>>>>>>>+<<<<<<<<<<[->+<]]]]]]]]]]]>>]
+    <<<<<<<<<<[>>>>>>>>>[-<+<<<+>>>>]<<<<<<<<<<<<<<<<<<<]>>>>>>>>>>
+    [>>>>>>>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>
+            [-<--------->>>>>>>>>>>+<<<<<<<<<<[-<+>]]]]]]]]]]]>>>]
+    <<<<<<<<<<
+    [>>>>[->>>+>>+<<<<<]<<<<<<<<<<<<<<]
+    >>>>>>>>>>[>>>>>>>[-<<<+>>>]>>>]<<<<<<<<<<
+    [>>>>>>>>[->-<]>
+      [<<<<<<<<<[<[-]>>>>>>>>>>[-<<<<<<<<<<+>>>>>>>>>>]<<<<<<<<<<<<<<<<<<<]
+        >>>>>>>>>>>>>>>>>>>]
+      <<<<<<<<<<<<<<<<<<<]
+    >>>>>>>>>[+[+[+[+[+[+[+[+[+[+[[-]<+>]]]]]]]]]]]<
+  ]
+  >>>>>>>>
+  [                                   subtract divisor from dividend
+    <<<<<<
+    [>>>>>>>>[-]>[-]<<<<<[->>>+>+<<<<]>>>>>>]<<<<<<<<<<
+    [>>>>>>>>[-<<<<+>>>>]<<<[->>>+>+<<<<]<<<<<<<<<<<<<<<]>>>>>>>>>>
+    [>>>>>>>>>[-<<<<+>>>>]>]<<<<<<<<<<
+    [>>>>>>>>[-<->]<<<<<<<<<<<<<<<<<<]>>>>>>>>>>
+    [>>>>>>>[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<
+            [++++++++++[+>-<]>>>>>>>>>>-<<<<<<<<<<]]]]]]]]]]]>>>]
+    >>>>>>>+
+    [                                 if difference is nonnegative then
+      [-]<<<<<<<<<<<<<<<<<            replace dividend and increment quotient
+      [>>>>[-]>>>>[-<<<<+>>>>]<<[->>+<<]<<<<<<<<<<<<<<<<]>>>>>>>>>>
+      [>>>>>>>>[->+<<<+>>]>>]<<<<<<<<<<
+      [>>>[->>>>>>+<<<<<<]<<<<<<<<<<<<<]>>>>>>>>>>
+      [>>>>>>>>>[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
+                [-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
+                [-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
+                [-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
+                [-<<<<<<+>>>>>>[-<<<<<<--------->>>>>>>>>>>>>>>>+<<<<<<<<<<
+                [-<<<<<<+>>>>>>]]]]]]]]]]]>]
+      >>>>>>>
+    ]                                 halve divisor and loop until zero
+    <<<<<<<<<<<<<<<<<[<<<<<<<<<<]>>>>>>>>>>
+    [>>>>>>>>[-]<<[->+<]<[->>>+<<<]>>>>>]<<<<<<<<<<
+    [+>>>>>>>[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
+             [-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
+             [-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
+             [-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
+             [-<<<<<<<+>>>>>>>]]]]]]]]]<<<<<<<
+             [->>>>>>>+<<<<<<<]-<<<<<<<<<<]
+    >>>>>>>
+    [-<<<<<<<<<<<+>>>>>>>>>>>]
+      >>>[>>>>>>>[-<<<<<<<<<<<+++++>>>>>>>>>>>]>>>]<<<<<<<<<<
+    [+>>>>>>>>[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
+              [-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
+              [-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
+              [-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
+              [-<<<<<<<<+>>>>>>>>]]]]]]]]]<<<<<<<<
+              [->>>>>>>>+<<<<<<<<]-<<<<<<<<<<]
+    >>>>>>>>[-<<<<<<<<<<<<<+>>>>>>>>>>>>>]>>
+    [>>>>>>>>[-<<<<<<<<<<<<<+++++>>>>>>>>>>>>>]>>]<<<<<<<<<<
+    [<<<<<<<<<<]>>>>>>>>>>
+    >>>>>>
+  ]
+  <<<<<<
+
+  *
+  * make copies of the loop variable and the quotient
+  *
+
+  [>>>[->>>>+>+<<<<<]>>>>>>>]
+  <<<<<<<<<<
+  [>>>>>>>[-<<<<+>>>>]<<<<<[->>>>>+>>+<<<<<<<]<<<<<<<<<<<<]
+  >>>>>>>>>>[>>>>>>>[-<<<<<+>>>>>]>>>]<<<<<<<<<<
+
+  *
+  * break out of the loop if the quotient is larger than the loop variable
+  *
+
+  [>>>>>>>>>[-<->]<
+    [<<<<<<<<
+      [<<[-]>>>>>>>>>>[-<<<<<<<<<<+>>>>>>>>>>]<<<<<<<<<<<<<<<<<<]
+    >>>>>>>>>>>>>>>>>>]<<<<<<<<<<<<<<<<<<]
+  >>>>>>>>[>-<[+[+[+[+[+[+[+[+[+[[-]>+<]]]]]]]]]]]>+
+
+  [ [-]
+
+    *
+    * partially increment the loop variable
+    *
+
+    <[-]+>>>>+>>>>>>>>[>>>>>>>>>>]<<<<<<<<<<
+
+    *
+    * examine the remainder for nonzero digits
+    *
+
+    [<<<<<<[<<<<[<<<<<<<<<<]>>>>+<<<<<<<<<<]<<<<]
+    >>>>>>>>>>>>>>>>>>>>[>>>>>>>>>>]<<<<<<<<<<[<<<<<<<<<<]
+    >>>>-
+
+    [ [+]
+
+      *
+      * decrement the loop variable and replace the number with the quotient
+      *
+
+      >>>>>>>>-<<[>[-]>>[-<<+>>]>>>>>>>]<<<<<<<<<<
+
+      *
+      * display the loop variable
+      *
+
+      [+>>[>>>>>>>>+>>]<<-<<<<<<<<<<]-
+      [>>++++++++++++++++++++++++++++++++++++++++++++++++.
+         ------------------------------------------------<<<<<<<<<<<<]
+      ++++++++++++++++++++++++++++++++.[-]>>>>
+
+    ]
+
+    *
+    * normalize the loop variable
+    *
+
+    >>>>>>
+    [>>[->>>>>+<<<<<[->>>>>+<<<<<
+       [->>>>>+<<<<<[->>>>>+<<<<<
+       [->>>>>+<<<<<[->>>>>+<<<<<
+       [->>>>>+<<<<<[->>>>>+<<<<<
+       [->>>>>+<<<<<[->>>>>--------->>>>>+<<<<<<<<<<
+       [->>>>>+<<<<<]]]]]]]]]]]>>>>>>>>]
+    <<<<<<<<<<[>>>>>>>[-<<<<<+>>>>>]<<<<<<<<<<<<<<<<<]
+    >>>>>>>>>
+
+  ]<
+
+]>>
+
+*
+* display the number and end
+*
+
+[>>>>>>>>>>]<<<<<<<<<<[+>[>>>>>>>>>+>]<-<<<<<<<<<<]-
+[>++++++++++++++++++++++++++++++++++++++++++++++++.<<<<<<<<<<<]
+++++++++++.

samples/Brainfuck/fib100.bf

@@ -0,0 +1,13 @@
+# Calculate and output all fibonacci numbers under 100
+
++++++++++++
+>+>>>>++++++++++++++++++++++++++++++++++++++++++++
+>++++++++++++++++++++++++++++++++<<<<<<[>[>>>>>>+>
++<<<<<<<-]>>>>>>>[<<<<<<<+>>>>>>>-]<[>++++++++++[-
+<-[>>+>+<<<-]>>>[<<<+>>>-]+<[>[-]<[-]]>[<<[>>>+<<<
+-]>>[-]]<<]>>>[>>+>+<<<-]>>>[<<<+>>>-]+<[>[-]<[-]]
+>[<<+>>[-]]<<<<<<<]>>>>>[+++++++++++++++++++++++++
++++++++++++++++++++++++.[-]]++++++++++<[->-<]>++++
+++++++++++++++++++++++++++++++++++++++++++++.[-]<<
+<<<<<<<<<<[>>>+>+<<<<-]>>>>[<<<<+>>>>-]<-[>>.>.<<<
+[-]]<<[>>+>+<<<-]>>>[<<<+>>>-]<<[<+>-]>[<+>-]<<<-]

samples/Brainfuck/hello.bf

@@ -0,0 +1,4 @@
+// More complex version of hello world
+
+>++++++++[<+++++++++>-]<.>>+>+>++>[-]+<[>[->+<<++++>]<<]>.+++++++..+++.>
+>+++++++.<<<[[-]<[-]>]<+++++++++++++++.>>.+++.------.--------.>>+.>++++.

samples/Brainfuck/helloworld.bf

@@ -0,0 +1,3 @@
+// Hello World
+
+++++++++[>++++[>++>+++>+++>+<<<<-]>+>+>->>+[<]<-]>>.>---.+++++++..+++.>>.<-.<.+++.------.--------.>>+.>++.

samples/Brainfuck/rot13.bf

@@ -0,0 +1,30 @@
+# ROT13 cipher
+
+-,+[                         Read first character and start outer character reading loop
+    -[                       Skip forward if character is 0
+        >>++++[>++++++++<-]  Set up divisor (32) for division loop
+                               (MEMORY LAYOUT: dividend copy remainder divisor quotient zero zero)
+        <+<-[                Set up dividend (x minus 1) and enter division loop
+            >+>+>-[>>>]      Increase copy and remainder / reduce divisor / Normal case: skip forward
+            <[[>+<-]>>+>]    Special case: move remainder back to divisor and increase quotient
+            <<<<<-           Decrement dividend
+        ]                    End division loop
+    ]>>>[-]+                 End skip loop; zero former divisor and reuse space for a flag
+    >--[-[<->+++[-]]]<[         Zero that flag unless quotient was 2 or 3; zero quotient; check flag
+        ++++++++++++<[       If flag then set up divisor (13) for second division loop
+                               (MEMORY LAYOUT: zero copy dividend divisor remainder quotient zero zero)
+            >-[>+>>]         Reduce divisor; Normal case: increase remainder
+            >[+[<+>-]>+>>]   Special case: increase remainder / move it back to divisor / increase quotient
+            <<<<<-           Decrease dividend
+        ]                    End division loop
+        >>[<+>-]             Add remainder back to divisor to get a useful 13
+        >[                   Skip forward if quotient was 0
+            -[               Decrement quotient and skip forward if quotient was 1
+                -<<[-]>>     Zero quotient and divisor if quotient was 2
+            ]<<[<<->>-]>>    Zero divisor and subtract 13 from copy if quotient was 1
+        ]<<[<<+>>-]          Zero divisor and add 13 to copy if quotient was 0
+    ]                        End outer skip loop (jump to here if ((character minus 1)/32) was not 2 or 3)
+    <[-]                     Clear remainder from first division if second division was skipped
+    <.[-]                    Output ROT13ed character from copy and clear it
+    <-,+                     Read next character
+]                            End character reading loop

samples/C/pqiv.h

@@ -0,0 +1,166 @@
+/**
+ * pqiv
+ *
+ * Copyright (c) 2013-2014, Phillip Berndt
+ *
+ * This program is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ * You should have received a copy of the GNU General Public License
+ * along with this program.  If not, see <http://www.gnu.org/licenses/>.
+ *
+ */
+
+// This file contains the definition of files, image types and
+// the plugin infrastructure. It should be included in file type
+// handlers.
+
+#ifndef _PQIV_H_INCLUDED
+#define _PQIV_H_INCLUDED
+
+#include <glib.h>
+#include <gtk/gtk.h>
+#include <gio/gio.h>
+#include "lib/bostree.h"
+
+#ifndef PQIV_VERSION
+#define PQIV_VERSION "2.3"
+#endif
+
+#define FILE_FLAGS_ANIMATION      (guint)(1)
+#define FILE_FLAGS_MEMORY_IMAGE   (guint)(1<<1)
+
+// The structure for images {{{
+typedef struct file_type_handler_struct_t file_type_handler_t;
+typedef struct {
+	// File type
+	const file_type_handler_t *file_type;
+
+	// Special flags
+	// FILE_FLAGS_ANIMATION        -> Animation functions are invoked
+	//                                Set by file type handlers
+	// FILE_FLAGS_MEMORY_IMAGE     -> File lives in memory
+	guint file_flags;
+
+	// The file name to display and to sort by
+	gchar *display_name;
+
+	// The URI or file name of the file
+	gchar *file_name;
+
+	// If the file is a memory image, the actual image data
+	GBytes *file_data;
+
+	// The file monitor structure is used for inotify-watching of
+	// the files
+	GFileMonitor *file_monitor;
+
+	// This flag stores whether this image is currently loaded
+	// and valid. i.e. if it is set, you can assume that
+	// private_data contains a representation of the image;
+	// if not, you can NOT assume that it does not.
+	gboolean is_loaded;
+
+	// Cached image size
+	guint width;
+	guint height;
+
+	// File-type specific data, allocated and freed by the file type handlers
+	void *private;
+} file_t;
+// }}}
+// Definition of the built-in file types {{{
+
+// If you want to implement your own file type, you'll have to implement the
+// following functions and a non-static initialization function named
+// file_type_NAME_initializer that fills a file_type_handler_t with pointers to
+// the functions. Store the file in backends/NAME.c and adjust the Makefile to
+// add the required libraries if your backend is listed in the $(BACKENDS)
+// variable.
+
+typedef enum { PARAMETER, RECURSION, INOTIFY, BROWSE_ORIGINAL_PARAMETER, FILTER_OUTPUT } load_images_state_t;
+// Allocation function: Allocate the ->private structure within a file and add the
+// image(s) to the list of available images via load_images_handle_parameter_add_file()
+// If an image is not to be loaded for any reason, the file structure should be
+// deallocated using file_free()
+// Returns a pointer to the first added image
+// Optional, you can also set the pointer to this function to NULL.
+typedef BOSNode *(*file_type_alloc_fn_t)(load_images_state_t state, file_t *file);
+
+// Deallocation, if a file is removed from the images list. Free the ->private structure.
+// Only called if ->private is non-NULL.
+typedef void (*file_type_free_fn_t)(file_t *file);
+
+// Actually load a file into memory
+typedef void (*file_type_load_fn_t)(file_t *file, GInputStream *data, GError **error_pointer);
+
+// Unload a file
+typedef void (*file_type_unload_fn_t)(file_t *file);
+
+// Animation support: Initialize memory for animations, return ms until first frame
+// Optional, you can also set the pointer to this function to NULL.
+typedef double (*file_type_animation_initialize_fn_t)(file_t *file);
+
+// Animation support: Advance to the next frame, return ms until next frame
+// Optional, you can also set the pointer to this function to NULL.
+typedef double (*file_type_animation_next_frame_fn_t)(file_t *file);
+
+// Draw the current view to a cairo context
+typedef void (*file_type_draw_fn_t)(file_t *file, cairo_t *cr);
+
+struct file_type_handler_struct_t {
+	// All files will be filtered with this filter. If it lets it pass,
+	// a handler is assigned to a file. If none do, the file is
+	// discarded if it was found during directory traversal or
+	// loaded using the first image backend if it was an explicit
+	// parameter.
+	GtkFileFilter *file_types_handled;
+
+	// Pointers to the functions defined above
+	file_type_alloc_fn_t alloc_fn;
+	file_type_free_fn_t free_fn;
+	file_type_load_fn_t load_fn;
+	file_type_unload_fn_t unload_fn;
+	file_type_animation_initialize_fn_t animation_initialize_fn;
+	file_type_animation_next_frame_fn_t animation_next_frame_fn;
+	file_type_draw_fn_t draw_fn;
+};
+
+// Initialization function: Tell pqiv about a backend
+typedef void (*file_type_initializer_fn_t)(file_type_handler_t *info);
+
+// pqiv symbols available to plugins {{{
+
+// Global cancellable that should be used for every i/o operation
+extern GCancellable *image_loader_cancellable;
+
+// Current scale level. For backends that don't support cairo natively.
+extern gdouble current_scale_level;
+
+// Load a file from disc/memory/network
+GInputStream *image_loader_stream_file(file_t *file, GError **error_pointer);
+
+// Add a file to the list of loaded files
+// Should be called at least once in a file_type_alloc_fn_t, with the state being
+// forwarded unaltered.
+BOSNode *load_images_handle_parameter_add_file(load_images_state_t state, file_t *file);
+
+// Load all data from an input stream into memory, conveinience function
+GBytes *g_input_stream_read_completely(GInputStream *input_stream, GCancellable *cancellable, GError **error_pointer);
+
+// Free a file
+void file_free(file_t *file);
+
+// }}}
+
+// File type handlers, used in the initializer and file type guessing
+extern file_type_handler_t file_type_handlers[];
+
+/* }}} */
+
+#endif

samples/Chapel/distributions.chpl

@@ -58,6 +58,34 @@ var BA: [BlockSpace] int;
 forall ba in BA do
   ba = here.id;
 
+//
+// The 'hasSingleLocalSubdomain' method on arrays will return true if the 
+// index set for a locale can be represented by a single domain.
+//
+if !BA.hasSingleLocalSubdomain() then
+  halt("For a Block distribution, the index set per locale should be \
+      represented by a single domain");
+
+//
+// If the distribution's subdomains can be represented as single subdomain,
+// we can use the 'localSubdomain' method to get the index set for the 
+// current locale.
+//
+// Below, we'll use the index set to confirm that the array elements have the 
+// correct locale id.
+//
+
+for L in Locales {
+  on L {
+    const indices = BA.localSubdomain();
+    for i in indices {
+      if BA[i] != L.id then
+        halt("Error: incorrect locale id");
+    }
+  }
+}
+
+
 //
 // Output the Block-distributed array to visually see how the elements
 // are partitioned across the locales.
@@ -104,6 +132,14 @@ writeln("Block Array Index Map");
 writeln(BA2);
 writeln();
 
+//
+// We can use the 'targetLocales' method available on an array to get the
+// locales array used as targets.
+//
+for (L, ML) in zip(BA2.targetLocales(), MyLocales) do
+  if L != ML then
+    halt("Error: BA2.targetLocales() should equal MyLocales");
+
 
 
 //
@@ -126,6 +162,18 @@ writeln("Cyclic Array Index Map");
 writeln(CA);
 writeln();
 
+//
+// The domain returned by 'localSubdomain' need not be a dense block, as is
+// the case for the Cyclic Distribution.
+//
+on Locales[0] {
+  const indices = CA.localSubdomain();
+  for i in indices {
+    if CA[i] != 0 then
+      halt("Error: Cyclic array values on Locale 0 should be zero");
+  }
+}
+
 
 //
 // Next, we'll declare a Block-Cyclic distribution.  These
@@ -134,7 +182,7 @@ writeln();
 // of indices.  Thus, the BlockCyclic distribution is parameterized
 // by a starting index (as with Cyclic) and a block size (per
 // dimension) specifying how large the chunks to be dealt out are.
-// 
+//
 const BlkCycSpace = Space dmapped BlockCyclic(startIdx=Space.low, 
                                               blocksize=(2, 3));
 var BCA: [BlkCycSpace] int;
@@ -146,6 +194,46 @@ writeln("Block-Cyclic Array Index Map");
 writeln(BCA);
 writeln();
 
+//
+// A locale's index set for a Block-Cyclic distribution cannot be represented
+// by a single subdomain.
+//
+if BCA.hasSingleLocalSubdomain() then
+  halt("A Block-Cyclic index set cannot be represented by a single subdomain");
+
+//
+// If the local index set cannot be represented by a single subdomain, 
+// we can use the 'localSubdomains' iterator to yield a number of domains
+// that represent the whole index set.
+//
+// Let's write a function that will use 'localSubdomains' to verify the 
+// correctness of the array values.
+//
+
+proc verifyID(Data: []) {
+  for L in Locales {
+    on L {
+      for indices in Data.localSubdomains() {
+        for i in indices {
+          if Data[i] != L.id then
+            halt("Error: incorrect locale id");
+        }
+      }
+    }
+  }
+}
+verifyID(BCA);
+
+//
+// The 'localSubdomains' iterator is also available on distributions that
+// can represent a locale's index set with a single domain. This allows us to
+// write more general code that will work for all distributions.
+//
+// This means that we can call the 'verifyID' function on any array, like the
+// 'BA' array from earlier.
+//
+verifyID(BA);
+
 
 //
 // The ReplicatedDist distribution is different: each of the

samples/Chapel/lulesh.chpl

@@ -292,14 +292,14 @@ proc main() {
     LagrangeLeapFrog();
 
     if debug {
-      //      deprint("[[ Forces ]]", fx, fy, fz);
+      deprintatomic("[[ Forces ]]", fx, fy, fz);
       deprint("[[ Positions ]]", x, y, z);
       deprint("[[ p, e, q ]]", p, e, q);
     }
     if showProgress then
-      writeln("time = ", format("%e", time), ", dt=", format("%e", deltatime),
-              if doTiming then ", elapsed = " + (getCurrentTime()-iterTime) 
-                          else "");
+      writef("time = %er, dt=%er, %s", time, deltatime,
+             if doTiming then ", elapsed = " + (getCurrentTime()-iterTime) +"\n"
+                         else "\n");
   }
   if (cycle == maxcycles) {
     writeln("Stopped early due to reaching maxnumsteps");
@@ -314,12 +314,10 @@ proc main() {
   if printCoords {
     var outfile = open("coords.out", iomode.cw);
     var writer = outfile.writer();
-    var fmtstr = if debug then "%1.9e" else "%1.4e";
-    for i in Nodes {
-      writer.writeln(format(fmtstr, x[i]), " ", 
-                     format(fmtstr, y[i]), " ", 
-                     format(fmtstr, z[i]));
-    }
+    var fmtstr = if debug then "%1.9re %1.9er %1.9er\n" 
+                          else "%1.4er %1.4er %1.4er\n";
+    for i in Nodes do
+      writer.writef(fmtstr, x[i], y[i], z[i]);
     writer.close();
     outfile.close();
   }
@@ -479,7 +477,7 @@ inline proc localizeNeighborNodes(eli: index(Elems),
                                   y: [] real, ref y_local: 8*real,
                                   z: [] real, ref z_local: 8*real) {
 
-  for param i in 1..nodesPerElem {
+  for i in 1..nodesPerElem {
     const noi = elemToNode[eli][i];
 
     x_local[i] = x[noi];
@@ -670,7 +668,7 @@ proc SumElemStressesToNodeForces(b_x: 8*real, b_y: 8*real, b_z: 8*real,
                                  ref fx: 8*real,
                                  ref fy: 8*real,
                                  ref fz: 8*real) {
-  for param i in 1..8 {
+  for i in 1..8 {
     fx[i] = -(stress_xx * b_x[i]);
     fy[i] = -(stress_yy * b_y[i]);
     fz[i] = -(stress_zz * b_z[i]);
@@ -725,17 +723,17 @@ inline proc CalcElemFBHourglassForce(xd: 8*real, yd: 8*real, zd: 8*real,
   var hx, hy, hz: 4*real;
 
   // reduction
-  for param i in 1..4 {
-    for param j in 1..8 {
+  for i in 1..4 {
+    for j in 1..8 {
       hx[i] += hourgam[j][i] * xd[j];
       hy[i] += hourgam[j][i] * yd[j];
       hz[i] += hourgam[j][i] * zd[j];
     }
   }
 
-  for param i in 1..8 {
+  for i in 1..8 {
     var shx, shy, shz: real;
-    for param j in 1..4 {
+    for j in 1..4 {
       shx += hourgam[i][j] * hx[j];
       shy += hourgam[i][j] * hy[j];
       shz += hourgam[i][j] * hz[j];
@@ -1088,16 +1086,16 @@ proc CalcFBHourglassForceForElems(determ, x8n, y8n, z8n, dvdx, dvdy, dvdz) {
 
     /* TODO: Can we enable this local block? */
     // local {
-      for param i in 1..4 {
+      for i in 1..4 {
         var hourmodx, hourmody, hourmodz: real;
         // reduction
-        for param j in 1..8 {
+        for j in 1..8 {
           hourmodx += x8n[eli][j] * gammaCoef[i][j];
           hourmody += y8n[eli][j] * gammaCoef[i][j];
           hourmodz += z8n[eli][j] * gammaCoef[i][j];
         }
 
-        for param j in 1..8 {
+        for j in 1..8 {
           hourgam[j][i] = gammaCoef[i][j] - volinv * 
             (dvdx[eli][j] * hourmodx +
              dvdy[eli][j] * hourmody +
@@ -1221,7 +1219,7 @@ proc CalcKinematicsForElems(dxx, dyy, dzz, const dt: real) {
       arealg[k] = CalcElemCharacteristicLength(x_local, y_local, z_local,
                                                volume);
 
-      for param i in 1..8 {
+      for i in 1..8 {
         x_local[i] -= dt2 * xd_local[i];
         y_local[i] -= dt2 * yd_local[i];
         z_local[i] -= dt2 * zd_local[i];
@@ -1669,7 +1667,7 @@ proc CalcSoundSpeedForElems(vnewc, rho0:real, enewc, pnewc, pbvc, bvc) {
 
 
 iter elemToNodes(elem) {
-  for param i in 1..nodesPerElem do
+  for i in 1..nodesPerElem do
     yield elemToNode[elem][i];
 }
                                  
@@ -1679,14 +1677,19 @@ iter elemToNodesTuple(e) {
 }
 
 
-proc deprint(title:string, x:[?D] real, y:[D]real, z:[D]real) {
+proc deprint(title:string, x:[?D] real, y:[D] real, z:[D] real) {
   writeln(title);
-  for i in D {
-    writeln(format("%3d", i), ": ", 
-            format("%3.4e", x[i]), " ", 
-            format("%3.4e", y[i]), " ", 
-            format("%3.4e", z[i]));
-  }
+  for i in D do
+    writef("%3i: %3.4er %3.4er %3.4er\n", 
+           if use3DRepresentation then idx3DTo1D(i, D.dim(1).size) else i, 
+           x[i], y[i], z[i]);
 }
 
 
+proc deprintatomic(title:string, x:[?D] atomic real, y:[] atomic real, z:[] atomic real) {
+  writeln(title);
+  for i in D do
+    writef("%3i: %3.4er %3.4er %3.4er\n", 
+           if use3DRepresentation then idx3DTo1D(i, D.dim(1).size) else i, 
+           x[i].peek(), y[i].peek(), z[i].peek());
+}

samples/Clarion/CStringClass.clw

@@ -0,0 +1,172 @@
+      Member()
+         omit('***$***',_VER_C55)
+_ABCDllMode_  EQUATE(0)
+_ABCLinkMode_ EQUATE(1)
+         ***$***
+      Include('Equates.CLW'),ONCE
+      Include('Keycodes.CLW'),ONCE
+      Include('Errors.CLW'),ONCE
+      Map
+      End ! map
+      Include('CStringClass.inc'),ONCE
+CStringClass.Construct PROCEDURE                       ! Declare Procedure
+  CODE
+  SELF.bufferSize  = DEFAULT_CS_BUFFER_SIZE
+  SELF.CS         &= New(CSTRING(SELF.bufferSize))
+CStringClass.Destruct PROCEDURE                        ! Declare Procedure
+  CODE
+  Dispose(SELF.cs)
+CStringClass.Cat PROCEDURE  (STRING pStr) !,*CSTRING,PROC ! Declare Procedure
+newLen                       LONG,AUTO
+oldCS                        &CSTRING
+  CODE
+  newLen = Len(pStr)
+  IF (newLen+SELF.strLength+2) > SELF.newStrSize
+    ! Only grow the internal string if the result of the cat will be larger than the string currently is.
+    ! The reason for the "+2" is because this is used in the string slicing outside this IF. Without this matching +2 there is potential for an out of bounds slice which would be bad!
+
+    ! Save a temporary copy of the old string so we can us it in the concatination after we have grown it!
+    oldCS &= New(CSTRING(SELF.strLength+1))
+    oldCS = SELF.CS
+    Dispose(SELF.CS)
+
+    SELF.newStrSize = newLen + SELF.strLength + 1 + SELF.bufferSize
+    SELF.CS &= New(CSTRING(SELF.newStrSize))
+    SELF.CS = oldCS
+    Dispose(oldCS)
+  END
+
+  ! Append the new string directly to the end of the old one.
+  SELF.CS[SELF.strLength+1 : SELF.strLength+newLen] = pStr
+  ! And terminate the CSTRING manually
+  SELF.CS[SELF.strLength+newLen+1] = '<0>'
+
+  ! This is the same as doing "SELF.strLength = Len(SELF.CS)" but the Len() is _really_ slow on large strings. This is much faster!
+  SELF.strLength += newLen
+
+  ! This is what it used to be:
+  ! SELF.Str(SELF.Str() & s)
+  ! It is a nice and neat solution but performance, especially on large strings was terrible!
+
+  RETURN SELF.Str()
+CStringClass.Str PROCEDURE  (STRING pStr) !,*CSTRING, PROC   ! Declare Procedure
+  CODE
+  IF Len(pStr) > SELF.newStrSize
+    ! Only Dispose/New the internal string if the new one requires it.
+    ! This might be slightly innefficient in terms of memory usage when the string gets smaller
+    ! But it is _vasty_ better for performance when the string gets added to a lot.
+    Dispose(SELF.CS)
+    SELF.newStrSize = Len(pStr) + 1 + SELF.bufferSize
+    SELF.CS &= New(CSTRING(SELF.newStrSize))
+  END
+
+  SELF.CS        = pStr
+  SELF.strLength = Len(SELF.CS)
+
+  RETURN SELF.CS
+CStringClass.Len PROCEDURE  !,LONG                     ! Declare Procedure
+  CODE
+  RETURN SELF.strLength
+CStringClass.Replace PROCEDURE  (STRING pFind, STRING pReplace) !,*CSTRING,PROC ! Declare Procedure
+! FindString , ReplaceWith
+locate                       LONG,AUTO
+lastLocate                   LONG
+  CODE
+  LOOP
+    locate = InString(Upper(pFind), Upper(SELF.Str()), 1, lastLocate+1)
+    IF ~locate
+      BREAK
+    END
+
+    ! So we dont end up having recursive replacement.
+    lastLocate = locate + Len(pReplace)-1
+
+    SELF.Str(Sub(SELF.Str(), 1, locate-1)                  & |
+             pReplace                                      & |
+             Sub(SELF.Str(), locate+Len(pFind), SELF.Len())    |
+             )
+  END
+
+  RETURN SELF.Str()
+CStringClass.Str PROCEDURE  () !,*CSTRING              ! Declare Procedure 3
+  CODE
+  RETURN SELF.CS
+!------------------------------------------------------------------------------
+CStringClass.Contains PROCEDURE  (STRING pFind, BYTE pCaseSensitive=TRUE) !,BYTE ! Declare Procedure
+! Returns a value (TRUE) indicating whether the specified String occurs within this string.
+! Second parameter defaults to a case sensitive search.
+  CODE
+  IF pCaseSensitive = TRUE
+    IF InString(pFind, SELF.Str(), 1 , 1) > 0
+      RETURN TRUE
+    END
+  ELSE
+    IF InString(Lower(pFind), SELF.Lower(), 1 , 1) > 0
+      RETURN TRUE
+    END
+  END
+
+  RETURN FALSE
+CStringClass.Lower PROCEDURE  () !,STRING              ! Declare Procedure
+! Returns a "Lowered" version of the self.cs doesnt change the self.cs
+  CODE
+  RETURN Lower(SELF.CS)
+CStringClass.SubString PROCEDURE  (LONG pPosition, LONG pLength) !,STRING,PROC ! Declare Procedure
+  CODE
+  RETURN Sub(SELF.Str(), pPosition, pLength)
+CStringClass.ToLower PROCEDURE  () !,*CSTRING,PROC     ! Declare Procedure
+! Converts this string to lowercase and returns the converted string
+
+  CODE
+  RETURN SELF.Str(SELF.Lower())
+CStringClass.ToUpper PROCEDURE  () !,*CSTRING,PROC     ! Declare Procedure
+! Converts this string to uppercase and returns the converted string
+
+  CODE
+  RETURN SELF.Str(SELF.Upper())
+CStringClass.Trim PROCEDURE  () !,*CSTRING,PROC        ! Declare Procedure
+  CODE
+  SELF.Str(Left(SELF.Str()))
+  SELF.Str(Clip(SELF.Str()))
+  RETURN SELF.Str()
+CStringClass.Upper PROCEDURE  () !,STRING              ! Declare Procedure
+  CODE
+  RETURN Upper(SELF.Str())
+CStringClass.IndexOf PROCEDURE  (STRING pLookIn, BYTE pCaseSensitive=TRUE) !,LONG ! Declare Procedure
+! Returns the index of the first parameter (pLookIn) is found within the SELF.CS
+! zero if it is not found
+  CODE
+  IF pCaseSensitive = TRUE
+    RETURN InString(SELF.Str(), pLookIn, 1 , 1)
+  ELSE
+    RETURN InString(SELF.Lower(), Lower(pLookIn), 1 , 1)
+  END
+CStringClass.FoundIn PROCEDURE  (STRING pLookIn, BYTE pCaseSensitive=TRUE) !,BYTE ! Declare Procedure
+! Returns TRUE if the first parameter (pLookIn) is found within the SELF.CS
+! FALSE if it is no
+  CODE
+  IF SELF.IndexOf(pLookIn, pCaseSensitive) > 0
+    RETURN TRUE
+  ELSE
+    RETURN FALSE
+  END
+CStringClass.SetBuffer PROCEDURE  (LONG pNewBuffer)    ! Declare Procedure
+  CODE
+  SELF.bufferSize = pNewBuffer
+CStringClass.EscapeXml PROCEDURE  (<STRING pStr>) !,STRING ! Declare Procedure
+CS CStringClass
+  CODE
+  IF Omitted(pStr)=FALSE
+    CS.Str(pStr)
+  ELSE
+    ! Make a copy so we don't alter the original
+    CS.Str(SELF.Str())
+  END
+  CS.Replace('&', '&amp;')
+  CS.Replace('<', '&lt;')
+  CS.Replace('>', '&gt;')
+  CS.Replace('"', '&quot;')
+  CS.Replace('''', '&apos;')
+
+  RETURN CS.Str()
+

samples/Clarion/ConsoleSupport.clw

@@ -0,0 +1,68 @@
+      Member()
+      Include('ConsoleSupport.inc'),ONCE
+	  Map
+        MODULE('32-bit Windows API')
+            ! General functions
+            GetLastError(),DWORD,PASCAL
+ 
+            ! Console functions
+            GetStdHandle(DWORD),HANDLE,PASCAL,PROC,RAW
+            WriteConsole(Handle,Long,Dword,long,long),bool,Raw,Pascal,name('WriteConsoleA')
+            ReadConsole(Handle,Long,Dword,long,long),bool,Raw,Pascal,name('ReadConsoleA')
+            SetConsoleTitle(Long),Bool,Raw,Pascal,name('SetConsoleTitleA')
+            GetConsoleTitle(Long,dword),Bool,Raw,Pascal,name('GetConsoleTitleA')
+            SetConsoleMode(Handle,dWord),BOOL,RAW,PASCAL
+            GetConsoleMode(Handle,Long),BOOL,RAW,PASCAL
+        End
+      End 
+      
+ConsoleSupport.Construct PROCEDURE
+
+  CODE
+
+ConsoleSupport.Destruct PROCEDURE
+
+  CODE
+
+ConsoleSupport.Init				   PROCEDURE () !,BYTE,VIRTUAL 
+  CODE
+
+    SELF.OutputHandle = GetStdHandle(STD_OUTPUT_HANDLE)
+    If SELF.OutputHandle = INVALID_HANDLE_VALUE
+        Halt(1,'Unable to get output handle (' & GetLastError() & ')')
+        RETURN INVALID_HANDLE_VALUE
+    End
+ 
+    SELF.InputHandle = GetStdHandle(STD_INPUT_HANDLE)
+    if SELF.InputHandle = INVALID_HANDLE_VALUE
+        Halt(2,'Unable to get console input handle (' & GetLastError() & ')')
+        RETURN INVALID_HANDLE_VALUE
+    End
+ 
+    If ~SetConsoleMode(SELF.InputHandle,ENABLE_PROCESSED_INPUT )
+        Halt(3,'Unable to set console mode (' & GetLastError() & ')')
+        RETURN INVALID_OTHER
+    End
+
+    RETURN FALSE
+
+ConsoleSupport.WriteLine			   PROCEDURE (STRING pText) !,BYTE,PROC,VIRTUAL 
+  CODE
+    SELF.TextBuffer = SELF.Prefix & pText & '<13,10>'
+    If WriteConsole(SELF.OutputHandle, ADDRESS(SELF.TextBuffer), LEN(SELF.TextBuffer),ADDRESS(SELF.BytesWritten), NULL) = 0
+        Halt(4,'WriteConsoleError (' & GetLastError() & ')')
+        RETURN -1
+    End
+    RETURN FALSE
+
+Consolesupport.ReadKey  			   PROCEDURE () !,STRING,PROC,VIRTUAL 
+  CODE
+  SELF.WriteLine('Press any key to continue...')
+  Clear(SELF.InBuffer)
+  Loop
+    IF ReadConsole(SELF.InputHandle,Address(SELF.InBuffer),100,Address(SELF.BytesRead),NULL) = 0 THEN
+      Halt(5,'Error on read console (' & GetLastError() & ')')
+      Break
+    End
+  Until SELF.BytesRead > 0
+  RETURN SELF.InBuffer

samples/Clarion/HelloWorld.clw

@@ -0,0 +1,10 @@
+  PROGRAM
+
+  MAP
+  END
+
+  CODE
+
+  MESSAGE('Hello World!')
+
+  RETURN

samples/Clarion/hello.clw

@@ -0,0 +1,12 @@
+  MEMBER()
+  INCLUDE('HelloClass.inc'),ONCE
+  MAP
+  END
+
+HelloClass.Construct              PROCEDURE
+  CODE
+HelloClass.Destruct               PROCEDURE() !,VIRTUAL
+  CODE
+HelloClass.SayHello               PROCEDURE
+  CODE
+  MESSAGE('Hello World!')

samples/Clojure/build.boot

@@ -0,0 +1,15 @@
+;; from: https://github.com/boot-clj/boot#configure-task-options
+
+(set-env!
+  :source-paths #{"src"}
+  :dependencies '[[me.raynes/conch "0.8.0"]])
+
+(task-options!
+  pom {:project 'my-project
+       :version "0.1.0"}
+  jar {:manifest {"Foo" "bar"}})
+
+(deftask build
+  "Build my project."
+  []
+  (comp (pom) (jar) (install)))

samples/Common Lisp/hello.lisp

@@ -0,0 +1,2 @@
+(DEFUN HELLO ()
+  (PRINT 'HELLO))

samples/D/mpq.d

@@ -0,0 +1,318 @@
+/*
+ *  mpq.d -- D programming language module for libmpq
+ *
+ *  Copyright (c) 2008 Georg Lukas <georg@op-co.de>
+ *
+ *  This program is free software; you can redistribute it and/or modify
+ *  it under the terms of the GNU General Public License as published by
+ *  the Free Software Foundation; either version 2 of the License, or
+ *  (at your option) any later version.
+ *
+ *  This program is distributed in the hope that it will be useful,
+ *  but WITHOUT ANY WARRANTY; without even the implied warranty of
+ *  MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ *  GNU General Public License for more details.
+ *
+ *  You should have received a copy of the GNU General Public License
+ *  along with this program; if not, write to the Free Software
+ *  Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ *  This module is written to support Phobos. Patches to allow binding to
+ *  Tango are welcome.
+ */
+
+module mpq;
+
+/* the following pragma does not work on DMD/Linux, generates a warning on
+ * GDC/Linux and has not been tested on Windows. Commented out for now. */
+// pragma(lib, "libmpq");
+
+import std.string; // for format() and toStringz()
+import std.traits; // for ParameterTypeTuple!()
+
+/* XXX: this assumes that libmpq is compiled with Large File Support on */
+alias long off_t;
+
+/* libmpq error return values */
+const LIBMPQ_ERROR_OPEN			= -1;	/* open error on file. */
+const LIBMPQ_ERROR_CLOSE		= -2;	/* close error on file. */
+const LIBMPQ_ERROR_SEEK			= -3;	/* lseek error on file. */
+const LIBMPQ_ERROR_READ			= -4;	/* read error on file. */
+const LIBMPQ_ERROR_WRITE		= -5;	/* write error on file. */
+const LIBMPQ_ERROR_MALLOC		= -6;	/* memory allocation error. */
+const LIBMPQ_ERROR_FORMAT		= -7;	/* format errror. */
+const LIBMPQ_ERROR_NOT_INITIALIZED	= -8;	/* init() wasn't called. */
+const LIBMPQ_ERROR_SIZE			= -9;	/* buffer size is to small. */
+const LIBMPQ_ERROR_EXIST		= -10;	/* file or block does not exist in archive. */
+const LIBMPQ_ERROR_DECRYPT		= -11;	/* we don't know the decryption seed. */
+const LIBMPQ_ERROR_UNPACK		= -12;	/* error on unpacking file. */
+
+/** libmpq internal meta-data for an archive */
+extern struct mpq_archive_s;
+
+extern(C) {
+
+/* libmpq__generic information about library. */
+char *libmpq__version();
+
+/* libmpq__generic mpq archive information. */
+int libmpq__archive_open(mpq_archive_s **mpq_archive, char *mpq_filename, off_t archive_offset);
+int libmpq__archive_close(mpq_archive_s *mpq_archive);
+int libmpq__archive_packed_size(mpq_archive_s *mpq_archive, off_t *packed_size);
+int libmpq__archive_unpacked_size(mpq_archive_s *mpq_archive, off_t *unpacked_size);
+int libmpq__archive_offset(mpq_archive_s *mpq_archive, off_t *offset);
+int libmpq__archive_version(mpq_archive_s *mpq_archive, uint *version_);
+int libmpq__archive_files(mpq_archive_s *mpq_archive, uint *files);
+
+/* libmpq__generic file processing functions. */
+int libmpq__file_packed_size(mpq_archive_s *mpq_archive, uint file_number, off_t *packed_size);
+int libmpq__file_unpacked_size(mpq_archive_s *mpq_archive, uint file_number, off_t *unpacked_size);
+int libmpq__file_offset(mpq_archive_s *mpq_archive, uint file_number, off_t *offset);
+int libmpq__file_blocks(mpq_archive_s *mpq_archive, uint file_number, uint *blocks);
+int libmpq__file_encrypted(mpq_archive_s *mpq_archive, uint file_number, uint *encrypted);
+int libmpq__file_compressed(mpq_archive_s *mpq_archive, uint file_number, uint *compressed);
+int libmpq__file_imploded(mpq_archive_s *mpq_archive, uint file_number, uint *imploded);
+int libmpq__file_number(mpq_archive_s *mpq_archive, char *filename, uint *number);
+int libmpq__file_read(mpq_archive_s *mpq_archive, uint file_number, ubyte *out_buf, off_t out_size, off_t *transferred);
+
+/* libmpq__generic block processing functions. */
+int libmpq__block_open_offset(mpq_archive_s *mpq_archive, uint file_number);
+int libmpq__block_close_offset(mpq_archive_s *mpq_archive, uint file_number);
+int libmpq__block_unpacked_size(mpq_archive_s *mpq_archive, uint file_number, uint block_number, off_t *unpacked_size);
+int libmpq__block_read(mpq_archive_s *mpq_archive, uint file_number, uint block_number, ubyte *out_buf, off_t out_size, off_t *transferred);
+
+}
+
+
+/** exception class for failed libmpq calls */
+class MPQException : Exception {
+	const string[] Errors = [
+		"unknown error",
+		"open error on file",
+		"close error on file",
+		"lseek error on file",
+		"read error on file",
+		"write error on file",
+		"memory allocation error",
+		"format errror",
+		"init() wasn't called",
+		"buffer size is to small",
+		"file or block does not exist in archive",
+		"we don't know the decryption seed",
+		"error on unpacking file"];
+
+	public int errno;
+	this(char[] fnname = "unknown_function", int errno = 0) {
+
+		this.errno = errno;
+		if (-errno >= Errors.length)
+			errno = 0;
+		super(std.string.format("Error in %s(): %s (%d)",
+					fnname, Errors[-errno], errno));
+	}
+}
+
+
+/** template to wrap function calls and throw exceptions in case of error
+ *
+ * thanks for the idea to while(nan) blog,
+ * http://while-nan.blogspot.com/2007/06/wrapping-functions-for-fun-and-profit.html
+ *
+ * use: MPQ_CHECKERR(libmpq__archive_open)(&m, "foo.mpq", -1);
+ *   returns the retval of archive_open on success;
+ *   throws an MPQException on failure.
+ *
+ * @param Fn libmpq__function reference
+ * @param args libmpq__function parameters
+ * @return return value of libmpq__function on success
+ * @throw MPQException on error
+ */
+int MPQ_CHECKERR(alias Fn)(ParameterTypeTuple!(Fn) args)
+{
+	int result = Fn(args);
+	if (result < 0) {
+		/* XXX: relying on non-specified stringof() behaviour */
+		throw new MPQException((&Fn).stringof[2..$], result);
+	}
+        return result;
+}
+
+
+/** mixin alias to wrap library functions into MPQ_CHECKERR.
+ *
+ * alias mpq.func_name(...) to MPQ_CHECKERR(libmpq__func_name)(...)
+ * @param func_name name of the function to be wrapped
+ */
+template MPQ_FUNC(char[] func_name) {
+	const char[] MPQ_FUNC = "alias MPQ_CHECKERR!(libmpq__" ~ func_name ~ ") " ~ func_name ~ ";";
+}
+
+alias libmpq__version libversion; /* must be direct alias because it returns char*, not error int */
+mixin(MPQ_FUNC!("archive_open"));
+mixin(MPQ_FUNC!("archive_close"));
+mixin(MPQ_FUNC!("archive_packed_size"));
+mixin(MPQ_FUNC!("archive_unpacked_size"));
+mixin(MPQ_FUNC!("archive_offset"));
+mixin(MPQ_FUNC!("archive_version"));
+mixin(MPQ_FUNC!("archive_files"));
+mixin(MPQ_FUNC!("file_packed_size"));
+mixin(MPQ_FUNC!("file_unpacked_size"));
+mixin(MPQ_FUNC!("file_offset"));
+mixin(MPQ_FUNC!("file_blocks"));
+mixin(MPQ_FUNC!("file_encrypted"));
+mixin(MPQ_FUNC!("file_compressed"));
+mixin(MPQ_FUNC!("file_imploded"));
+mixin(MPQ_FUNC!("file_number"));
+mixin(MPQ_FUNC!("file_read"));
+mixin(MPQ_FUNC!("block_open_offset"));
+mixin(MPQ_FUNC!("block_close_offset"));
+mixin(MPQ_FUNC!("block_unpacked_size"));
+mixin(MPQ_FUNC!("block_read"));
+
+/** getter function named name for returning archive_* single values:
+ *
+ *   <type> Archive.<name>() { return libmpq__archive_<name>() }
+ *
+ * @param type return type for the original function reference
+ * @param name name of the original function
+ * @param name2 name for the prototype (defaults to name, used for "version")
+ * @return getter function mixin
+ */
+template MPQ_A_GET(char[] type, char[] name, char[] name2 = name) {
+	const char[] MPQ_A_GET = type ~ " " ~ name2 ~ "() { " ~
+			type ~ " ret; " ~
+			"archive_" ~ name ~ "(m, &ret); return ret;" ~
+		"}";
+}
+
+/** wrapper class for an MPQ Archive
+ *
+ * syntax: auto a = new mpq.Archive("somefile.mpq");
+ */
+class Archive {
+	mpq_archive_s *m;
+	File listfile;
+	char[][] listfiledata;
+
+	this(char[] archivename, off_t offset = -1) {
+		archive_open(&m, toStringz(archivename), offset);
+	}
+
+	mixin(MPQ_A_GET!("off_t", "packed_size"));
+	mixin(MPQ_A_GET!("off_t", "unpacked_size"));
+	mixin(MPQ_A_GET!("off_t", "offset"));
+	mixin(MPQ_A_GET!("uint", "version", "version_"));
+	mixin(MPQ_A_GET!("uint", "files"));
+
+	~this() {
+		archive_close(m);
+	}
+
+	mpq_archive_s* archive() {
+		return m;
+	}
+
+	File opIndex(char[] fname) {
+		return new File(this, fname);
+	}
+	File opIndex(int fno) {
+		return new File(this, fno);
+	}
+
+	char[][] filelist() {
+		try {
+			if (!listfile) {
+				listfile = this["(listfile)"];
+				listfiledata = (cast(char[])listfile.read()).splitlines();
+			}
+			return listfiledata;
+		} catch (MPQException e) {
+			return [];
+		}
+	}
+
+	/+uint filenumber(char[] filename) {
+		try {
+			if (!listfile) {
+				listfile = this["(listfile)"];
+				listfiledata = (cast(char[])listfile.read()).splitlines();
+			}
+			return listfiledata;
+		} catch (MPQException e) {
+			return [];
+		}
+	}+/
+
+}
+
+
+/** getter function named name for returning file_* single values:
+ *
+ *   <type> File.<name>() { return libmpq__file_<name>() }
+ *
+ * @param type return type for the original function reference
+ * @param name name of the original function
+ * @param name2 name for the prototype (defaults to name, used for "version")
+ * @return getter function mixin
+ */
+template MPQ_F_GET(char[] type, char[] name, char[] name2 = name) {
+	const char[] MPQ_F_GET = type ~ " " ~ name2 ~ "() { " ~
+			type ~ " ret; " ~
+			"file_" ~ name ~ "(am, fileno, &ret); " ~
+			"return ret;" ~
+		"}";
+}
+
+/** wrapper class for a single file in an MPQ Archive
+ *
+ * syntax:
+ *    auto a = new mpq.Archive("somefile.mpq");
+ *    auto f = a["(listfile)"];
+ *    auto f2 = a[0];
+ *    auto f3 = new File(a, "(listfile)");
+ */
+class File {
+	Archive a;
+	mpq_archive_s* am;
+	char[] filename;
+	uint fileno;
+
+	this(Archive a, int fileno) {
+		this.a = a;
+		this.am = a.archive();
+		if (fileno >= a.files) {
+			throw new MPQException(format("File(%d)", fileno),
+				LIBMPQ_ERROR_EXIST);
+		}
+		this.filename = format("file%04d.xxx", fileno);
+		this.fileno = fileno;
+	}
+
+	this(Archive a, char[] filename) {
+		this.a = a;
+		this.am = a.archive();
+		this.filename = filename;
+		/* this line will throw an exception when the file is not there */
+		mpq.file_number(am, toStringz(filename), &this.fileno);
+	}
+
+	mixin(MPQ_F_GET!("off_t", "packed_size"));
+	mixin(MPQ_F_GET!("off_t", "unpacked_size"));
+	mixin(MPQ_F_GET!("off_t", "offset"));
+	mixin(MPQ_F_GET!("uint", "blocks"));
+	mixin(MPQ_F_GET!("uint", "encrypted"));
+	mixin(MPQ_F_GET!("uint", "compressed"));
+	mixin(MPQ_F_GET!("uint", "imploded"));
+
+	uint no() {	return fileno; }
+	char[] name() {	return filename; }
+
+	ubyte[] read() {
+		ubyte[] content;
+		content.length = this.unpacked_size();
+		off_t trans;
+		mpq.file_read(am, fileno, content.ptr, content.length, &trans);
+		content.length = trans;
+		return content;
+	}
+}

samples/DIGITAL Command Language/fis_gtm_kitinstal.com

@@ -0,0 +1,443 @@
+$!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
+$!								!
+$!	Copyright 2001, 2011 Fidelity Information Services, Inc	!
+$!								!
+$!	This source code contains the intellectual property	!
+$!	of its copyright holder(s), and is made available	!
+$!	under a license.  If you do not know the terms of	!
+$!	the license, please stop and do not read further.	!
+$!								!
+$!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
+$!
+$!
+$!	KITINSTAL.COM PROCEDURE FOR THE GT.M PRODUCT
+$!
+$ ON CONTROL_Y THEN VMI$CALLBACK CONTROL_Y
+$! ON WARNING THEN EXIT $STATUS !! allow warning errors for INSTALL REPLACE
+$ IF P1 .EQS. "VMI$_INSTALL" THEN GOTO INSTALL
+$ IF P1 .EQS. "VMI$_POSTINSTALL" THEN GOTO POSTINSTALL
+$ IF P1 .EQS. "VMI$_IVP" THEN GOTO IVP
+$ EXIT VMI$_UNSUPPORTED
+$!
+$INSTALL:
+$ TYPE SYS$INPUT
+
+  GT.M  (c)  COPYRIGHT 1985 - 2000  by  Sanchez Computer Associates
+                            ALL RIGHTS RESERVED
+
+$!  the following 2 lines must be maintained
+$ GTM$VMS_VERSION :== 072	! Minimum VMS version required
+$ ALPHA = (f$getsyi("arch_name") .eqs. "Alpha")
+$ IF ALPHA
+$  THEN
+$   GTM$DISK_SPACE == 28000	! Minumum disk space on system disk required
+$  ELSE
+$   GTM$DISK_SPACE == 16000	! Minumum disk space on system disk required
+$ ENDIF
+$ IF F$ELEMENT(0,",",VMI$VMS_VERSION) .EQS. "RELEASED"
+$  THEN
+$   GTM$VMS_IS == F$ELEMENT(1,",",VMI$VMS_VERSION)
+$   IF GTM$VMS_IS .LTS. GTM$VMS_VERSION
+$    THEN
+$     VMI$CALLBACK MESSAGE E VMSMISMATCH "This GT.M kit requires an existing VMS''GTM$VMS_VERSION' system."
+$     EXIT VMI$_FAILURE
+$   ENDIF
+$  ELSE
+$   GTM$VMS_IS :==
+$   WRITE SYS$OUTPUT "  No VMS version checking performed for field test versions."
+$ ENDIF
+$ IF (GTM$VMS_IS .GES. "052") THEN T1 = F$VERIFY(VMI$KIT_DEBUG)
+$ VMI$CALLBACK CHECK_NET_UTILIZATION GTM$ROOM 'GTM$DISK_SPACE'
+$ IF .NOT. GTM$ROOM
+$  THEN
+$   VMI$CALLBACK MESSAGE E NOSPACE "There is not enough disk space -- GT.M needs ''GTM$DISK_SPACE' blocks."
+$   EXIT VMI$_FAILURE
+$ ENDIF
+$!  setup default answers
+$ GTM$DOPURGE :== YES
+$ GTM$RUN_IVP :== YES
+$ GTM$STD_CNF :== YES
+$ GTM$DST_OWN :== SYSTEM
+$ IF F$IDENTIFIER(GTM$DST_OWN,"NAME_TO_NUMBER") .EQ. 0 THEN GTM$DST_OWN :== 1,4
+$ GTM$SYS_DST :== YES
+$ GTM$DST_DIR :== GTM_DIST
+$ GTM$DST_CRE == GTM$DST_DIR
+$ GTM$DST_DEV :==
+$ GTM$STARTDB :== YES
+$ GTM$MGR_COM :== YES
+$ GTM$HLP_DIR :== NO
+$ GTM$DEF_DCL :== YES
+$ GTM$DEF_SYS :== YES
+$ GTM$LNK_LOG :== YES
+$ GTM$INSTALL :== YES
+$ GTM$DEF_GLD :== YES
+$ GTM$GBL_DIR :== MUMPS.GLD
+$ GTM$DEF_RTN :== YES
+$ GTM$RTN_DIR :== [],GTM$DIST:
+$ GTM$PCT_RTN :== YES
+$ VMI$CALLBACK ASK GTM$DOPURGE "Do you want to purge files replaced by this installation" 'GTM$DOPURGE' B -
+  "@VMI$KWD:GTMKITHLP HELP_PURGE"
+$ IF .NOT. GTM$DOPURGE THEN VMI$CALLBACK SET PURGE NO
+$ VMI$CALLBACK ASK GTM$STD_CNF "Do you want the standard GT.M configuration (performs INSTALL)" 'GTM$STD_CNF' B -
+  "@VMI$KWD:GTMKITHLP HELP_STD_CNF"
+$ IF GTM$STD_CNF
+$  THEN
+$   GTM$SYS_DST == 1
+$   GTM$STARTDB == 1
+$   GTM$MGR_COM == 1
+$   GTM$HLP_DIR == 0
+$   GTM$DEF_DCL == 1
+$   GTM$DEF_SYS == 1
+$   GTM$INSTALL == 1
+$   GTM$LNK_LOG == 1
+$   GTM$INSTALL == 1
+$   GTM$DEF_GLD == 1
+$   GTM$DEF_RTN == 1
+$   GTM$PCT_RTN == 1
+$   GTM$DST_LOG :== SYS$COMMON:['GTM$DST_DIR']
+$   GTM$DIR_TYPE :== COMMON
+$  ELSE ! Not standard configuration
+$   VMI$CALLBACK ASK GTM$DST_OWN "What UIC should own the GT.M distribution" 'GTM$DST_OWN' S "@VMI$KWD:GTMKITHLP HELP_DST_OWN"
+$   GTM$DST_OWN == GTM$DST_OWN - "[" - "]"
+$   VMI$CALLBACK ASK GTM$SYS_DST "Do you want the GT.M distribution to go into a System Directory" 'GTM$SYS_DST' B -
+    "@VMI$KWD:GTMKITHLP HELP_SYS_DST"
+$   IF GTM$SYS_DST
+$    THEN
+$     VMI$CALLBACK ASK GTM$DST_DIR "In what System Directory do you want to place GT.M" 'GTM$DST_DIR' S -
+      "@VMI$KWD:GTMKITHLP HELP_SYS_DIR"
+$     GTM$DST_DIR == GTM$DST_DIR - "[" - "]"
+$     GTM$DST_CRE == GTM$DST_DIR
+$     GTM$DST_LOG :== SYS$COMMON:['GTM$DST_DIR']
+$     GTM$DIR_TYPE :== COMMON
+$    ELSE ! Not system disk
+$     VMI$CALLBACK ASK GTM$DST_DEV "On which device do you want to place GT.M" "''GTM$DST_DEV'" S "@VMI$KWD:GTMKITHLP HELP_DST_DEV"
+$     VMI$CALLBACK ASK GTM$DST_DIR "In what directory on that device do you want to place GT.M" 'GTM$DST_DIR' S -
+      "@VMI$KWD:GTMKITHLP HELP_DST_DIR"
+$     GTM$DST_DEV == GTM$DST_DEV - ":"
+$     GTM$DST_DIR == GTM$DST_DIR - "[" - "]"
+$     GTM$DST_LOG :== 'GTM$DST_DEV':['GTM$DST_DIR']
+$     GTM$DST_CRE == GTM$DST_LOG
+$     GTM$DIR_TYPE :== USER
+$   ENDIF ! system disk
+$   VMI$CALLBACK ASK GTM$STARTDB "Do you want GTMSTART.COM in the startup database" 'GTM$STARTDB' B -
+    "@VMI$KWD:GTMKITHLP HELP_STARTDB"
+$   IF .NOT. GTM$STARTDB
+$    THEN
+$     VMI$CALLBACK ASK GTM$MGR_COM "Do you want the GT.M .COM files in SYS$MANAGER" 'GTM$MGR_COM' B -
+      "@VMI$KWD:GTMKITHLP HELP_MGR_COM"
+$   ENDIF
+$   VMI$CALLBACK ASK GTM$HLP_DIR "Do you want the GT.M help files in SYS$HELP" 'GTM$HLP_DIR' B "@VMI$KWD:GTMKITHLP HELP_HLP_DIR"
+$   VMI$CALLBACK ASK GTM$DEF_DCL "Do you want to define GT.M commands to the system" 'GTM$DEF_DCL' B -
+    "@VMI$KWD:GTMKITHLP HELP_DEF_DCL"
+$   VMI$CALLBACK ASK GTM$DEF_SYS "Do you want to define GT.M logical names in the System Table" 'GTM$DEF_SYS' B -
+    "@VMI$KWD:GTMKITHLP HELP_DEF_SYS"
+$   VMI$CALLBACK ASK GTM$LNK_LOG "Do you want to define the LNK$LIBRARY logical names" 'GTM$LNK_LOG' B -
+    "@VMI$KWD:GTMKITHLP HELP_LNK_LOG"
+$   VMI$CALLBACK ASK GTM$RUN_IVP "Do you want to run the IVP (performs INSTALL)" 'GTM$RUN_IVP' B -
+    "@VMI$KWD:GTMKITHLP HELP_RUN_IVP"
+$   IF GTM$RUN_IVP
+$    THEN
+$     GTM$PCT_RTN == 1
+$    ELSE
+$     VMI$CALLBACK ASK GTM$PCT_RTN "Do you want to compile the GT.M percent routines (performs INSTALL)" 'GTM$PCT_RTN' B -
+      "@VMI$KWD:GTMKITHLP HELP_PCT_RTN"
+$   ENDIF
+$   IF (GTM$RUN_IVP .OR. GTM$PCT_RTN)
+$    THEN
+$     GTM$INSTALL == 1
+$    ELSE
+$     VMI$CALLBACK ASK GTM$INSTALL "Do you want to INSTALL the GT.M shareable images now" 'GTM$INSTALL' B -
+      "@VMI$KWD:GTMKITHLP HELP_INSTALL"
+$   ENDIF
+$   VMI$CALLBACK ASK GTM$DEF_RTN "Do you want to have a default definition for GTM$ROUTINES" 'GTM$DEF_RTN' B -
+    "@VMI$KWD:GTMKITHLP HELP_DEF_RTN"
+$   IF GTM$DEF_RTN
+$    THEN
+$     VMI$CALLBACK ASK GTM$RTN_DIR "What is the search specification for GTM$ROUTINES" 'GTM$RTN_DIR' S -
+      "@VMI$KWD:GTMKITHLP HELP_RTN_DIR"
+$   ENDIF
+$   VMI$CALLBACK ASK GTM$DEF_GLD "Do you want to have a default definition for GTM$GBLDIR" 'GTM$DEF_GLD' B -
+    "@VMI$KWD:GTMKITHLP HELP_DEF_GLD"
+$   IF GTM$DEF_GLD
+$    THEN
+$     VMI$CALLBACK ASK GTM$GBL_DIR "What is the file specification for GTM$GBLDIR" 'GTM$GBL_DIR' S -
+      "@VMI$KWD:GTMKITHLP HELP_GBL_DIR"
+$   ENDIF
+$ ENDIF ! standard configuration
+$!  tell them what's happening
+$ IF GTM$MGR_COM
+$  THEN
+$   WRITE SYS$OUTPUT "  The following command files are created and copied to SYS$MANAGER:"
+$  ELSE
+$   WRITE SYS$OUTPUT "  The following command files are created:"
+$ ENDIF
+$ TYPE SYS$INPUT
+
+        GTMINSTALL.COM
+        GTMLOGICALS.COM
+        GTMLOGIN.COM
+        GTMSTART.COM
+        GTMSTOP.COM
+
+  Each file contains its own user documentation.
+
+  All the questions have been asked.   Installation now proceeds  without your
+  manual intervention for about 10-15 minutes.
+$ IF GTM$RUN_IVP THEN WRITE SYS$OUTPUT "  Finally the Installation Verification Procedure tests the installation."
+$ WRITE SYS$OUTPUT ""
+$ VMI$CALLBACK CREATE_DIRECTORY 'GTM$DIR_TYPE' 'GTM$DST_CRE' "/OWNER_UIC=[''GTM$DST_OWN'] /PROTECTION=(WO:RE)"
+$ VMI$CALLBACK RESTORE_SAVESET B
+$ VMI$CALLBACK RESTORE_SAVESET C
+$ WRITE SYS$OUTPUT ""
+$ VMI$CALLBACK MESSAGE I CRECOM "Creating command files."
+$!  Create GTMINSTALL.COM
+$ OPEN /WRITE OUFILE VMI$KWD:GTMINSTALL.COM
+$ WRITE OUFILE "$!"
+$ WRITE OUFILE "$!	GTMINSTALL.COM installs GTMSECSHR and other GT.M images."
+$ WRITE OUFILE "$!      GTMSECSHR is a small protected image and must be installed."
+$ WRITE OUFILE "$!      GTMSHR is the run-time library and is installed for performance."
+$ WRITE OUFILE "$!      GTM$DMOD and MCOMPILE are small images frequently used in development."
+$ WRITE OUFILE "$!"
+$ WRITE OUFILE "$ INSTALL"
+$ WRITE OUFILE "REPLACE  /OPEN/SHARED/HEADER/PROTECTED	GTMSECSHR"
+$ WRITE OUFILE "REPLACE  /OPEN/SHARED/HEADER		GTMSHR"
+$ WRITE OUFILE "REPLACE  /OPEN/SHARED/HEADER		GTM$DMOD"
+$ WRITE OUFILE "REPLACE  /OPEN/SHARED/HEADER		MCOMPILE"
+$ WRITE OUFILE "$ EXIT"
+$ CLOSE OUFILE
+$!  Create GTMLOGICALS.COM
+$ GTM$HLP_LOG :== GTM$DIST
+$ IF GTM$HLP_DIR THEN GTM$HLP_LOG :== SYS$HELP
+$ OPEN /WRITE OUFILE VMI$KWD:GTMLOGICALS.COM
+$ WRITE OUFILE "$!"
+$ WRITE OUFILE "$!	GTMLOGICALS.COM defines the logical names required to use GT.M."
+$ WRITE OUFILE "$!	By default the definitions are placed in the PROCESS table."
+$ WRITE OUFILE "$!	Parameter 1, if supplied should be the name of a logical name table"
+$ WRITE OUFILE "$!	and/or the mode of definition."
+$ WRITE OUFILE "$!      Assignments in a ""permanent"" table reduce GT.M activation time."
+$ WRITE OUFILE "$!"
+$ IF GTM$LNK_LOG THEN WRITE OUFILE "$!	The LNK$LIBRARY names many require adjustment to your environment."
+$ IF GTM$DEF_GLD THEN WRITE OUFILE "$!	GTM$GBLDIR is defined to provide default access to a global directory."
+$ IF GTM$DEF_RTN THEN WRITE OUFILE "$!	GTM$ROUTINES is defined to provide access to the GT.M utilities."
+$ IF GTM$DEF_RTN THEN WRITE OUFILE "$!	You may wish to define a different structure for $ZROUTINES."
+$ WRITE OUFILE "$!"
+$ WRITE OUFILE "$ IF (P1 .NES. """") .AND. (F$EXTRACT(0,1,P1) .NES. ""/"") THEN P1 := /'P1"
+$ WRITE OUFILE "$ DEFINE 'P1' GTM$DIST		''GTM$DST_LOG'"
+$ IF GTM$DEF_GLD THEN WRITE OUFILE "$ DEFINE 'P1' GTM$GBLDIR	''GTM$GBL_DIR'"
+$ IF GTM$DEF_RTN THEN WRITE OUFILE "$ DEFINE 'P1' GTM$ROUTINES	""''GTM$RTN_DIR'"""
+$ WRITE OUFILE "$ DEFINE 'P1' GTM$HELP		''GTM$HLP_LOG'"
+$ WRITE OUFILE "$ DEFINE 'P1' GTMSHR		GTM$DIST:GTMSHR.EXE"
+$ WRITE OUFILE "$ DEFINE 'P1' GTMSECSHR		GTM$DIST:GTMSECSHR.EXE"
+$ WRITE OUFILE "$ DEFINE 'P1' GTM$DMOD		GTM$DIST:GTM$DMOD.EXE"
+$ WRITE OUFILE "$ DEFINE 'P1' MCOMPILE		GTM$DIST:MCOMPILE.EXE"
+$ IF GTM$LNK_LOG
+$  THEN
+$   N1 = 0
+$   DN = 0
+$   T1 = F$TRNLNM("LNK$LIBRARY")
+$   IF  (T1 .EQS. "") .OR. (F$LOCATE("GTMLIB",T1) .NE. F$LENGTH(T1)) .OR. (F$LOCATE("GTMSHR",T1) .NE. F$LENGTH(T1))
+$    THEN
+$     WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY	GTM$DIST:GTMLIB.OLB"
+$     DN = 1
+$    ELSE ! lnk$library is in use
+$LNK_LOOP:
+$     N1 = N1 + 1
+$     T1 = F$TRNLNM("LNK$LIBRARY_''N1'")
+$     IF  (T1 .EQS. "") .OR. (F$LOCATE("GTMLIB",T1) .NE. F$LENGTH(T1)) .OR. (F$LOCATE("GTMSHR",T1) .NE. F$LENGTH(T1))
+$      THEN
+$       WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY_''N1'	GTM$DIST:GTMLIB.OLB"
+$       DN = 1
+$     ENDIF
+$     IF  (.NOT. DN) .AND. (N1 .LT. 998)  THEN  GOTO LNK_LOOP
+$   ENDIF ! gtmlib handling
+$   IF  DN ! placed gtmlib
+$    THEN
+$     N1 = N1 + 1
+$     WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY_''N1'	GTM$DIST:GTMSHR.OLB"
+$    ELSE
+$     VMI$CALLBACK MESSAGE I NOLNKLOG "No LNK$LIBRARY logical names available"
+$   ENDIF
+$ ENDIF ! setting up LNK$LIBRARYs
+$ WRITE OUFILE "$ EXIT"
+$ CLOSE OUFILE
+$!  Create GTMLOGIN.COM
+$ OPEN /WRITE OUFILE VMI$KWD:GTMLOGIN.COM
+$ WRITE OUFILE "$!"
+$ WRITE OUFILE "$!	GTMLOGIN.COM performs process specific setup for GT.M."
+$ WRITE OUFILE "$!	It calls GTMLOGICALS.COM if the logical names are not"
+$ WRITE OUFILE "$!      in the SYSTEM table."
+$ WRITE OUFILE "$!	It defines symbols to access GT.M images."
+$ WRITE OUFILE "$!	It defines GT.M commands locally if they are not defined to the system."
+$ WRITE OUFILE "$!      When the command and logical names are not defined on a process level,"
+$ WRITE OUFILE "$!      a production user may save start-up time by not using GTMLOGIN."
+$ WRITE OUFILE "$!      CCE is infrequently used, but may be defined as a foreign command."
+$ WRITE OUFILE "$!"
+$ IF .NOT. GTM$DEF_SYS
+$  THEN
+$   WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
+$   WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
+$   WRITE OUFILE "$ @'dir'GTMLOGICALS.COM"
+$ ENDIF
+$ IF .NOT. GTM$DEF_DCL THEN WRITE OUFILE "$ SET COMMAND GTM$DIST:GTMCOMMANDS.CLD"
+$ WRITE OUFILE "$ DSE :== $GTM$DIST:DSE.EXE	! Database System Editor"
+$ WRITE OUFILE "$ GDE :== $GTM$DIST:GDE.EXE	! Global Directory Editor"
+$ WRITE OUFILE "$ GTM :== MUMPS/DIRECT		! Direct Mode MUMPS"
+$ WRITE OUFILE "$ LKE :== $GTM$DIST:LKE.EXE	! Lock Editor"
+$ WRITE OUFILE "$ MUPI*P :== $GTM$DIST:MUPIP.EXE	! MUMPS Peripheral Interchange Program"
+$ WRITE OUFILE "$ EXIT"
+$ WRITE OUFILE "$ CCE :== $GTM$DIST:CCE.EXE	! GT.CX Operator Interface Program"
+$ WRITE OUFILE "$ EXIT"
+$ CLOSE OUFILE
+$!  Create GTMSTART.COM
+$ OPEN /WRITE OUFILE VMI$KWD:GTMSTART.COM
+$ WRITE OUFILE "$!"
+$ WRITE OUFILE "$!	GTMSTART.COM should be placed in the VMS startup database."
+$ WRITE OUFILE "$!	It invokes GTMLOGICALS.COM and GTMINSTALL.COM."
+$ WRITE OUFILE "$!"
+$ WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
+$ WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
+$ IF GTM$DEF_SYS THEN WRITE OUFILE "$ IF P1 .EQS. """" .OR. (P1 .EQS. ""FULL"") THEN P1 := SYSTEM/EXEC"
+$ WRITE OUFILE "$ @'dir'GTMLOGICALS 'P1'"
+$ WRITE OUFILE "$ @'dir'GTMINSTALL"
+$ WRITE OUFILE "$ EXIT"
+$ CLOSE OUFILE
+$!  Create GTMSTOP.COM
+$ OPEN /WRITE OUFILE VMI$KWD:GTMSTOP.COM
+$ WRITE OUFILE "$!"
+$ WRITE OUFILE "$!	GTMSTOP.COM stops all the active GT.M processes and does a RUNDOWN."
+$ WRITE OUFILE "$!	Place an invocation or copy of this procedure in the site specific"
+$ WRITE OUFILE "$!	 shutdown: SYS$MANAGER:SYSHUTDWN to ensure all GT.M databases are"
+$ WRITE OUFILE "$!	 properly closed before VMS terminates.  GTMSTOP should follow"
+$ WRITE OUFILE "$!	 GTCMSTOP and precede GTCXSTOP, if they are used."
+$ WRITE OUFILE "$!	If GTMSTOP is not intended to disable subsequent use of GT.M,"
+$ WRITE OUFILE "$!	 add a comment (!) before the INSTALL REMOVE GTMSECSHR."
+$ WRITE OUFILE "$!"
+$ IF .NOT. GTM$DEF_SYS
+$  THEN
+$   WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
+$   WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
+$   WRITE OUFILE "$ @'dir'GTMLOGICALS.COM"
+$ ENDIF
+$ WRITE OUFILE "$ MUPIP := $GTM$DIST:MUPIP.EXE"
+$ WRITE OUFILE "$ STOP := $GTM$DIST:GTM$STOP"
+$ WRITE OUFILE "$ STOP 'P1'"
+$ WRITE OUFILE "$ MUPIP RUNDOWN"
+$ WRITE OUFILE "$ INSTALL REMOVE GTMSECSHR"
+$ WRITE OUFILE "$ EXIT"
+$ IF GTM$DEF_SYS THEN WRITE OUFILE "$ IF P2 .EQS. """" THEN P2 := /SYSTEM/EXEC"
+$ WRITE OUFILE "$ DEASSIGN 'P2' GTMSECSHR"
+$ CLOSE OUFILE
+$ VMI$CALLBACK MESSAGE I PREINS "Preparing files for installation."
+$!  GTMFILES.KIT must be maintained as kit contents change
+$ GTM$HLP_LOG == GTM$DST_LOG
+$ IF GTM$HLP_DIR THEN GTM$HLP_LOG :== VMI$ROOT:[SYSHLP]
+$ OPEN /WRITE OUFILE VMI$KWD:GTMFILES.KIT
+$ IF GTM$MGR_COM
+$  THEN
+$   WRITE OUFILE "GTM$ GTMINSTALL.COM VMI$ROOT:[SYSMGR] C"
+$   WRITE OUFILE "GTM$ GTMLOGICALS.COM VMI$ROOT:[SYSMGR] C"
+$   WRITE OUFILE "GTM$ GTMLOGIN.COM VMI$ROOT:[SYSMGR] C"
+$   WRITE OUFILE "GTM$ GTMSTART.COM VMI$ROOT:[SYSMGR] C"
+$   WRITE OUFILE "GTM$ GTMSTOP.COM VMI$ROOT:[SYSMGR] C"
+$ ENDIF
+$ WRITE OUFILE "GTM$ GTMINSTALL.COM ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMLOGICALS.COM ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMLOGIN.COM ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMSTART.COM ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMSTOP.COM ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ DSE.HLB ''GTM$HLP_LOG'"
+$ WRITE OUFILE "GTM$ GDE.HLB ''GTM$HLP_LOG'"
+$ WRITE OUFILE "GTM$ LKE.HLB ''GTM$HLP_LOG'"
+$ WRITE OUFILE "GTM$ MUMPS.HLB ''GTM$HLP_LOG'"
+$ WRITE OUFILE "GTM$ MUPIP.HLB ''GTM$HLP_LOG'"
+$ WRITE OUFILE "GTM$ GTMLIB.OLB ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMSHR.OLB ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMZCALL.MLB ''GTM$DST_LOG'"
+$ IF ALPHA
+$  THEN
+$   WRITE OUFILE "GTM$ GTM$DEFAULTS.M64 ''GTM$DST_LOG'"
+$  ELSE
+$   WRITE OUFILE "GTM$ GTM$DEFAULTS.MAR ''GTM$DST_LOG'"
+$ ENDIF
+$ WRITE OUFILE "GTM$ GTM$CE.H ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMCOLLECT.OPT ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMCOMMANDS.CLD ''GTM$DST_LOG' C"
+$ WRITE OUFILE "GTM$ *.M ''GTM$DST_LOG'"
+$ CLOSE OUFILE
+$!  GTMIMAGES.KIT must be maintained as kit contents change
+$ OPEN /WRITE OUFILE VMI$KWD:GTMIMAGES.KIT
+$ WRITE OUFILE "GTM$ GTMSECSHR.EXE ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTMSHR.EXE ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ DSE.EXE ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GDE.EXE ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTM$DMOD.EXE ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ LKE.EXE ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ MCOMPILE.EXE ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ MUPIP.EXE ''GTM$DST_LOG'"
+$ WRITE OUFILE "GTM$ GTM$STOP.EXE ''GTM$DST_LOG'"
+$ CLOSE OUFILE
+$!  Provide with file.KITs
+$ VMI$CALLBACK PROVIDE_FILE "" VMI$KWD:GTMFILES.KIT "" T
+$ VMI$CALLBACK PROVIDE_IMAGE "" VMI$KWD:GTMIMAGES.KIT "" T
+$ VMI$CALLBACK MESSAGE I FININS "Finalizing the installation."
+$ IF GTM$DEF_DCL THEN VMI$CALLBACK PROVIDE_DCL_COMMAND GTMCOMMANDS.CLD
+$ IF GTM$STARTDB THEN VMI$CALLBACK MODIFY_STARTUP_DB ADD GTMSTART.COM LPMAIN
+$!  GTM$INSTALL is TRUE if GTM$RUN_IVP or GTM$PCT_RTN
+$ IF GTM$INSTALL THEN VMI$CALLBACK SET POSTINSTALL YES
+$ IF GTM$RUN_IVP THEN VMI$CALLBACK SET IVP YES
+$ EXIT VMI$_SUCCESS
+$!
+$POSTINSTALL:
+$ ON CONTROL_Y THEN EXIT VMI$_FAILURE
+$! remove MUPIP from command tables for change from V2.4 to V2.5
+$ SET NOON
+$ DEFINE /USER_MODE SYS$OUTPUT NL:
+$ DEFINE /USER_MODE SYS$ERROR NL:
+$ SET COMMAND /TABLE=SYS$COMMON:[SYSLIB]DCLTABLES /OUTPUT=SYS$COMMON:[SYSLIB]DCLTABLES /DELETE=MUPIP
+$ DEFINE /USER_MODE SYS$OUTPUT NL:
+$ DEFINE /USER_MODE SYS$ERROR NL:
+$ SET COMMAND /DELETE=MUPIP
+$ SET ON
+$ IF GTM$MGR_COM
+$  THEN
+$   T1 := SYS$MANAGER:
+$  ELSE
+$   T1 = GTM$DST_LOG
+$ ENDIF
+$ @'T1'GTMSTART
+$ @'T1'GTMLOGIN
+$ ON CONTROL_Y THEN EXIT VMI$_FAILURE
+$ SET DEFAULT GTM$DIST
+$ T2 = F$ENVIRONMENT("PROTECTION")
+$ SET PROTECTION=(S=REWD,O=REWD,G=REWD,W=RE)/DEFAULT
+$ MUMPS GTM$DMOD.M
+$ IF GTM$LNK_LOG
+$  THEN
+$   T1 :=
+$  ELSE
+$   T1 :=,GTMLIB.OLB/LIB,GTMSHR.OLB/LIB
+$ ENDIF
+$ LINK GTM$DMOD.OBJ/NOTRACE'T1
+$ IF GTM$PCT_RTN
+$  THEN
+$   TYPE SYS$INPUT
+
+  Compiling the GT.M percent (%) routines.
+$   MUMPS *
+$   IF GTM$DOPURGE THEN PURGE *.*
+$   SET DEFAULT VMI$KWD
+$ ENDIF ! percent routines
+$ SET PROTECTION=('T2')/DEFAULT
+$ EXIT VMI$_SUCCESS
+$!
+$IVP:
+$!	The real Installation Verification Procedure.
+$ TYPE SYS$INPUT
+
+  GT.M  Installation Verification Procedure
+
+$!	Extract the IVP .COM file from the text library.
+$ LIBRARIAN /EXTRACT=GTM$IVP /OUTPUT=GTM$IVP.COM	GTM$IVP.TLB
+$ @GTM$IVP
+$ EXIT $STATUS
+$!

samples/DIGITAL Command Language/ghostpdl_zlib_make_vms.com

@@ -0,0 +1,867 @@
+$! make libz under VMS written by
+$! Martin P.J. Zinser
+$!
+$! In case of problems with the install you might contact me at
+$! zinser@zinser.no-ip.info(preferred) or
+$! martin.zinser@eurexchange.com (work)
+$!
+$! Make procedure history for Zlib
+$!
+$!------------------------------------------------------------------------------
+$! Version history
+$! 0.01 20060120 First version to receive a number
+$! 0.02 20061008 Adapt to new Makefile.in
+$! 0.03 20091224 Add support for large file check
+$! 0.04 20100110 Add new gzclose, gzlib, gzread, gzwrite
+$! 0.05 20100221 Exchange zlibdefs.h by zconf.h.in
+$! 0.06 20120111 Fix missing amiss_err, update zconf_h.in, fix new exmples
+$!               subdir path, update module search in makefile.in
+$! 0.07 20120115 Triggered by work done by Alexey Chupahin completly redesigned
+$!               shared image creation
+$! 0.08 20120219 Make it work on VAX again, pre-load missing symbols to shared
+$!               image
+$! 0.09 20120305 SMS.  P1 sets builder ("MMK", "MMS", " " (built-in)).
+$!               "" -> automatic, preference: MMK, MMS, built-in.
+$!
+$ on error then goto err_exit
+$!
+$ true  = 1
+$ false = 0
+$ tmpnam = "temp_" + f$getjpi("","pid")
+$ tt = tmpnam + ".txt"
+$ tc = tmpnam + ".c"
+$ th = tmpnam + ".h"
+$ define/nolog tconfig 'th'
+$ its_decc = false
+$ its_vaxc = false
+$ its_gnuc = false
+$ s_case   = False
+$!
+$! Setup variables holding "config" information
+$!
+$ Make    = "''p1'"
+$ name     = "Zlib"
+$ version  = "?.?.?"
+$ v_string = "ZLIB_VERSION"
+$ v_file   = "zlib.h"
+$ ccopt   = "/include = []"
+$ lopts   = ""
+$ dnsrl   = ""
+$ aconf_in_file = "zconf.h.in#zconf.h_in#zconf_h.in"
+$ conf_check_string = ""
+$ linkonly = false
+$ optfile  = name + ".opt"
+$ mapfile  = name + ".map"
+$ libdefs  = ""
+$ vax      = f$getsyi("HW_MODEL").lt.1024
+$ axp      = f$getsyi("HW_MODEL").ge.1024 .and. f$getsyi("HW_MODEL").lt.4096
+$ ia64     = f$getsyi("HW_MODEL").ge.4096
+$!
+$! 2012-03-05 SMS.
+$! Why is this needed?  And if it is needed, why not simply ".not. vax"?
+$!
+$!!! if axp .or. ia64 then  set proc/parse=extended
+$!
+$ whoami = f$parse(f$environment("Procedure"),,,,"NO_CONCEAL")
+$ mydef  = F$parse(whoami,,,"DEVICE")
+$ mydir  = f$parse(whoami,,,"DIRECTORY") - "]["
+$ myproc = f$parse(whoami,,,"Name") + f$parse(whoami,,,"type")
+$!
+$! Check for MMK/MMS
+$!
+$ if (Make .eqs. "")
+$ then
+$   If F$Search ("Sys$System:MMS.EXE") .nes. "" Then Make = "MMS"
+$   If F$Type (MMK) .eqs. "STRING" Then Make = "MMK"
+$ else
+$   Make = f$edit( Make, "trim")
+$ endif
+$!
+$ gosub find_version
+$!
+$  open/write topt tmp.opt
+$  open/write optf 'optfile'
+$!
+$ gosub check_opts
+$!
+$! Look for the compiler used
+$!
+$ gosub check_compiler
+$ close topt
+$ close optf
+$!
+$ if its_decc
+$ then
+$   ccopt = "/prefix=all" + ccopt
+$   if f$trnlnm("SYS") .eqs. ""
+$   then
+$     if axp
+$     then
+$       define sys sys$library:
+$     else
+$       ccopt = "/decc" + ccopt
+$       define sys decc$library_include:
+$     endif
+$   endif
+$!
+$! 2012-03-05 SMS.
+$! Why /NAMES = AS_IS?  Why not simply ".not. vax"?  And why not on VAX?
+$!
+$   if axp .or. ia64
+$   then
+$       ccopt = ccopt + "/name=as_is/opt=(inline=speed)"
+$       s_case = true
+$   endif
+$ endif
+$ if its_vaxc .or. its_gnuc
+$ then
+$    if f$trnlnm("SYS").eqs."" then define sys sys$library:
+$ endif
+$!
+$! Build a fake configure input header
+$!
+$ open/write conf_hin config.hin
+$ write conf_hin "#undef _LARGEFILE64_SOURCE"
+$ close conf_hin
+$!
+$!
+$ i = 0
+$FIND_ACONF:
+$ fname = f$element(i,"#",aconf_in_file)
+$ if fname .eqs. "#" then goto AMISS_ERR
+$ if f$search(fname) .eqs. ""
+$ then
+$   i = i + 1
+$   goto find_aconf
+$ endif
+$ open/read/err=aconf_err aconf_in 'fname'
+$ open/write aconf zconf.h
+$ACONF_LOOP:
+$ read/end_of_file=aconf_exit aconf_in line
+$ work = f$edit(line, "compress,trim")
+$ if f$extract(0,6,work) .nes. "#undef"
+$ then
+$   if f$extract(0,12,work) .nes. "#cmakedefine"
+$   then
+$       write aconf line
+$   endif
+$ else
+$   cdef = f$element(1," ",work)
+$   gosub check_config
+$ endif
+$ goto aconf_loop
+$ACONF_EXIT:
+$ write aconf ""
+$ write aconf "/* VMS specifics added by make_vms.com: */"
+$ write aconf "#define VMS 1"
+$ write aconf "#include <unistd.h>"
+$ write aconf "#include <unixio.h>"
+$ write aconf "#ifdef _LARGEFILE"
+$ write aconf "# define off64_t __off64_t"
+$ write aconf "# define fopen64 fopen"
+$ write aconf "# define fseeko64 fseeko"
+$ write aconf "# define lseek64 lseek"
+$ write aconf "# define ftello64 ftell"
+$ write aconf "#endif"
+$ write aconf "#if !defined( __VAX) && (__CRTL_VER >= 70312000)"
+$ write aconf "# define HAVE_VSNPRINTF"
+$ write aconf "#endif"
+$ close aconf_in
+$ close aconf
+$ if f$search("''th'") .nes. "" then delete 'th';*
+$! Build the thing plain or with mms
+$!
+$ write sys$output "Compiling Zlib sources ..."
+$ if make.eqs.""
+$ then
+$   if (f$search( "example.obj;*") .nes. "") then delete example.obj;*
+$   if (f$search( "minigzip.obj;*") .nes. "") then delete minigzip.obj;*
+$   CALL MAKE adler32.OBJ "CC ''CCOPT' adler32" -
+                adler32.c zlib.h zconf.h
+$   CALL MAKE compress.OBJ "CC ''CCOPT' compress" -
+                compress.c zlib.h zconf.h
+$   CALL MAKE crc32.OBJ "CC ''CCOPT' crc32" -
+                crc32.c zlib.h zconf.h
+$   CALL MAKE deflate.OBJ "CC ''CCOPT' deflate" -
+                deflate.c deflate.h zutil.h zlib.h zconf.h
+$   CALL MAKE gzclose.OBJ "CC ''CCOPT' gzclose" -
+                gzclose.c zutil.h zlib.h zconf.h
+$   CALL MAKE gzlib.OBJ "CC ''CCOPT' gzlib" -
+                gzlib.c zutil.h zlib.h zconf.h
+$   CALL MAKE gzread.OBJ "CC ''CCOPT' gzread" -
+                gzread.c zutil.h zlib.h zconf.h
+$   CALL MAKE gzwrite.OBJ "CC ''CCOPT' gzwrite" -
+                gzwrite.c zutil.h zlib.h zconf.h
+$   CALL MAKE infback.OBJ "CC ''CCOPT' infback" -
+                infback.c zutil.h inftrees.h inflate.h inffast.h inffixed.h
+$   CALL MAKE inffast.OBJ "CC ''CCOPT' inffast" -
+                inffast.c zutil.h zlib.h zconf.h inffast.h
+$   CALL MAKE inflate.OBJ "CC ''CCOPT' inflate" -
+                inflate.c zutil.h zlib.h zconf.h infblock.h
+$   CALL MAKE inftrees.OBJ "CC ''CCOPT' inftrees" -
+                inftrees.c zutil.h zlib.h zconf.h inftrees.h
+$   CALL MAKE trees.OBJ "CC ''CCOPT' trees" -
+                trees.c deflate.h zutil.h zlib.h zconf.h
+$   CALL MAKE uncompr.OBJ "CC ''CCOPT' uncompr" -
+                uncompr.c zlib.h zconf.h
+$   CALL MAKE zutil.OBJ "CC ''CCOPT' zutil" -
+                zutil.c zutil.h zlib.h zconf.h
+$   write sys$output "Building Zlib ..."
+$   CALL MAKE libz.OLB "lib/crea libz.olb *.obj" *.OBJ
+$   write sys$output "Building example..."
+$   CALL MAKE example.OBJ "CC ''CCOPT' [.test]example" -
+                [.test]example.c zlib.h zconf.h
+$   call make example.exe "LINK example,libz.olb/lib" example.obj libz.olb
+$   write sys$output "Building minigzip..."
+$   CALL MAKE minigzip.OBJ "CC ''CCOPT' [.test]minigzip" -
+              [.test]minigzip.c zlib.h zconf.h
+$   call make minigzip.exe -
+              "LINK minigzip,libz.olb/lib" -
+              minigzip.obj libz.olb
+$ else
+$   gosub crea_mms
+$   write sys$output "Make ''name' ''version' with ''Make' "
+$   'make'
+$ endif
+$!
+$! Create shareable image
+$!
+$ gosub crea_olist
+$ write sys$output "Creating libzshr.exe"
+$ call map_2_shopt 'mapfile' 'optfile'
+$ LINK_'lopts'/SHARE=libzshr.exe modules.opt/opt,'optfile'/opt
+$ write sys$output "Zlib build completed"
+$ delete/nolog tmp.opt;*
+$ exit
+$AMISS_ERR:
+$ write sys$output "No source for config.hin found."
+$ write sys$output "Tried any of ''aconf_in_file'"
+$ goto err_exit
+$CC_ERR:
+$ write sys$output "C compiler required to build ''name'"
+$ goto err_exit
+$ERR_EXIT:
+$ set message/facil/ident/sever/text
+$ close/nolog optf
+$ close/nolog topt
+$ close/nolog aconf_in
+$ close/nolog aconf
+$ close/nolog out
+$ close/nolog min
+$ close/nolog mod
+$ close/nolog h_in
+$ write sys$output "Exiting..."
+$ exit 2
+$!
+$!
+$MAKE: SUBROUTINE   !SUBROUTINE TO CHECK DEPENDENCIES
+$ V = 'F$Verify(0)
+$! P1 = What we are trying to make
+$! P2 = Command to make it
+$! P3 - P8  What it depends on
+$
+$ If F$Search(P1) .Eqs. "" Then Goto Makeit
+$ Time = F$CvTime(F$File(P1,"RDT"))
+$arg=3
+$Loop:
+$       Argument = P'arg
+$       If Argument .Eqs. "" Then Goto Exit
+$       El=0
+$Loop2:
+$       File = F$Element(El," ",Argument)
+$       If File .Eqs. " " Then Goto Endl
+$       AFile = ""
+$Loop3:
+$       OFile = AFile
+$       AFile = F$Search(File)
+$       If AFile .Eqs. "" .Or. AFile .Eqs. OFile Then Goto NextEl
+$       If F$CvTime(F$File(AFile,"RDT")) .Ges. Time Then Goto Makeit
+$       Goto Loop3
+$NextEL:
+$       El = El + 1
+$       Goto Loop2
+$EndL:
+$ arg=arg+1
+$ If arg .Le. 8 Then Goto Loop
+$ Goto Exit
+$
+$Makeit:
+$ VV=F$VERIFY(0)
+$ write sys$output P2
+$ 'P2
+$ VV='F$Verify(VV)
+$Exit:
+$ If V Then Set Verify
+$ENDSUBROUTINE
+$!------------------------------------------------------------------------------
+$!
+$! Check command line options and set symbols accordingly
+$!
+$!------------------------------------------------------------------------------
+$! Version history
+$! 0.01 20041206 First version to receive a number
+$! 0.02 20060126 Add new "HELP" target
+$ CHECK_OPTS:
+$ i = 1
+$ OPT_LOOP:
+$ if i .lt. 9
+$ then
+$   cparm = f$edit(p'i',"upcase")
+$!
+$! Check if parameter actually contains something
+$!
+$   if f$edit(cparm,"trim") .nes. ""
+$   then
+$     if cparm .eqs. "DEBUG"
+$     then
+$       ccopt = ccopt + "/noopt/deb"
+$       lopts = lopts + "/deb"
+$     endif
+$     if f$locate("CCOPT=",cparm) .lt. f$length(cparm)
+$     then
+$       start = f$locate("=",cparm) + 1
+$       len   = f$length(cparm) - start
+$       ccopt = ccopt + f$extract(start,len,cparm)
+$       if f$locate("AS_IS",f$edit(ccopt,"UPCASE")) .lt. f$length(ccopt) -
+          then s_case = true
+$     endif
+$     if cparm .eqs. "LINK" then linkonly = true
+$     if f$locate("LOPTS=",cparm) .lt. f$length(cparm)
+$     then
+$       start = f$locate("=",cparm) + 1
+$       len   = f$length(cparm) - start
+$       lopts = lopts + f$extract(start,len,cparm)
+$     endif
+$     if f$locate("CC=",cparm) .lt. f$length(cparm)
+$     then
+$       start  = f$locate("=",cparm) + 1
+$       len    = f$length(cparm) - start
+$       cc_com = f$extract(start,len,cparm)
+        if (cc_com .nes. "DECC") .and. -
+           (cc_com .nes. "VAXC") .and. -
+           (cc_com .nes. "GNUC")
+$       then
+$         write sys$output "Unsupported compiler choice ''cc_com' ignored"
+$         write sys$output "Use DECC, VAXC, or GNUC instead"
+$       else
+$         if cc_com .eqs. "DECC" then its_decc = true
+$         if cc_com .eqs. "VAXC" then its_vaxc = true
+$         if cc_com .eqs. "GNUC" then its_gnuc = true
+$       endif
+$     endif
+$     if f$locate("MAKE=",cparm) .lt. f$length(cparm)
+$     then
+$       start  = f$locate("=",cparm) + 1
+$       len    = f$length(cparm) - start
+$       mmks = f$extract(start,len,cparm)
+$       if (mmks .eqs. "MMK") .or. (mmks .eqs. "MMS")
+$       then
+$         make = mmks
+$       else
+$         write sys$output "Unsupported make choice ''mmks' ignored"
+$         write sys$output "Use MMK or MMS instead"
+$       endif
+$     endif
+$     if cparm .eqs. "HELP" then gosub bhelp
+$   endif
+$   i = i + 1
+$   goto opt_loop
+$ endif
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! Look for the compiler used
+$!
+$! Version history
+$! 0.01 20040223 First version to receive a number
+$! 0.02 20040229 Save/set value of decc$no_rooted_search_lists
+$! 0.03 20060202 Extend handling of GNU C
+$! 0.04 20090402 Compaq -> hp
+$CHECK_COMPILER:
+$ if (.not. (its_decc .or. its_vaxc .or. its_gnuc))
+$ then
+$   its_decc = (f$search("SYS$SYSTEM:DECC$COMPILER.EXE") .nes. "")
+$   its_vaxc = .not. its_decc .and. (F$Search("SYS$System:VAXC.Exe") .nes. "")
+$   its_gnuc = .not. (its_decc .or. its_vaxc) .and. (f$trnlnm("gnu_cc") .nes. "")
+$ endif
+$!
+$! Exit if no compiler available
+$!
+$ if (.not. (its_decc .or. its_vaxc .or. its_gnuc))
+$ then goto CC_ERR
+$ else
+$   if its_decc
+$   then
+$     write sys$output "CC compiler check ... hp C"
+$     if f$trnlnm("decc$no_rooted_search_lists") .nes. ""
+$     then
+$       dnrsl = f$trnlnm("decc$no_rooted_search_lists")
+$     endif
+$     define/nolog decc$no_rooted_search_lists 1
+$   else
+$     if its_vaxc then write sys$output "CC compiler check ... VAX C"
+$     if its_gnuc
+$     then
+$         write sys$output "CC compiler check ... GNU C"
+$         if f$trnlnm(topt) then write topt "gnu_cc:[000000]gcclib.olb/lib"
+$         if f$trnlnm(optf) then write optf "gnu_cc:[000000]gcclib.olb/lib"
+$         cc = "gcc"
+$     endif
+$     if f$trnlnm(topt) then write topt "sys$share:vaxcrtl.exe/share"
+$     if f$trnlnm(optf) then write optf "sys$share:vaxcrtl.exe/share"
+$   endif
+$ endif
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! If MMS/MMK are available dump out the descrip.mms if required
+$!
+$CREA_MMS:
+$ write sys$output "Creating descrip.mms..."
+$ create descrip.mms
+$ open/append out descrip.mms
+$ copy sys$input: out
+$ deck
+# descrip.mms: MMS description file for building zlib on VMS
+# written by Martin P.J. Zinser
+# <zinser@zinser.no-ip.info or martin.zinser@eurexchange.com>
+
+OBJS = adler32.obj, compress.obj, crc32.obj, gzclose.obj, gzlib.obj\
+       gzread.obj, gzwrite.obj, uncompr.obj, infback.obj\
+       deflate.obj, trees.obj, zutil.obj, inflate.obj, \
+       inftrees.obj, inffast.obj
+
+$ eod
+$ write out "CFLAGS=", ccopt
+$ write out "LOPTS=", lopts
+$ write out "all : example.exe minigzip.exe libz.olb"
+$ copy sys$input: out
+$ deck
+        @ write sys$output " Example applications available"
+
+libz.olb : libz.olb($(OBJS))
+	@ write sys$output " libz available"
+
+example.exe : example.obj libz.olb
+              link $(LOPTS) example,libz.olb/lib
+
+minigzip.exe : minigzip.obj libz.olb
+              link $(LOPTS) minigzip,libz.olb/lib
+
+clean :
+	delete *.obj;*,libz.olb;*,*.opt;*,*.exe;*
+
+
+# Other dependencies.
+adler32.obj  : adler32.c zutil.h zlib.h zconf.h
+compress.obj : compress.c zlib.h zconf.h
+crc32.obj    : crc32.c zutil.h zlib.h zconf.h
+deflate.obj  : deflate.c deflate.h zutil.h zlib.h zconf.h
+example.obj  : [.test]example.c zlib.h zconf.h
+gzclose.obj  : gzclose.c zutil.h zlib.h zconf.h
+gzlib.obj    : gzlib.c zutil.h zlib.h zconf.h
+gzread.obj   : gzread.c zutil.h zlib.h zconf.h
+gzwrite.obj  : gzwrite.c zutil.h zlib.h zconf.h
+inffast.obj  : inffast.c zutil.h zlib.h zconf.h inftrees.h inffast.h
+inflate.obj  : inflate.c zutil.h zlib.h zconf.h
+inftrees.obj : inftrees.c zutil.h zlib.h zconf.h inftrees.h
+minigzip.obj : [.test]minigzip.c zlib.h zconf.h
+trees.obj    : trees.c deflate.h zutil.h zlib.h zconf.h
+uncompr.obj  : uncompr.c zlib.h zconf.h
+zutil.obj    : zutil.c zutil.h zlib.h zconf.h
+infback.obj  : infback.c zutil.h inftrees.h inflate.h inffast.h inffixed.h
+$ eod
+$ close out
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! Read list of core library sources from makefile.in and create options
+$! needed to build shareable image
+$!
+$CREA_OLIST:
+$ open/read min makefile.in
+$ open/write mod modules.opt
+$ src_check_list = "OBJZ =#OBJG ="
+$MRLOOP:
+$ read/end=mrdone min rec
+$ i = 0
+$SRC_CHECK_LOOP:
+$ src_check = f$element(i, "#", src_check_list)
+$ i = i+1
+$ if src_check .eqs. "#" then goto mrloop
+$ if (f$extract(0,6,rec) .nes. src_check) then goto src_check_loop
+$ rec = rec - src_check
+$ gosub extra_filnam
+$ if (f$element(1,"\",rec) .eqs. "\") then goto mrloop
+$MRSLOOP:
+$ read/end=mrdone min rec
+$ gosub extra_filnam
+$ if (f$element(1,"\",rec) .nes. "\") then goto mrsloop
+$MRDONE:
+$ close min
+$ close mod
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! Take record extracted in crea_olist and split it into single filenames
+$!
+$EXTRA_FILNAM:
+$ myrec = f$edit(rec - "\", "trim,compress")
+$ i = 0
+$FELOOP:
+$ srcfil = f$element(i," ", myrec)
+$ if (srcfil .nes. " ")
+$ then
+$   write mod f$parse(srcfil,,,"NAME"), ".obj"
+$   i = i + 1
+$   goto feloop
+$ endif
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! Find current Zlib version number
+$!
+$FIND_VERSION:
+$ open/read h_in 'v_file'
+$hloop:
+$ read/end=hdone h_in rec
+$ rec = f$edit(rec,"TRIM")
+$ if (f$extract(0,1,rec) .nes. "#") then goto hloop
+$ rec = f$edit(rec - "#", "TRIM")
+$ if f$element(0," ",rec) .nes. "define" then goto hloop
+$ if f$element(1," ",rec) .eqs. v_string
+$ then
+$   version = 'f$element(2," ",rec)'
+$   goto hdone
+$ endif
+$ goto hloop
+$hdone:
+$ close h_in
+$ return
+$!------------------------------------------------------------------------------
+$!
+$CHECK_CONFIG:
+$!
+$ in_ldef = f$locate(cdef,libdefs)
+$ if (in_ldef .lt. f$length(libdefs))
+$ then
+$   write aconf "#define ''cdef' 1"
+$   libdefs = f$extract(0,in_ldef,libdefs) + -
+              f$extract(in_ldef + f$length(cdef) + 1, -
+                        f$length(libdefs) - in_ldef - f$length(cdef) - 1, -
+                        libdefs)
+$ else
+$   if (f$type('cdef') .eqs. "INTEGER")
+$   then
+$     write aconf "#define ''cdef' ", 'cdef'
+$   else
+$     if (f$type('cdef') .eqs. "STRING")
+$     then
+$       write aconf "#define ''cdef' ", """", '''cdef'', """"
+$     else
+$       gosub check_cc_def
+$     endif
+$   endif
+$ endif
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! Check if this is a define relating to the properties of the C/C++
+$! compiler
+$!
+$ CHECK_CC_DEF:
+$ if (cdef .eqs. "_LARGEFILE64_SOURCE")
+$ then
+$   copy sys$input: 'tc'
+$   deck
+#include "tconfig"
+#define _LARGEFILE
+#include <stdio.h>
+
+int main(){
+FILE *fp;
+  fp = fopen("temp.txt","r");
+  fseeko(fp,1,SEEK_SET);
+  fclose(fp);
+}
+
+$   eod
+$   test_inv = false
+$   comm_h = false
+$   gosub cc_prop_check
+$   return
+$ endif
+$ write aconf "/* ", line, " */"
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! Check for properties of C/C++ compiler
+$!
+$! Version history
+$! 0.01 20031020 First version to receive a number
+$! 0.02 20031022 Added logic for defines with value
+$! 0.03 20040309 Make sure local config file gets not deleted
+$! 0.04 20041230 Also write include for configure run
+$! 0.05 20050103 Add processing of "comment defines"
+$CC_PROP_CHECK:
+$ cc_prop = true
+$ is_need = false
+$ is_need = (f$extract(0,4,cdef) .eqs. "NEED") .or. (test_inv .eq. true)
+$ if f$search(th) .eqs. "" then create 'th'
+$ set message/nofac/noident/nosever/notext
+$ on error then continue
+$ cc 'tmpnam'
+$ if .not. ($status)  then cc_prop = false
+$ on error then continue
+$! The headers might lie about the capabilities of the RTL
+$ link 'tmpnam',tmp.opt/opt
+$ if .not. ($status)  then cc_prop = false
+$ set message/fac/ident/sever/text
+$ on error then goto err_exit
+$ delete/nolog 'tmpnam'.*;*/exclude='th'
+$ if (cc_prop .and. .not. is_need) .or. -
+     (.not. cc_prop .and. is_need)
+$ then
+$   write sys$output "Checking for ''cdef'... yes"
+$   if f$type('cdef_val'_yes) .nes. ""
+$   then
+$     if f$type('cdef_val'_yes) .eqs. "INTEGER" -
+         then call write_config f$fao("#define !AS !UL",cdef,'cdef_val'_yes)
+$     if f$type('cdef_val'_yes) .eqs. "STRING" -
+         then call write_config f$fao("#define !AS !AS",cdef,'cdef_val'_yes)
+$   else
+$     call write_config f$fao("#define !AS 1",cdef)
+$   endif
+$   if (cdef .eqs. "HAVE_FSEEKO") .or. (cdef .eqs. "_LARGE_FILES") .or. -
+       (cdef .eqs. "_LARGEFILE64_SOURCE") then -
+      call write_config f$string("#define _LARGEFILE 1")
+$ else
+$   write sys$output "Checking for ''cdef'... no"
+$   if (comm_h)
+$   then
+      call write_config f$fao("/* !AS */",line)
+$   else
+$     if f$type('cdef_val'_no) .nes. ""
+$     then
+$       if f$type('cdef_val'_no) .eqs. "INTEGER" -
+           then call write_config f$fao("#define !AS !UL",cdef,'cdef_val'_no)
+$       if f$type('cdef_val'_no) .eqs. "STRING" -
+           then call write_config f$fao("#define !AS !AS",cdef,'cdef_val'_no)
+$     else
+$       call write_config f$fao("#undef !AS",cdef)
+$     endif
+$   endif
+$ endif
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! Check for properties of C/C++ compiler with multiple result values
+$!
+$! Version history
+$! 0.01 20040127 First version
+$! 0.02 20050103 Reconcile changes from cc_prop up to version 0.05
+$CC_MPROP_CHECK:
+$ cc_prop = true
+$ i    = 1
+$ idel = 1
+$ MT_LOOP:
+$ if f$type(result_'i') .eqs. "STRING"
+$ then
+$   set message/nofac/noident/nosever/notext
+$   on error then continue
+$   cc 'tmpnam'_'i'
+$   if .not. ($status)  then cc_prop = false
+$   on error then continue
+$! The headers might lie about the capabilities of the RTL
+$   link 'tmpnam'_'i',tmp.opt/opt
+$   if .not. ($status)  then cc_prop = false
+$   set message/fac/ident/sever/text
+$   on error then goto err_exit
+$   delete/nolog 'tmpnam'_'i'.*;*
+$   if (cc_prop)
+$   then
+$     write sys$output "Checking for ''cdef'... ", mdef_'i'
+$     if f$type(mdef_'i') .eqs. "INTEGER" -
+         then call write_config f$fao("#define !AS !UL",cdef,mdef_'i')
+$     if f$type('cdef_val'_yes) .eqs. "STRING" -
+         then call write_config f$fao("#define !AS !AS",cdef,mdef_'i')
+$     goto msym_clean
+$   else
+$     i = i + 1
+$     goto mt_loop
+$   endif
+$ endif
+$ write sys$output "Checking for ''cdef'... no"
+$ call write_config f$fao("#undef !AS",cdef)
+$ MSYM_CLEAN:
+$ if (idel .le. msym_max)
+$ then
+$   delete/sym mdef_'idel'
+$   idel = idel + 1
+$   goto msym_clean
+$ endif
+$ return
+$!------------------------------------------------------------------------------
+$!
+$! Write configuration to both permanent and temporary config file
+$!
+$! Version history
+$! 0.01 20031029 First version to receive a number
+$!
+$WRITE_CONFIG: SUBROUTINE
+$  write aconf 'p1'
+$  open/append confh 'th'
+$  write confh 'p1'
+$  close confh
+$ENDSUBROUTINE
+$!------------------------------------------------------------------------------
+$!
+$! Analyze the project map file and create the symbol vector for a shareable
+$! image from it
+$!
+$! Version history
+$! 0.01 20120128 First version
+$! 0.02 20120226 Add pre-load logic
+$!
+$ MAP_2_SHOPT: Subroutine
+$!
+$ SAY := "WRITE_ SYS$OUTPUT"
+$!
+$ IF F$SEARCH("''P1'") .EQS. ""
+$ THEN
+$    SAY "MAP_2_SHOPT-E-NOSUCHFILE:  Error, inputfile ''p1' not available"
+$    goto exit_m2s
+$ ENDIF
+$ IF "''P2'" .EQS. ""
+$ THEN
+$    SAY "MAP_2_SHOPT:  Error, no output file provided"
+$    goto exit_m2s
+$ ENDIF
+$!
+$ module1 = "deflate#deflateEnd#deflateInit_#deflateParams#deflateSetDictionary"
+$ module2 = "gzclose#gzerror#gzgetc#gzgets#gzopen#gzprintf#gzputc#gzputs#gzread"
+$ module3 = "gzseek#gztell#inflate#inflateEnd#inflateInit_#inflateSetDictionary"
+$ module4 = "inflateSync#uncompress#zlibVersion#compress"
+$ open/read map 'p1
+$ if axp .or. ia64
+$ then
+$     open/write aopt a.opt
+$     open/write bopt b.opt
+$     write aopt " CASE_SENSITIVE=YES"
+$     write bopt "SYMBOL_VECTOR= (-"
+$     mod_sym_num = 1
+$ MOD_SYM_LOOP:
+$     if f$type(module'mod_sym_num') .nes. ""
+$     then
+$         mod_in = 0
+$ MOD_SYM_IN:
+$         shared_proc = f$element(mod_in, "#", module'mod_sym_num')
+$         if shared_proc .nes. "#"
+$         then
+$             write aopt f$fao(" symbol_vector=(!AS/!AS=PROCEDURE)",-
+        		       f$edit(shared_proc,"upcase"),shared_proc)
+$             write bopt f$fao("!AS=PROCEDURE,-",shared_proc)
+$             mod_in = mod_in + 1
+$             goto mod_sym_in
+$         endif
+$         mod_sym_num = mod_sym_num + 1
+$         goto mod_sym_loop
+$     endif
+$MAP_LOOP:
+$     read/end=map_end map line
+$     if (f$locate("{",line).lt. f$length(line)) .or. -
+         (f$locate("global:", line) .lt. f$length(line))
+$     then
+$         proc = true
+$         goto map_loop
+$     endif
+$     if f$locate("}",line).lt. f$length(line) then proc = false
+$     if f$locate("local:", line) .lt. f$length(line) then proc = false
+$     if proc
+$     then
+$         shared_proc = f$edit(line,"collapse")
+$         chop_semi = f$locate(";", shared_proc)
+$         if chop_semi .lt. f$length(shared_proc) then -
+              shared_proc = f$extract(0, chop_semi, shared_proc)
+$         write aopt f$fao(" symbol_vector=(!AS/!AS=PROCEDURE)",-
+        			 f$edit(shared_proc,"upcase"),shared_proc)
+$         write bopt f$fao("!AS=PROCEDURE,-",shared_proc)
+$     endif
+$     goto map_loop
+$MAP_END:
+$     close/nolog aopt
+$     close/nolog bopt
+$     open/append libopt 'p2'
+$     open/read aopt a.opt
+$     open/read bopt b.opt
+$ALOOP:
+$     read/end=aloop_end aopt line
+$     write libopt line
+$     goto aloop
+$ALOOP_END:
+$     close/nolog aopt
+$     sv = ""
+$BLOOP:
+$     read/end=bloop_end bopt svn
+$     if (svn.nes."")
+$     then
+$        if (sv.nes."") then write libopt sv
+$        sv = svn
+$     endif
+$     goto bloop
+$BLOOP_END:
+$     write libopt f$extract(0,f$length(sv)-2,sv), "-"
+$     write libopt ")"
+$     close/nolog bopt
+$     delete/nolog/noconf a.opt;*,b.opt;*
+$ else
+$     if vax
+$     then
+$     open/append libopt 'p2'
+$     mod_sym_num = 1
+$ VMOD_SYM_LOOP:
+$     if f$type(module'mod_sym_num') .nes. ""
+$     then
+$         mod_in = 0
+$ VMOD_SYM_IN:
+$         shared_proc = f$element(mod_in, "#", module'mod_sym_num')
+$         if shared_proc .nes. "#"
+$         then
+$     	      write libopt f$fao("UNIVERSAL=!AS",-
+      	  			     f$edit(shared_proc,"upcase"))
+$             mod_in = mod_in + 1
+$             goto vmod_sym_in
+$         endif
+$         mod_sym_num = mod_sym_num + 1
+$         goto vmod_sym_loop
+$     endif
+$VMAP_LOOP:
+$     	  read/end=vmap_end map line
+$     	  if (f$locate("{",line).lt. f$length(line)) .or. -
+   	      (f$locate("global:", line) .lt. f$length(line))
+$     	  then
+$     	      proc = true
+$     	      goto vmap_loop
+$     	  endif
+$     	  if f$locate("}",line).lt. f$length(line) then proc = false
+$     	  if f$locate("local:", line) .lt. f$length(line) then proc = false
+$     	  if proc
+$     	  then
+$     	      shared_proc = f$edit(line,"collapse")
+$     	      chop_semi = f$locate(";", shared_proc)
+$     	      if chop_semi .lt. f$length(shared_proc) then -
+      	  	  shared_proc = f$extract(0, chop_semi, shared_proc)
+$     	      write libopt f$fao("UNIVERSAL=!AS",-
+      	  			     f$edit(shared_proc,"upcase"))
+$     	  endif
+$     	  goto vmap_loop
+$VMAP_END:
+$     else
+$         write sys$output "Unknown Architecture (Not VAX, AXP, or IA64)"
+$         write sys$output "No options file created"
+$     endif
+$ endif
+$ EXIT_M2S:
+$ close/nolog map
+$ close/nolog libopt
+$ endsubroutine

samples/DIGITAL Command Language/libxslt_build.com

@@ -0,0 +1,342 @@
+$! BUILD_XSLT.COM
+$!
+$! Build the XSLT library
+$!
+$! Arguments:
+$!
+$!	p1	- "DEBUG" is you want to build with debug
+$!
+$! This package requires libxml to have already been installed.  You need
+$! to ensure that the logical name LIBXML is defined and points to the 
+$! directory containing libxml's .h files
+$!
+$! This procedure creates the object libraries
+$!
+$!	XML_LIBDIR:LIBXSLT.OLB
+$!	XML_LIBDIR:LIBEXSLT.OLB
+$!
+$! and the program
+$!
+$!	XSLTPROC
+$!
+$! After the library is built, you can link these routines into
+$! your code with the command  
+$!
+$! 	LINK your_modules,XML_LIBDIR:LIBEXSLT/LIB,LIBXSLT/LIBRARY,LIBXML/LIB
+$!
+$! Change History
+$! --------------
+$! Command file author : John A Fotheringham (jaf@jafsoft.com)
+$! Last update         : 2 Nov 2001
+$! 
+$!- configuration -------------------------------------------------------------
+$!
+$!- compile command.
+$!
+$   cc_opts = "/INCLUDE=([],XML_SRCDIR:,[-.libxslt])/NAMES=(SHORTENED)/FLOAT=IEEE/IEEE_MODE=DENORM_RESULTS"
+$!
+$   if p1.eqs."DEBUG"
+$   then
+$     debug = "Y"
+$     cc_command = "CC''cc_opts'/DEBUG/NOOPTIMIZE/LIST/SHOW=ALL"
+$   else
+$     debug = "N"
+$     cc_command = "CC''cc_opts'"
+$   endif
+$!
+$!- configure multiple build passes for each library. -------------------------
+$!
+$!  For each pass:
+$!
+$!  "libname" is the name of the library or module being created
+$!
+$!  "progname" is the name of the program being created
+$!
+$!  "src" is the list of sources to be built into the library  or program
+$!	- This should be compared to the definition of 
+$!	  "<NAME>_la_SOURCES" in the MAKEFILE.IN file in 
+$!	  corresponding directory.
+$!
+$   num_passes = 3	! two libraries and a program
+$!
+$!- pass 1 - library LIBXSLT
+$!
+$   libname_1  = "LIBXSLT"
+$   h_file_1   = "xslt.h"
+$   progname_1 = ""
+$!
+$   ! see "libxslt_la_SOURCES" in [.libxslt]makefile.in
+$   src_1 = "xslt.c xsltutils.c pattern.c templates.c variables.c keys.c"
+$   src_1 = src_1 + " numbers.c extensions.c extra.c functions.c"
+$   src_1 = src_1 + " namespaces.c imports.c attributes.c documents.c"
+$   src_1 = src_1 + " preproc.c transform.c security.c"
+$!
+$!- pass 2 - library LIBEXSLT
+$!
+$   libname_2  = "LIBEXSLT"
+$   h_file_2   = "exslt.h"
+$   progname_2 = ""
+$!
+$   ! see "libexslt_la_SOURCES" in [.libexslt]makefile.in
+$   src_2   = "exslt.c common.c math.c sets.c functions.c strings.c date.c saxon.c dynamic.c"
+$!
+$!- pass 3 - program XSLTPROC
+$!
+$   libname_3  = ""
+$   h_file_3   = ""
+$   progname_3 = "XSLTPROC"
+$!
+$   ! see "xsltproc_SOURCES" in [.xsltproc]makefile.in
+$   src_3   = "xsltproc.c"
+$!
+$!- set up and check logicals  -----------------------------------------------
+$!
+$!  XML_LIBDIR - object library directory
+$!  XML_SRCDIR - top-level build directory of libxml package -- needed for config.h and trio.h
+$!  LIBXML - source directory containing .h files for libxml package
+$!
+$   if f$trnlnm("XML_LIBDIR").eqs.""
+$   then
+$     on error then continue
+$     globfile = f$search("[--...]libxml.olb")
+$     if globfile.eqs.""
+$     then
+$       write sys$output ""
+$       write sys$output "	You need to define the XML_LIBDIR logical name to"
+$       write sys$output "	point to the directory containing your object"
+$       write sys$output "	libraries.  This should already contain LIBXML.OLB"
+$       write sys$output "	from the libxml package, and will be the directory"
+$       write sys$output "	the new LIBXSLT.OLB library will be placed in"
+$       write sys$output ""
+$       exit
+$     else
+$	srcdir = f$parse(globfile,,,"DEVICE") + f$parse(globfile,,,"DIRECTORY")
+$	define/process XML_LIBDIR "''srcdir'"
+$       write sys$output "Defining XML_LIBDIR as ""''srcdir'"""
+$     endif
+$   endif
+$!
+$   if f$trnlnm("libxml").eqs.""
+$   then
+$     ! look for globals.h in a directory installed paralle to this one
+$     on error then continue
+$     globfile = f$search("[--...]globals.h")
+$     if globfile.eqs.""
+$     then
+$       write sys$output ""
+$       write sys$output "	You need to define a LIBXML logical directory to"
+$       write sys$output "	point to the directory containing the .h files"
+$       write sys$output "	for the libxml package"
+$       write sys$output ""
+$       exit
+$     else
+$	srcdir = f$element(0,"]",globfile)+ "]"
+$	define/process LIBXML "''srcdir'"
+$       write sys$output "Defining LIBXML as ""''srcdir'"""
+$     endif
+$   endif
+$!
+$   if f$trnlnm("XML_SRCDIR").eqs.""
+$   then
+$     globfile = f$search("[--...]globals.c")
+$     if globfile.eqs.""
+$     then
+$	write sys$output "Can't locate globals.c.  You need to manually define a XML_SRCDIR logical"
+$	exit
+$     else
+$	srcdir = f$parse(globfile,,,"DEVICE") + f$parse(globfile,,,"DIRECTORY")
+$	define/process XML_SRCDIR "''srcdir'"
+$       write sys$output "Defining XML_SRCDIR as ""''srcdir'"""
+$     endif
+$   endif
+$!
+$!- set up some working logicals -------------------
+$!
+$ pass_no = 1
+$ set_pass_logical:
+$!
+$   if pass_no.le.num_passes
+$   then
+$!
+$     Libname  = libname_'pass_no'
+$     progname = progname_'pass_no'
+$     if libname.nes.""
+$     then
+$       logname  = "''libname'_SRCDIR"
+$     else
+$       logname  = "''progname'_SRCDIR"
+$     endif
+$     findfile = f$element(0," ",src_'pass_no')
+$!
+$!--- set up a source directory logical
+$!
+$     if f$trnlnm("''logname'").eqs.""
+$     then
+$       ! look for the target file in a parallel subdirectory
+$       globfile = f$search("[-...]''findfile'")
+$       if globfile.eqs.""
+$       then
+$  	  write sys$output "Can't locate ''findfile'.  You need to manually define a ''logname' logical"
+$	  exit
+$       else
+$  	  srcdir = f$element(0,"]",globfile)+ "]"
+$	  define/process 'logname' "''srcdir'"
+$         write sys$output "Defining ''logname' as ""''srcdir'"""
+$       endif
+$     endif
+$!
+$!--- if it's a library, set up a logical pointing to the .h files
+$!
+$     if libname.nes."" 
+$     then
+$	if f$trnlnm("''libname'").eqs."" 
+$       then 
+$         ! look for the target .h file in a parallel subdirectory
+$  	  h_file = h_file_'pass_no'
+$         globfile = f$search("[-...]''h_file'")
+$         if globfile.eqs.""
+$         then
+$	    write sys$output "Can't locate ''h_file'.  You need to manually define a ''libname' logical"
+$	    exit
+$         else
+$	    includedir = f$element(0,"]",globfile)+ "]"
+$	    define/process 'libname' "''includedir'"
+$           write sys$output "Defining ''libname' as ""''includedir'"""
+$	  endif
+$       endif
+$     endif
+$!
+$     pass_no = pass_no +1
+$     goto set_pass_logical
+$!
+$   endif	! for each pass
+$!
+$!- set up error handling (such as it is) -------------------------------------
+$!
+$ exit_status = 1
+$ saved_default = f$environment("default")
+$ on error then goto ERROR_OUT 
+$ on control_y then goto ERROR_OUT 
+$!
+$ goto start_here
+$ start_here:	  ! move this line to debug/rerun parts of this command file
+$!
+$!- compile modules into the library ------------------------------------------
+$!
+$!
+$ pass_no = 1	! make three passes, one for each library, one for XSLTPROC
+$ pass_loop:
+$!
+$ if pass_no.le.num_passes
+$ then
+$   Libname  = libname_'pass_no'
+$   progname = progname_'pass_no'
+$   if libname.nes.""
+$   then
+$     logname  = "''libname'_SRCDIR"
+$     pass_description = "the XML_LIBDIR:''libname'.OLB object library"
+$   else
+$     logname  = "''progname'_SRCDIR"
+$     pass_description = "the programs in ''progname'"
+$   endif
+$   src  = src_'pass_no'
+$!
+$!- create the library if need
+$!
+$   if libname.nes."" 
+$   then
+$     if f$search("XML_LIBDIR:''libname'.OLB").eqs."" 
+$     then
+$       write sys$output "Creating new object library XML_LIBDIR:''libname'.OLB..."
+$       library/create XML_LIBDIR:'libname'.OLB
+$     endif
+$   endif
+$!
+$!- move to the source directory 
+$!
+$   set def 'logname'
+$!
+$!- define the library and link commands (link command not used as is)
+$!
+$   if libname.nes.""
+$   then
+$     lib_command  = "LIBRARY/REPLACE XML_LIBDIR:''libname'.OLB"
+$     link_command = ""
+$   else
+$     lib_command  = ""
+$     link_command = "LINK"
+$   endif
+$!
+$   write sys$output ""
+$   write sys$output "Building ''pass_description'
+$   write sys$output ""
+$!
+$   s_no = 0
+$   src = f$edit(src,"COMPRESS")
+$!
+$ source_loop:
+$!
+$     next_source = f$element (S_no," ",src)
+$     if next_source.nes."" .and. next_source.nes." "
+$     then
+$       call build 'next_source'
+$       s_no = s_no + 1
+$       goto source_loop
+$     endif
+$!
+$     pass_no = pass_no + 1
+$     goto pass_loop
+$!
+$   endif	! for each pass
+$!
+$!- Th-th-th-th-th-that's all folks! ------------------------------------------
+$!
+$EXIT_OUT:
+$!
+$ set def 'saved_default
+$ exit 'exit_status
+$!
+$
+$ERROR_OUT:
+$ exit_status = $status
+$ write sys$output "''f$message(exit_status)'"
+$ goto EXIT_OUT
+$!
+$!- the BUILD subroutine.  Compile then insert into library or link as required
+$!
+$BUILD: subroutine
+$   on warning then goto EXIT_BUILD
+$   source_file = p1
+$   name = f$element(0,".",source_file)
+$   object_file = f$fao("XML_LIBDIR:!AS.OBJ",name)
+$!
+$!- compile
+$   write sys$output "Compiling ",p1,p2,"..."
+$   cc_command /object='object_file 'source_file' 'p2'
+$!
+$!- insert into library if command defined
+$!
+$   if lib_command.nes.""  
+$   then 
+$     lib_command 'object_file'
+$     delete/nolog 'object_file';*
+$   endif
+$!
+$!- link module if command defined
+$!
+$   if link_command.nes."" 
+$   then
+$	text = f$element(0,".",p1)	! lose the ".c"
+$	write sys$output "Linking ",text,"..."
+$	dbgopts = ""
+$	if debug then dbgopts = "/DEBUG"
+$	link_command'dbgopts' 'object_file',-
+      		XML_LIBDIR:libexslt/lib,-
+      		XML_LIBDIR:libxslt/lib,-
+      		XML_LIBDIR:libxml/library
+$   endif
+$!
+$EXIT_BUILD:
+$   exit $status
+$!
+$endsubroutine

samples/DIGITAL Command Language/vmsbackup_build.com

@@ -0,0 +1,10 @@
+$! Compiling with VAXC is said to work, but it requires the usual cruft
+$! (vaxcrtl and all), and to avoid hair we don't supply said cruft here.
+$ CC/DECC/PREFIX=all VMSBACKUP.C/DEFINE=(HAVE_MT_IOCTLS=0,HAVE_UNIXIO_H=1)
+$ CC/DECC/PREFIX=all DCLMAIN.C
+$! Probably we don't want match as it probably doesn't implement VMS-style
+$! matching, but I haven't looking into the issues yet.
+$ CC/DECC/PREFIX=all match
+$ LINK/exe=VMSBACKUP.EXE -
+vmsbackup.obj,dclmain.obj,match.obj,sys$input/opt
+identification="VMSBACKUP4.1.1"

samples/DTrace/counts.d

@@ -0,0 +1,23 @@
+/*
+ * This software is in the public domain.
+ *
+ * $Id: counts.d 10510 2005-08-15 01:46:19Z kateturner $
+ */
+
+#pragma D option quiet
+
+self int tottime;
+BEGIN {
+	tottime = timestamp;
+}
+
+php$target:::function-entry
+	@counts[copyinstr(arg0)] = count();
+}
+
+END {
+	printf("Total time: %dus\n", (timestamp - tottime) / 1000);
+	printf("# calls by function:\n");
+	printa("%-40s %@d\n", @counts);
+}
+

samples/DTrace/javascript-trace.d

@@ -0,0 +1,73 @@
+/* -*- Mode: dtrace-script; tab-width: 2; indent-tabs-mode: nil; c-basic-offset: 2 -*- */
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * Copyright (C) 2007  Sun Microsystems, Inc. All Rights Reserved.
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+/*
+ * javascript provider probes
+ *
+ * function-entry       (filename, classname, funcname)
+ * function-info        (filename, classname, funcname, lineno,
+ *                      runfilename, runlineno)
+ * function-args        (filename, classname, funcname, argc, argv, argv0,
+ *                      argv1, argv2, argv3, argv4)
+ * function-rval        (filename, classname, funcname, lineno, rval, rval0)
+ * function-return      (filename, classname, funcname)
+ * object-create-start  (filename, classname)
+ * object-create        (filename, classname, *object, rlineno)
+ * object-create-done   (filename, classname)
+ * object-finalize      (NULL, classname, *object)
+ * execute-start        (filename, lineno)
+ * execute-done         (filename, lineno)
+ */
+
+provider javascript {
+ probe function__entry(char *, char *, char *);
+ probe function__info(char *, char *, char *, int, char *, int);
+ probe function__args(char *, char *, char *, int, void *, void *, void *,
+     void *, void *, void *);
+ probe function__rval(char *, char *, char *, int, void *, void *);
+ probe function__return(char *, char *, char *);
+ probe object__create__start(char *, char *);
+ probe object__create__done(char *, char *);
+ /* XXX must use unsigned longs here instead of uintptr_t for OS X 
+    (Apple radar: 5194316 & 5565198) */
+ probe object__create(char *, char *, unsigned long, int);
+ probe object__finalize(char *, char *, unsigned long);
+ probe execute__start(char *, int);
+ probe execute__done(char *, int);
+};
+
+/*
+#pragma D attributes Unstable/Unstable/Common provider mozilla provider
+#pragma D attributes Private/Private/Unknown provider mozilla module
+#pragma D attributes Private/Private/Unknown provider mozilla function
+#pragma D attributes Unstable/Unstable/Common provider mozilla name
+#pragma D attributes Unstable/Unstable/Common provider mozilla args
+*/
+

samples/DTrace/probes.d

@@ -0,0 +1,93 @@
+/* ----------
+ *	DTrace probes for PostgreSQL backend
+ *
+ *	Copyright (c) 2006-2009, PostgreSQL Global Development Group
+ *
+ *	$PostgreSQL: pgsql/src/backend/utils/probes.d,v 1.11 2009/04/02 20:59:10 momjian Exp $
+ * ----------
+ */
+
+
+/*
+ * Typedefs used in PostgreSQL.
+ *
+ * NOTE: Do not use system-provided typedefs (e.g. uintptr_t, uint32_t, etc)
+ * in probe definitions, as they cause compilation errors on Mac OS X 10.5.
+ */
+#define LocalTransactionId unsigned int
+#define LWLockId int
+#define LWLockMode int
+#define LOCKMODE int
+#define BlockNumber unsigned int
+#define Oid unsigned int
+#define ForkNumber int
+#define bool char
+
+provider postgresql {
+
+	probe transaction__start(LocalTransactionId);
+	probe transaction__commit(LocalTransactionId);
+	probe transaction__abort(LocalTransactionId);
+
+	probe lwlock__acquire(LWLockId, LWLockMode);
+	probe lwlock__release(LWLockId);
+	probe lwlock__wait__start(LWLockId, LWLockMode);
+	probe lwlock__wait__done(LWLockId, LWLockMode);
+	probe lwlock__condacquire(LWLockId, LWLockMode);
+	probe lwlock__condacquire__fail(LWLockId, LWLockMode);
+
+	probe lock__wait__start(unsigned int, unsigned int, unsigned int, unsigned int, unsigned int, LOCKMODE);
+	probe lock__wait__done(unsigned int, unsigned int, unsigned int, unsigned int, unsigned int, LOCKMODE);
+
+	probe query__parse__start(const char *);
+	probe query__parse__done(const char *);
+	probe query__rewrite__start(const char *);
+	probe query__rewrite__done(const char *);
+	probe query__plan__start();
+	probe query__plan__done();
+	probe query__execute__start();
+	probe query__execute__done();
+	probe query__start(const char *);
+	probe query__done(const char *);
+	probe statement__status(const char *);
+
+	probe sort__start(int, bool, int, int, bool);
+	probe sort__done(bool, long);
+
+	probe buffer__read__start(ForkNumber, BlockNumber, Oid, Oid, Oid, bool, bool);
+	probe buffer__read__done(ForkNumber, BlockNumber, Oid, Oid, Oid, bool, bool, bool);
+	probe buffer__flush__start(ForkNumber, BlockNumber, Oid, Oid, Oid);
+	probe buffer__flush__done(ForkNumber, BlockNumber, Oid, Oid, Oid);
+
+	probe buffer__checkpoint__start(int);
+	probe buffer__checkpoint__sync__start();
+	probe buffer__checkpoint__done();
+	probe buffer__sync__start(int, int);
+	probe buffer__sync__written(int);
+	probe buffer__sync__done(int, int, int);
+	probe buffer__write__dirty__start(ForkNumber, BlockNumber, Oid, Oid, Oid);
+	probe buffer__write__dirty__done(ForkNumber, BlockNumber, Oid, Oid, Oid);
+
+	probe deadlock__found();
+
+	probe checkpoint__start(int);
+	probe checkpoint__done(int, int, int, int, int);
+	probe clog__checkpoint__start(bool);
+	probe clog__checkpoint__done(bool);
+	probe subtrans__checkpoint__start(bool);
+	probe subtrans__checkpoint__done(bool);
+	probe multixact__checkpoint__start(bool);
+	probe multixact__checkpoint__done(bool);
+	probe twophase__checkpoint__start();
+	probe twophase__checkpoint__done();
+
+	probe smgr__md__read__start(ForkNumber, BlockNumber, Oid, Oid, Oid);
+	probe smgr__md__read__done(ForkNumber, BlockNumber, Oid, Oid, Oid, int, int);
+	probe smgr__md__write__start(ForkNumber, BlockNumber, Oid, Oid, Oid);
+	probe smgr__md__write__done(ForkNumber, BlockNumber, Oid, Oid, Oid, int, int);
+
+	probe xlog__insert(unsigned char, unsigned char);
+	probe xlog__switch();
+	probe wal__buffer__write__dirty__start();
+	probe wal__buffer__write__dirty__done();
+};

samples/Eiffel/application.e

@@ -0,0 +1,44 @@
+note
+	description : "nino application root class"
+	date        : "$Date$"
+	revision    : "$Revision$"
+
+class
+	APPLICATION
+
+inherit
+	ARGUMENTS
+
+	HTTP_SERVER_SHARED_CONFIGURATION
+
+create
+	make
+
+feature {NONE} -- Initialization
+
+	make
+			-- Run application.
+		local
+			l_server : HTTP_SERVER
+			l_cfg: HTTP_SERVER_CONFIGURATION
+			l_http_handler : HTTP_HANDLER
+		do
+			create l_cfg.make
+			l_cfg.http_server_port := 9_000
+			l_cfg.document_root := default_document_root
+			set_server_configuration (l_cfg)
+			debug ("nino")
+				l_cfg.set_is_verbose (True)
+			end
+
+			create l_server.make (l_cfg)
+			create {APPLICATION_CONNECTION_HANDLER} l_http_handler.make (l_server)
+			l_server.setup (l_http_handler)
+		end
+
+feature -- Access
+
+	default_document_root: STRING = "webroot"
+
+end
+

samples/Eiffel/book_collection.e

@@ -0,0 +1,82 @@
+class
+	BOOK_COLLECTION
+
+create
+	make
+
+feature {NONE} -- Initialization
+
+	make (a_name: STRING_32)
+			-- Create a book collection with `a_name' as `name'.
+		do
+			set_name (a_name)
+			create book_index.make (10)
+		ensure
+			name_set: name = a_name
+		end
+
+feature -- Access
+
+	name: STRING_32
+			-- Name.
+
+	books: LIST [BOOK]
+			-- collection of book.
+		do
+			create {LINKED_LIST [BOOK]} Result.make
+			across
+				book_index as it
+			loop
+				Result.append (it.item)
+			end
+		end
+
+	books_by_author (a_author: STRING_32): LIST [BOOK]
+			-- Books wrote by `a_author' in this collection.
+		do
+			if attached book_index [a_author] as l_result then
+				Result := l_result
+			else
+				create {LINKED_LIST [BOOK]} Result.make
+			end
+		end
+
+feature -- Change
+
+	set_name (a_name: STRING_32)
+			-- Set `name' with `a_name'.
+		do
+			name := a_name
+		ensure
+			name_set: name = a_name
+		end
+
+	add_book (a_book: BOOK)
+			-- Extend collection with `a_book'.
+		local
+			l: detachable LIST [BOOK]
+		do
+			l := book_index.at (a_book.author.name)
+			if l = Void then
+				create {LINKED_LIST [BOOK]} l.make
+				book_index.put (l, a_book.author.name)
+			end
+			l.force (a_book)
+		end
+
+	add_books (book_list: like books)
+			-- Append collection with `book_list'.
+		do
+			across
+				book_list as it
+			loop
+				add_book (it.item)
+			end
+		end
+
+feature {NONE} -- Implementation
+
+	book_index: HASH_TABLE [LIST [BOOK], STRING_32]
+			-- Association of author name and its books.
+
+end -- class BOOK_COLLECTION

samples/Eiffel/git_checkout_command.e

@@ -0,0 +1,41 @@
+note
+	description: "Git checkout command."
+	author: "Olivier Ligot"
+
+class
+	GIT_CHECKOUT_COMMAND
+
+inherit
+	GIT_COMMAND
+
+create
+	make,
+	make_master
+
+feature {NONE} -- Initialization
+
+	make (a_branch: STRING)
+			-- Checkout the branch `a_branch'.
+		do
+			initialize
+			arguments.force_last (a_branch)
+			branch := a_branch
+		ensure
+			branch_set: branch = a_branch
+		end
+
+	make_master
+			-- Checkout the master branch.
+		do
+			make ("master")
+		end
+
+feature -- Access
+
+	branch: STRING
+			-- Branch to checkout
+
+	name: STRING = "checkout"
+			-- Git subcommand name
+
+end

samples/Elixir/filenames/mix.lock

@@ -0,0 +1,10 @@
+%{"cowboy": {:hex, :cowboy, "1.0.0"},
+  "cowlib": {:hex, :cowlib, "1.0.1"},
+  "hackney": {:hex, :hackney, "0.14.3"},
+  "hound": {:hex, :hound, "0.6.0"},
+  "httpoison": {:hex, :httpoison, "0.5.0"},
+  "idna": {:hex, :idna, "1.0.1"},
+  "phoenix": {:hex, :phoenix, "0.10.0"},
+  "plug": {:hex, :plug, "0.11.1"},
+  "poison": {:hex, :poison, "1.3.1"},
+  "ranch": {:hex, :ranch, "1.0.0"}}

samples/Erlang/filenames/rebar.config

@@ -0,0 +1,260 @@
+%% -*- mode: erlang;erlang-indent-level: 4;indent-tabs-mode: nil -*-
+%% ex: ts=4 sw=4 ft=erlang et
+%% This is a sample rebar.conf file that shows examples of some of rebar's
+%% options.
+
+%% == Core ==
+
+%% Extend list of always recursive commands
+{recursive_cmds, []}.
+
+%% Check required ERTS or OTP release version
+{require_erts_vsn, ".*"}.
+{require_otp_vsn, ".*"}.
+{require_min_otp_vsn, ".*"}.
+
+%% Additional library directories to add to the code path
+{lib_dirs, []}.
+
+%% == Erlang Compiler ==
+
+%% Erlang files to compile before the rest. Rebar automatically compiles
+%% parse_transforms and custom behaviours before anything other than the files
+%% in this list.
+{erl_first_files, ["src/mymib1.erl", "src/mymib2.erl"]}.
+
+%% Erlang compiler options
+{erl_opts, [no_debug_info,
+            {i, "myinclude"},
+            {src_dirs, ["src", "src2", "src3"]},
+            {platform_define,
+             "(linux|solaris|freebsd|darwin)", 'HAVE_SENDFILE'},
+            {platform_define, "(linux|freebsd)", 'BACKLOG', 128},
+            {platform_define, "R13", 'old_inets'}]}.
+
+%% MIB Options?
+{mib_opts, []}.
+
+%% SNMP mibs to compile first?
+{mib_first_files, []}.
+
+%% leex options
+{xrl_opts, []}.
+
+%% leex files to compile first
+{xrl_first_files, []}.
+
+%% yecc options
+{yrl_opts, []}.
+
+%% yecc files to compile first
+{yrl_first_files, []}.
+
+%% == EDoc ==
+
+%% EDoc options
+{edoc_opts, []}.
+
+%% == Port Compiler ==
+
+%% Port compilation environment variables. See rebar_port_compiler.erl for
+%% more info. Default is `[]'
+{port_env, [{"CFLAGS", "$CFLAGS -Ifoo"},
+            {"freebsd", "LDFLAGS", "$LDFLAGS -lfoo"}]}.
+
+%% port_specs
+%% List of filenames or wildcards to be compiled. May also contain a tuple
+%% consisting of a regular expression to be applied against the system
+%% architecture as a filter.
+{port_specs, [{"priv/so_name.so", ["c_src/*.c"]},
+              {"linux", "priv/hello_linux", ["c_src/hello_linux.c"]},
+              {"linux", "priv/hello_linux", ["c_src/*.c"], [{env, []}]}]}.
+
+%% == escriptize ==
+{escript_name, "application"}.
+{escript_incl_apps, []}.
+{escript_shebang, "#!/usr/bin/env escript\n"}.
+{escript_comment, "%%\n"}.
+{escript_emu_args, "%%! -pa application/application/ebin\n"}.
+
+%% == LFE Compiler ==
+
+%% LFE files to compile before the rest
+{lfe_first_files, []}.
+
+%% Options for the LFE compiler: reuse {erl_opts, []}
+
+%% == ErlyDTL Compiler ==
+
+%% Options for the ErlyDTL compiler
+{erlydtl_opts, []}.
+
+%% == Proto compiler ==
+{proto_opts, [
+    {compiler, protobuffs},
+    {src_dirs, ["src"]}
+]}.
+%% Available compilers for protocol buffer files (*.proto):
+%%   protobuffs  (default)
+%%   gpb
+%% Optional src_dirs which is a list of directories where
+%% to look for .proto files, default is src
+
+%% Options for the gpb protocol buffer compiler,
+%% if selected by the proto_compiler option
+{gpb_opts, []}.
+
+%% == EUnit ==
+
+%% Options for eunit:test()
+{eunit_opts, []}.
+
+%% Additional compile options for eunit. erl_opts is also used
+{eunit_compile_opts, []}.
+
+%% Same as erl_first_files, but used only when running 'eunit'
+{eunit_first_files, []}.
+
+%% == Cover ==
+
+%% Whether to enable coverage reporting. Default is `false'
+{cover_enabled, false}.
+
+%% Whether to print coverage report to console. Default is `false'
+{cover_print_enabled, false}.
+
+%% Whether to export coverage report to file. Default is `false'
+{cover_export_enabled, false}.
+
+%% == Common Test ==
+
+%% Override the default "test" directory in which SUITEs are located
+{ct_dir, "itest"}.
+
+%% Override the default "logs" directory in which SUITEs are logged
+{ct_log_dir, "test/logs"}.
+
+%% Option to pass extra parameters when launching Common Test
+{ct_extra_params, "-boot start_sasl -s myapp"}.
+
+%% Option to use short names (i.e., -sname test) when starting ct
+{ct_use_short_names, true}.
+
+%% == QuickCheck ==
+
+%% If qc_mod is unspecified, rebar tries to detect Triq or EQC
+{qc_opts, [{qc_mod, module()}, Options]}.
+
+%% Additional compile options for qc. erl_opts is also used
+{qc_compile_opts, []}.
+
+%% Same as erl_first_files, but used only when running 'qc'
+{qc_first_files, []}.
+
+%% == Cleanup ==
+
+%% Which files to cleanup
+{clean_files, ["file", "file2"]}.
+
+%% == OTP Applications ==
+
+%% Enable validation of the OTP app module list. Default is 'true'
+{validate_app_modules, true}.
+
+%% == Dependencies ==
+
+%% Where to put any downloaded dependencies. Default is "deps"
+{deps_dir, "deps"}.
+
+%% What dependencies we have, dependencies can be of 3 forms, an application
+%% name as an atom, eg. mochiweb, a name and a version (from the .app file), or
+%% an application name, a version and the SCM details on how to fetch it (SCM
+%% type, location and revision).
+%% Rebar currently supports git, hg, bzr, svn, rsync, fossil, and p4.
+{deps, [app_name,
+        {rebar, "1.0.*"},
+        {rebar, ".*",
+         {git, "git://github.com/rebar/rebar.git"}},
+        {rebar, ".*",
+         {git, "git://github.com/rebar/rebar.git", "Rev"}},
+        {rebar, "1.0.*",
+         {git, "git://github.com/rebar/rebar.git", {branch, "master"}}},
+        {rebar, "1.0.0",
+         {git, "git://github.com/rebar/rebar.git", {tag, "1.0.0"}}},
+        %% Dependencies can be marked as 'raw'. Rebar does not require
+        %% such dependencies to have a standard Erlang/OTP layout
+        %% which assumes the presence of either
+        %% "src/dependency_name.app.src" or "ebin/dependency_name.app"
+        %% files.
+        %%
+        %% 'raw' dependencies can still contain 'rebar.config' and
+        %% even can have the proper OTP directory layout, but they
+        %% won't be compiled.
+        %%
+        %% Only a subset of rebar commands will be executed on the
+        %% 'raw' subdirectories: get-deps, update-deps, check-deps,
+        %% list-deps and delete-deps.
+        {rebar, "",
+         {git, "git://github.com/rebar/rebar.git", {branch, "master"}},
+         [raw]},
+        {app_name, ".*", {hg, "https://www.example.org/url"}},
+        {app_name, ".*", {rsync, "Url"}},
+        {app_name, ".*", {svn, "https://www.example.org/url"}},
+        {app_name, ".*", {svn, "svn://svn.example.org/url"}},
+        {app_name, ".*", {bzr, "https://www.example.org/url", "Rev"}},
+        {app_name, ".*", {fossil, "https://www.example.org/url"}},
+        {app_name, ".*", {fossil, "https://www.example.org/url", "Vsn"}},
+        {app_name, ".*", {p4, "//depot/subdir/app_dir"}}]}.
+
+%% == Subdirectories ==
+
+%% Subdirectories?
+{sub_dirs, ["dir1", "dir2"]}.
+
+%% == Plugins ==
+
+%% Plugins you wish to include.
+%% These can include any module on the code path, including deps.
+%% Alternatively, plugins can be placed as source files in the plugin_dir, in
+%% which case they will be compiled and loaded dynamically at runtime.
+{plugins, [plugin1, plugin2]}.
+
+%% Override the directory in which plugin sources can be found.
+%% Defaults to ./plugins
+{plugin_dir, "some_other_directory"}.
+
+
+%% == Pre/Post Command Hooks ==
+
+{pre_hooks, [{clean, "./prepare_package_files.sh"},
+             {"linux", compile, "c_src/build_linux.sh"},
+             {compile, "escript generate_headers"},
+             {compile, "escript check_headers"}]}.
+
+{post_hooks, [{clean, "touch file1.out"},
+              {"freebsd", compile, "c_src/freebsd_tweaks.sh"},
+              {eunit, "touch file2.out"},
+              {compile, "touch postcompile.out"}]}.
+
+%% == xref ==
+
+{xref_warnings, false}.
+
+%% optional extra paths to include in xref:set_library_path/2.
+%% specified relative location of rebar.config.
+%% e.g. {xref_extra_paths,["../gtknode/src"]}
+{xref_extra_paths,[]}.
+
+%% xref checks to run
+{xref_checks, [undefined_function_calls, undefined_functions,
+               locals_not_used, exports_not_used,
+               deprecated_function_calls, deprecated_functions]}.
+
+%% Optional custom xref queries (xref manual has details) specified as
+%%     {xref_queries, [{query_string(), expected_query_result()},...]}
+%% The following for example removes all references to mod:*foo/4
+%% functions from undefined external function calls as those are in a
+%% generated module
+{xref_queries,
+ [{"(XC - UC) || (XU - X - B"
+   " - (\"mod\":\".*foo\"/\"4\"))",[]}]}.

samples/Erlang/filenames/rebar.config.lock

@@ -0,0 +1,158 @@
+%% THIS FILE IS GENERATED. DO NOT EDIT IT MANUALLY %%
+
+{sub_dirs,["rel","apps/riak"]}.
+{require_otp_vsn,"R16|17"}.
+{cover_enabled,true}.
+{lib_dirs,["apps/riak"]}.
+{erl_opts,[debug_info,fail_on_warning]}.
+{eunit_opts,[verbose]}.
+{erlydtl_opts,[{compiler_options,[report,return,debug_info]}]}.
+{deps,[{rebar_lock_deps_plugin,".*",
+                               {git,"git://github.com/seth/rebar_lock_deps_plugin.git",
+                                    "7a5835029c42b8138325405237ea7e8516a84800"}},
+       {node_package,".*",
+                     {git,"git://github.com/basho/node_package.git",
+                          "a829631eccebe3c1d7657a0075584f55bf342977"}},
+       {goldrush,".*",
+                 {git,"git://github.com/DeadZen/goldrush.git",
+                      "71e63212f12c25827e0c1b4198d37d5d018a7fec"}},
+       {lager,".*",
+              {git,"git://github.com/basho/lager.git",
+                   "b6b6cebcb27ccff8acc59ae775acebc2f52e4926"}},
+       {syslog,".*",
+               {git,"git://github.com/Vagabond/erlang-syslog.git",
+                    "918c9b453e0811b24f2c99b35b712b0ef9f29c7e"}},
+       {lager_syslog,".*",
+                     {git,"git://github.com/basho/lager_syslog.git",
+                          "fa2e7e3daee0d0a59dadb820fd3381eac4a65770"}},
+       {cluster_info,".*",
+                     {git,"git://github.com/basho/cluster_info.git",
+                          "e231144ca32dc83317be3360a4a259c73826b08a"}},
+       {sidejob,".*",
+                {git,"git://github.com/basho/sidejob.git",
+                     "c5aabba2d7daa80c340e110902bbcfcb552ccdcf"}},
+       {erlang_js,".*",
+                  {git,"git://github.com/basho/erlang_js.git",
+                       "07467d899ab90a2b719ad19ab0be0048c1c8d873"}},
+       {meck,".*",
+             {git,"git://github.com/basho/meck.git",
+                  "dde759050eff19a1a80fd854d7375174b191665d"}},
+       {getopt,".*",
+               {git,"git://github.com/jcomellas/getopt.git",
+                    "659a28f4145bc9843598972854299dc4ea77e4cb"}},
+       {neotoma,".*",
+                {git,"git://github.com/seancribbs/neotoma.git",
+                     "760928ec8870da02eb11bccb501e2700925d06c6"}},
+       {cuttlefish,".*",
+                   {git,"git://github.com/basho/cuttlefish.git",
+                        "c92c8325aeaea6b6ba7516bbd434f8e408f87d60"}},
+       {bitcask,".*",
+                {git,"git://github.com/basho/bitcask.git",
+                     "c74d0c43fdefdd435f7621ddf1fc2995b5bd123c"}},
+       {eper,".*",
+             {git,"git://github.com/basho/eper.git",
+                  "7222ecaebceb5422e74a9c1503043bbc6036f6b7"}},
+       {edown,".*",
+              {git,"git://github.com/uwiger/edown.git",
+                   "d62ec85281e451a46ba30045917c119d65b72a84"}},
+       {sext,".*",
+             {git,"git://github.com/basho/sext.git",
+                  "846b9cc22456287a572efd4c924203d77778670f"}},
+       {poolboy,".*",
+                {git,"git://github.com/basho/poolboy.git",
+                     "8bb45fbc715c5f493642a1cc572ec7017d0d5fa3"}},
+       {basho_stats,".*",
+                    {git,"git://github.com/basho/basho_stats.git",
+                         "19c532af235ae675439d491b329c55c2f9b02deb"}},
+       {riak_sysmon,".*",
+                    {git,"git://github.com/basho/riak_sysmon.git",
+                         "26a58bcaba96d07df885f7b3db4d4306f995ce14"}},
+       {eleveldb,".*",
+                 {git,"git://github.com/basho/eleveldb.git",
+                      "0e4e4e7cf3ddc26523a77f853ea9409c1707b26c"}},
+       {riak_ensemble,".*",
+                      {git,"git://github.com/basho/riak_ensemble",
+                           "78dc8f623353a212ca3cf12236d1e9ac824bde16"}},
+       {pbkdf2,".*",
+               {git,"git://github.com/basho/erlang-pbkdf2.git",
+                    "7076584f5377e98600a7e2cb81980b2992fb2f71"}},
+       {parse_trans,".*",
+                    {git,"git://github.com/uwiger/parse_trans.git",
+                         "82cc00264aa1bad8fc5c0739b7541feb4a843432"}},
+       {bear,".*",
+             {git,"git://github.com/basho/bear.git",
+                  "da820a13c607c3f816ee8b83c587266da5389761"}},
+       {folsom,".*",
+               {git,"git://github.com/basho/folsom.git",
+                    "72944523b6467c9f7add5f1c96dd5020424a2681"}},
+       {setup,".*",
+              {git,"git://github.com/uwiger/setup.git",
+                   "51ee7c9f64d2bbe9dcbb58c278e8fbfd4d0ca5e2"}},
+       {exometer_core,".*",
+                      {git,"git://github.com/basho/exometer_core.git",
+                           "b47a5d65d9500c2b8f6ccc50e34005503589ef77"}},
+       {clique,".*",
+               {git,"git://github.com/basho/clique.git",
+                    "3af4db8ea0f74aca42f6713446dcd5915c795a74"}},
+       {riak_core,".*",
+                  {git,"git://github.com/basho/riak_core.git",
+                       "044c4e7f8dbfe8c49c45f2f7090adff4cd5aba50"}},
+       {riak_pipe,".*",
+                  {git,"git://github.com/basho/riak_pipe.git",
+                       "3c0abc7ba301d57940c5a9c5de368b70429c28ff"}},
+       {protobuffs,".*",
+                   {git,"git://github.com/basho/erlang_protobuffs.git",
+                        "f88fc3c6881687432ddd5546b3c7b08009dfb26f"}},
+       {riak_pb,".*",
+                {git,"git://github.com/basho/riak_pb.git",
+                     "78c50efa698f33f7d6ab1c7f5fa4666ec03b46b4"}},
+       {mochiweb,".*",
+                 {git,"git://github.com/basho/mochiweb.git",
+                      "ade2a9b29a11034eb550c1d79b4f991bf5ca05ba"}},
+       {webmachine,".*",
+                   {git,"git://github.com/basho/webmachine.git",
+                        "7677c240f4a7ed020f4bab48278224966bb42311"}},
+       {riak_api,".*",
+                 {git,"git://github.com/basho/riak_api.git",
+                      "2781e66796903bc6847bffcf71a6ba7a05d69275"}},
+       {riak_dt,".*",
+                {git,"git://github.com/basho/riak_dt.git",
+                     "f7981d4ad7407ddc085f133f204dd71bf9d50c56"}},
+       {eunit_formatters,".*",
+                         {git,"git://github.com/seancribbs/eunit_formatters",
+                              "96b6ced4d45ba641cbf2c8a8ae9b350dd300bc10"}},
+       {riak_kv,".*",
+                {git,"git://github.com/basho/riak_kv.git",
+                     "404619cb57574cd43e2dc0dc0453884ec6732a99"}},
+       {merge_index,".*",
+                    {git,"git://github.com/basho/merge_index.git",
+                         "b701dde5c28956c3b629411e5ff7e50cbb5cb4b3"}},
+       {riak_search,".*",
+                    {git,"git://github.com/basho/riak_search.git",
+                         "8fe4a8c020a74c52ee877bf6dd410824b4f79f8b"}},
+       {erlydtl,".*",
+                {git,"git://github.com/evanmiller/erlydtl.git",
+                     "d20b53f04837a1053ed18987f645cb60eae82453"}},
+       {riak_control,".*",
+                     {git,"git://github.com/basho/riak_control.git",
+                          "09073ce672260e1ec0ba3999fabed7f319624ba1"}},
+       {riaknostic,".*",
+                   {git,"git://github.com/basho/riaknostic.git",
+                        "101d95bddff4b70afcd1dd5442b8c6651887e0a4"}},
+       {kvc,".*",
+            {git,"git://github.com/etrepum/kvc.git",
+                 "5565fe51857747662410cc3c06362ebcf48a2f04"}},
+       {ibrowse,".*",
+                {git,"git://github.com/cmullaparthi/ibrowse.git",
+                     "e8ae353c16d4f0897abb9f80025b52925b974dd1"}},
+       {yokozuna,".*",
+                 {git,"git://github.com/basho/yokozuna.git",
+                      "5868266b11f131d14c85495e50f899f3fe8158ba"}},
+       {canola,".*",
+               {git,"git://github.com/basho/canola.git",
+                    "9bdfee88fce20b3a01b7003696b53eb21913d6fb"}},
+       {riak_auth_mods,".*",
+                       {git,"git://github.com/basho/riak_auth_mods.git",
+                            "31b8b30e6c215418522eaa615264ae9769a87410"}}]}.
+{plugins,[rebar_lock_deps_plugin]}.
+

samples/Erlang/filenames/rebar.lock

@@ -0,0 +1,16 @@
+[{<<"goldrush">>,
+  {git,"git://github.com/DeadZen/goldrush.git",
+       {ref,"71e63212f12c25827e0c1b4198d37d5d018a7fec"}},
+  1},
+ {<<"riak_dt">>,
+  {git,"git://github.com/helium/riak_dt.git",
+       {ref,"15d66cb26c2028c1ad1271c359b1d5da213825c3"}},
+  0},
+ {<<"lager">>,
+  {git,"git://github.com/basho/lager.git",
+       {ref,"d33ccf3b69de09a628fe38b4d7981bb8671b8a4f"}},
+  0},
+ {<<"eleveldb">>,
+  {git,"git://github.com/helium/eleveldb.git",
+       {ref,"29a5360dc0365b3330dd0cd45b0b8166f3b854be"}},
+  0}].

samples/Filterscript/colormatrix.fs

@@ -0,0 +1,35 @@
+/*
+ * Copyright (C) 2012 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "ip.rsh"
+
+static rs_matrix4x4 Mat;
+
+void init() {
+    rsMatrixLoadIdentity(&Mat);
+}
+
+void setMatrix(rs_matrix4x4 m) {
+    Mat = m;
+}
+
+uchar4 __attribute__((kernel)) root(uchar4 in) {
+    float4 f = convert_float4(in);
+    f = rsMatrixMultiply(&Mat, f);
+    f = clamp(f, 0.f, 255.f);
+    return convert_uchar4(f);
+}
+

samples/Filterscript/fs_kernel.fs

@@ -0,0 +1,18 @@
+#pragma version(1)
+#pragma rs java_package_name(foo)
+
+int __attribute__((kernel)) root(uint32_t ain) {
+  return 0;
+}
+
+void __attribute__((kernel)) in_only(uint32_t ain) {
+}
+
+int __attribute__((kernel)) out_only() {
+  return 0;
+}
+
+int __attribute__((kernel)) everything(uint32_t ain, uint32_t x, uint32_t y) {
+  return 0;
+}
+

samples/Formatted/long_seq.for

@@ -0,0 +1,919 @@
+ACCEPTABLE LEFT PRIMERS
+                                  1-based     #                self   self hair-  qual-
+   # sequence                       start ln  N   GC%     Tm any_th end_th   pin   lity
+   0 tgctagctaggcgatgctag             411 20  0 55.00 60.028 23.16 23.16 38.59  0.028
+   1 actgatacgcgatgctagct             476 20  0 50.00 59.957 17.69  1.35  0.00  0.043
+   2 gatcgatgctagctaggcga             405 20  0 55.00 60.100 16.30 16.30  0.00  0.100
+   3 tcgatcgatgctagctaggc             403 20  0 55.00 60.100 18.63  8.45  0.00  0.100
+   4 tagctgatcgatcgtagcgg             565 20  0 55.00 60.101 25.02 17.36  0.00  0.101
+   5 gctgactgatcgatcgatgc             113 20  0 55.00 59.826 24.08 17.09 35.21  0.174
+   6 tatcatctctgcgcgatcga             361 20  0 50.00 59.747 22.07  1.72 38.48  0.253
+   7 agctaggcgatgctagctag             415 20  0 55.00 59.742 17.46 17.46 41.54  0.258
+   8 ctagctaggcgatgctagct             413 20  0 55.00 59.742 18.68 17.35 43.53  0.258
+   9 ggcgatctagctagctgact             583 20  0 55.00 59.671 17.44  7.44 37.58  0.329
+  10 tcgatgctagctaggcgatg             407 20  0 55.00 60.382 14.03  0.00  0.00  0.382
+  11 gctgatcgatcgatgctagc             398 20  0 55.00 59.618 25.97 24.79 35.21  0.382
+  12 gctagctgatcgatcgatgc             394 20  0 55.00 59.618 24.08 21.09 35.21  0.382
+  13 atcatctctgcgcgatcgat             362 20  0 50.00 60.382 22.07  5.02 38.48  0.382
+  14 gactgatacgcgatgctagc             475 20  0 55.00 59.551  8.61  8.61  0.00  0.449
+  15 atcgatgctagctaggcgat             406 20  0 50.00 59.452 18.43 18.43  0.00  0.548
+  16 gctagctgactgatacgcga             468 20  0 55.00 60.589 16.29  0.00  0.00  0.589
+  17 agctagctgactgatacgcg             467 20  0 55.00 60.590 17.99  3.89  0.00  0.590
+  18 atgctagctaggcgatgcta             410 20  0 50.00 59.375 10.59  8.91  0.00  0.625
+  19 ctatcatctctgcgcgatcg             360 20  0 55.00 59.347 12.19 12.19 39.07  0.653
+  20 gatgctagctaggcgatgct             409 20  0 55.00 60.668  7.01  7.53  0.00  0.668
+  21 gctactatcatctctgcgcg             356 20  0 55.00 59.273  0.00  0.00  0.00  0.727
+  22 cgtagcggcgatctagctag             577 20  0 60.00 60.791 15.64 15.64 37.58  0.791
+  23 cggcgatctagctagctgac             582 20  0 60.00 61.003 14.84  7.25 38.70  1.003
+  24 gctagctgatcgatcgtagc             563 20  0 55.00 58.995 23.70 23.70  0.00  1.005
+  25 gatcgatcgatgtgcggcta              81 20  0 55.00 61.006 19.16  0.00 41.65  1.006
+  26 atcgatcgatgtgcggctag              82 20  0 55.00 61.008 29.65  0.00 41.65  1.008
+  27 gctgactgatacgcgatgc              472 19  0 57.89 60.025  0.00  0.00  0.00  1.025
+  28 agctagctgatcatcgatgct            190 21  0 47.62 60.035 17.99 11.09  0.00  1.035
+  29 gctagctagctgactgatcga            105 21  0 52.38 60.037 34.38  0.00 46.11  1.037
+  30 tcatctctgcgcgatcgat              363 19  0 52.63 59.946 22.07  0.12 38.48  1.054
+  31 atcatctctgcgcgatcga              362 19  0 52.63 59.946 22.07  1.72 38.48  1.054
+  32 atcgatcgatgtgcggcta               82 19  0 52.63 59.945 29.65  0.00 41.65  1.055
+  33 gtagcggcgatctagctagc             578 20  0 60.00 61.071 16.97  7.15 39.86  1.071
+  34 gctagctgactgatcgatcg             109 20  0 55.00 58.924 16.84 13.89  0.00  1.076
+  35 gctgatcgatcgatgtgcg               78 19  0 57.89 60.097 29.87 18.15 42.69  1.097
+  36 tatcatctctgcgcgatcgat            361 21  0 47.62 60.172 22.07 11.47 38.48  1.172
+  37 gctagctagctgatcgatcga            390 21  0 52.38 60.172 34.38 22.52 46.11  1.172
+  38 gctagctagctgatcgatcga             70 21  0 52.38 60.172 34.38 22.52 46.11  1.172
+  39 catctctgcgcgatcgatg              364 19  0 57.89 59.810 13.74 13.74 38.48  1.190
+  40 tcgtagcggcgatctagcta             576 20  0 55.00 61.231 11.55  9.27 36.40  1.231
+  41 actgatacgcgatgctagcta            476 21  0 47.62 59.765 17.69  3.08  0.00  1.235
+  42 actgatcgatcgatgctagct            117 21  0 47.62 59.763 23.29 11.70 35.21  1.237
+  43 agctagctgatcgatcgatgt             73 21  0 47.62 59.763 17.99  2.62 35.21  1.237
+  44 tagcggcgatctagctagct             579 20  0 55.00 61.243 23.74 23.74 46.60  1.243
+  45 cgtagcggcgatctagcta              577 19  0 57.89 59.729 11.55  9.27 37.58  1.271
+  46 ctagctgatcgatcgtagcg             564 20  0 55.00 58.727 25.02 15.05  0.00  1.273
+  47 tagcggcgatctagctagc              579 19  0 57.89 59.725 16.97  9.14 39.86  1.275
+  48 catcgatcgatgcatgcatg             442 20  0 50.00 58.722 37.80 23.31 44.93  1.278
+  49 tcatctctgcgcgatcgatg             363 20  0 55.00 61.279 18.01 18.01 38.48  1.279
+  50 gctagctagctgatcgatcg             559 20  0 55.00 58.714 34.38 11.90 46.11  1.286
+  51 gctagctagctgatcgatcg             390 20  0 55.00 58.714 34.38 11.90 46.11  1.286
+  52 gctagctagctgatcgatcg              70 20  0 55.00 58.714 34.38 11.90 46.11  1.286
+  53 agcatcggattagctagctga              3 21  0 47.62 59.689 28.29 20.88  0.00  1.311
+  54 agctgatcgatcgtagcgg              566 19  0 57.89 60.315 25.02 17.36  0.00  1.315
+  55 cggcgatctagctagctga              582 19  0 57.89 59.650 21.57 16.66 38.70  1.350
+  56 ctagctgatcgatcgatgtgc             75 21  0 52.38 59.643 31.83 30.04 35.21  1.357
+  57 gctagctgatcgatcgatgtg             74 21  0 52.38 59.643 12.06  6.93 35.21  1.357
+  58 gctagctaggcgatgctagc             412 20  0 60.00 61.357 30.41 30.41 46.19  1.357
+  59 tagctagctgactgatacgcg            466 21  0 52.38 60.373 28.29  3.89  0.00  1.373
+  60 gctagctgactgatcgatcga            109 21  0 52.38 60.374 22.52 22.52  0.00  1.374
+  61 agctagctgactgatcgatcg            108 21  0 52.38 60.374 17.99 13.89  0.00  1.374
+  62 cgatcgatgctagctaggcg             404 20  0 60.00 61.409 15.59  9.14  0.00  1.409
+  63 gctagctagctgactgatcg             105 20  0 55.00 58.563 34.38  1.84 46.11  1.437
+  64 atgctagctaggcgatgct              410 19  0 52.63 59.561 10.59  7.53  0.00  1.439
+  65 agctagctgatcgatcgtagc            562 21  0 52.38 60.441 26.87 26.87  0.00  1.441
+  66 gctagctagctgatcgatcgt            559 21  0 52.38 60.441 34.38  2.65 46.11  1.441
+  67 tagctaggcgatgctagctag            414 21  0 52.38 59.559 18.42 17.46 42.44  1.441
+  68 ctagctaggcgatgctagcta            413 21  0 52.38 59.559 18.69 17.64 42.44  1.441
+  69 tagctgatcgatcgatgtgc              76 20  0 50.00 58.558 31.83 30.04 35.21  1.442
+  70 gatgctagctaggcgatgcta            409 21  0 52.38 60.444  9.82  8.91  0.00  1.444
+  71 atgctagctaggcgatgctag            410 21  0 52.38 60.444 23.16 23.16 38.59  1.444
+  72 gctagctgatcatcgatgct             191 20  0 50.00 58.539 16.29 12.14  0.00  1.461
+  73 agctagctgatcatcgatgc             190 20  0 50.00 58.539 21.42  9.22  0.00  1.461
+  74 gctgactgatacgcgatgct             472 20  0 55.00 61.494  2.33  0.00  0.00  1.494
+  75 agctgactgatacgcgatgc             471 20  0 55.00 61.494  3.47  0.00  0.00  1.494
+  76 ggcgatctagctagctgacta            583 21  0 52.38 59.491 17.44  5.40 37.58  1.509
+  77 gatcgatgctagctaggcgat            405 21  0 52.38 60.510 21.61 21.61  0.00  1.510
+  78 atcgatcgatgctagctaggc            402 21  0 52.38 60.510 29.65  8.45 33.56  1.510
+  79 ctgatcgatcgatgtgcgg               79 19  0 57.89 59.447 15.54  5.83 41.65  1.553
+  80 agctgatcgatcgatgtgcg              77 20  0 55.00 61.556 31.92 20.26 42.69  1.556
+  81 cgatcatcgatgctagctagc            548 21  0 52.38 59.444 34.89 34.89 46.99  1.556
+  82 tagctaggcgatgctagcta             414 20  0 50.00 58.433 19.37 17.81 42.44  1.567
+  83 agctagctactgatcgatgct            303 21  0 47.62 59.415 17.56 11.51  0.00  1.585
+  84 tcgatcgatgtgcggctag               83 19  0 57.89 60.606 18.63  0.00 41.65  1.606
+  85 gactgatcgatcgatgctagc            116 21  0 52.38 59.378 15.86  8.45 35.21  1.622
+  86 agctagctgactgatcgatca            260 21  0 47.62 59.347 26.99 26.99 35.44  1.653
+  87 ctgactgatacgcgatgctag            473 21  0 52.38 59.312  1.70  0.00  0.00  1.688
+  88 ctagctgactgatacgcgatg            469 21  0 52.38 59.312  0.00  0.00  0.00  1.688
+  89 gctactatcatctctgcgcga            356 21  0 52.38 60.707  2.71  2.71  0.00  1.707
+  90 agctactatcatctctgcgcg            355 21  0 52.38 60.709  0.00  0.00  0.00  1.709
+  91 actatcatctctgcgcgatc             359 20  0 50.00 58.270  4.99  0.00  0.00  1.730
+  92 actgatcgatcgatgctagc             117 20  0 50.00 58.270 23.29 13.61 35.21  1.730
+  93 gctagctgatcgatcgatgt              74 20  0 50.00 58.270 14.29  2.62 35.21  1.730
+  94 ctatcatctctgcgcgatcga            360 21  0 52.38 60.771 22.07  1.72 38.48  1.771
+  95 atcgatgctagctaggcgatg            406 21  0 52.38 60.779 21.16  4.37  0.00  1.779
+  96 tgactgatacgcgatgctag             474 20  0 50.00 58.207  1.70  0.00  0.00  1.793
+  97 ctgactgatacgcgatgcta             473 20  0 50.00 58.207  2.33  0.00  0.00  1.793
+  98 tagctgactgatacgcgatg             470 20  0 50.00 58.207  0.00  0.00  0.00  1.793
+  99 ctgactgatcgatcgatgct             114 20  0 50.00 58.197 26.44 12.40 35.21  1.803
+ 100 agctgactgatcgatcgatg             112 20  0 50.00 58.197 23.05 13.21 35.21  1.803
+ 101 tcggattagctagctgatgc               7 20  0 50.00 58.176 17.46 17.46 40.05  1.824
+ 102 gcatcggattagctagctga               4 20  0 50.00 58.176 28.29 20.88  0.00  1.824
+ 103 agcatcggattagctagctg               3 20  0 50.00 58.171 28.29 10.80  0.00  1.829
+ 104 gatgctagctaggcgatgc              409 19  0 57.89 59.141  4.18  0.00  0.00  1.859
+ 105 ctgatacgcgatgctagctag            477 21  0 52.38 59.113 17.46 17.46  0.00  1.887
+ 106 gctagctgactgatacgcg              468 19  0 57.89 59.086  8.21  3.89  0.00  1.914
+ 107 ctctgcgcgatcgatgctag             367 20  0 60.00 61.946 21.94 18.16 38.48  1.946
+ 108 tctgcgcgatcgatgctag              368 19  0 57.89 60.966 21.94 18.16 38.48  1.966
+ 109 ctctgcgcgatcgatgcta              367 19  0 57.89 60.966 26.61 17.10 38.48  1.966
+ 110 cgatgctagctaggcgatgc             408 20  0 60.00 61.968 11.09  0.00  0.00  1.968
+ 111 gactgatacgcgatgctagct            475 21  0 52.38 60.975 17.69  1.35  0.00  1.975
+ 112 gctagctgactgatacgcgat            468 21  0 52.38 60.975  8.21  0.00  0.00  1.975
+ 113 tgatacgcgatgctagctag             478 20  0 50.00 57.994 17.46 17.46  0.00  2.006
+ 114 ctgatacgcgatgctagcta             477 20  0 50.00 57.994 17.69  3.08  0.00  2.006
+ 115 cgcgatcgatgctagctagc             372 20  0 60.00 62.011 34.89 34.89 43.67  2.011
+ 116 gcgcgatcgatgctagctag             371 20  0 60.00 62.011 21.66 17.46 38.48  2.011
+ 117 ctgatcgatcgatgctagct             399 20  0 50.00 57.983 19.70  2.01 35.21  2.017
+ 118 agctgatcgatcgatgctag             397 20  0 50.00 57.983 27.33 18.05 34.69  2.017
+ 119 ctagctgatcgatcgatgct             395 20  0 50.00 57.983 33.87 33.38 38.16  2.017
+ 120 agctagctgatcgatcgatg             393 20  0 50.00 57.983 21.99 11.03 35.21  2.017
+ 121 ctgatcgatcgatgctagct             118 20  0 50.00 57.983 19.70  2.01 35.21  2.017
+ 122 agctagctgatcgatcgatg              73 20  0 50.00 57.983 21.99 11.03 35.21  2.017
+ 123 catcggattagctagctgatgc             5 22  0 50.00 59.982 24.41 24.41 40.05  2.018
+ 124 gcatcggattagctagctgatg             4 22  0 50.00 59.982 27.81 27.81 33.28  2.018
+ 125 tcgatgctagctaggcgat              407 19  0 52.63 58.964 14.03  3.01  0.00  2.036
+ 126 atcgatgctagctaggcga              406 19  0 52.63 58.964 16.30 16.30  0.00  2.036
+ 127 actatcatctctgcgcgatcg            359 21  0 52.38 61.037 12.19 12.19 39.07  2.037
+ 128 gcgcgatcgatgctagcta              371 19  0 57.89 61.037 21.66  3.08 38.48  2.037
+ 129 gctgatcgatcgatgctagct            398 21  0 52.38 61.044 27.88 12.70 35.21  2.044
+ 130 agctgatcgatcgatgctagc            397 21  0 52.38 61.044 27.33 27.90 34.69  2.044
+ 131 gctagctgatcgatcgatgct            394 21  0 52.38 61.044 33.87 33.38 38.16  2.044
+ 132 agctagctgatcgatcgatgc            393 21  0 52.38 61.044 24.08 21.09 35.21  2.044
+ 133 cgcgatcgatgctagctag              372 19  0 57.89 58.947 22.07 17.46 38.48  2.053
+ 134 tcgtagcggcgatctagc               576 18  0 61.11 59.936  4.70  0.00 36.40  2.064
+ 135 cgtagcggcgatctagct               577 18  0 61.11 59.935 11.03 11.03 37.58  2.065
+ 136 gcggcgatctagctagct               581 18  0 61.11 59.933 23.74 23.74 38.05  2.067
+ 137 agcggcgatctagctagc               580 18  0 61.11 59.933 16.97  7.15 39.86  2.067
+ 138 ctagctgactgatacgcgat             469 20  0 50.00 57.918  1.43  0.00  0.00  2.082
+ 139 ctagctgatcgatcgtagcgg            564 21  0 57.14 61.096 20.31 16.15  0.00  2.096
+ 140 agctactatcatctctgcgc             355 20  0 50.00 57.898  0.00  0.00  0.00  2.102
+ 141 gctagctactgatcgatgct             304 20  0 50.00 57.898 11.51 11.51  0.00  2.102
+ 142 agctagctactgatcgatgc             303 20  0 50.00 57.898 17.56  1.76  0.00  2.102
+ 143 agcatcggattagctagctgat             3 22  0 45.45 60.108 17.84 15.13  0.00  2.108
+ 144 tgctagctaggcgatgcta              411 19  0 52.63 58.881 17.69  8.91  0.00  2.119
+ 145 aagcatcggattagctagctg              2 21  0 47.62 58.879 28.29 10.80  0.00  2.121
+ 146 tctgcgcgatcgatgcta               368 18  0 55.56 59.857 26.61 16.13 38.48  2.143
+ 147 cgatgctagctaggcgatg              408 19  0 57.89 58.856 11.09  0.00  0.00  2.144
+ 148 agctagctgatcatcgatgcta           190 22  0 45.45 59.845 17.99 13.09  0.00  2.155
+ 149 tagctagctgatcatcgatgct           189 22  0 45.45 59.845 16.29 15.30  0.00  2.155
+ 150 atcgatcgatgtgcggct                82 18  0 55.56 60.166 29.65  4.36 41.65  2.166
+ 151 gctagctgactgatcgatca             261 20  0 50.00 57.829 26.99 26.99 35.44  2.171
+ 152 tagctagctgactgatcgatcg           107 22  0 50.00 60.174 28.29 13.89  0.00  2.174
+ 153 agctgatcatcatcgatgct             515 20  0 45.00 57.788 11.25  0.72 40.32  2.212
+ 154 agctagctgactgatcgatcat           260 22  0 45.45 59.778 26.67 18.02 36.62  2.222
+ 155 tgactgatacgcgatgctagc            474 21  0 52.38 61.238  8.61  8.61  0.00  2.238
+ 156 gctgactgatacgcgatgcta            472 21  0 52.38 61.238  2.33  0.00  0.00  2.238
+ 157 tagctgactgatacgcgatgc            470 21  0 52.38 61.238  3.47  0.00  0.00  2.238
+ 158 tagctagctgatcgatcgtagc           561 22  0 50.00 60.238 26.87 26.87  0.00  2.238
+ 159 gctagctagctgatcgatcgta           559 22  0 50.00 60.238 34.38  3.07 46.11  2.238
+ 160 tgatcgatcgatgctagctagg           400 22  0 50.00 60.239 26.44  6.29 35.21  2.239
+ 161 gctgactgatcgatcgatgct            113 21  0 52.38 61.244 26.44 12.40 35.21  2.244
+ 162 agctgactgatcgatcgatgc            112 21  0 52.38 61.244 24.08 19.43 35.21  2.244
+ 163 gatcgatcgatgtgcggct               81 19  0 57.89 61.263 19.16  0.00 41.65  2.263
+ 164 gctgatcatcgatgctactagc           195 22  0 50.00 59.727 18.08 16.44 45.61  2.273
+ 165 gctagctgatcatcgatgctac           191 22  0 50.00 59.727  9.57  5.47  0.00  2.273
+ 166 gatcgatcgatgtgcggc                81 18  0 61.11 59.714 18.10  0.95 41.65  2.286
+ 167 ctagctagctgactgatacgc            465 21  0 52.38 58.703 14.90  0.00  0.00  2.297
+ 168 tagctgatcgatcgatgtgcg             76 21  0 52.38 61.299 31.92 20.26 42.69  2.299
+ 169 agctgatcgatcgatgtgc               77 19  0 52.63 58.698 31.83 30.04 35.21  2.302
+ 170 gctgatcatcatcgatgctagc           516 22  0 50.00 60.302 10.80 10.34 40.32  2.302
+ 171 gctagctgatcatcatcgatgc           512 22  0 50.00 60.302 21.42  7.40 40.32  2.302
+ 172 aagcatcggattagctagctga             2 22  0 45.45 60.306 28.29 20.88  0.00  2.306
+ 173 gatcgatcgtagcggcga               570 18  0 61.11 60.318 13.01  8.51 45.59  2.318
+ 174 atcggattagctagctgatgc              6 21  0 47.62 58.673 17.46 17.46 40.05  2.327
+ 175 gcatcggattagctagctgat              4 21  0 47.62 58.673 17.84 15.13  0.00  2.327
+ 176 gcggcgatctagctagctg              581 19  0 63.16 61.329 17.07  8.17 38.05  2.329
+ 177 tgctagtgatgcatgctagt              24 20  0 45.00 57.636 24.96 11.17 35.89  2.364
+ 178 ctactatcatctctgcgcga             357 20  0 50.00 57.636  2.71  2.71  0.00  2.364
+ 179 actagctagctgactgatacgc           464 22  0 50.00 60.368 21.52  0.00  0.00  2.368
+ 180 gctagctagctgatcatcga             187 20  0 50.00 57.613 34.38  0.24 46.11  2.387
+ 181 tctctgcgcgatcgatgcta             366 20  0 55.00 62.413 26.61 17.10 38.48  2.413
+ 182 tgatcgatcgatgctagctagt           119 22  0 45.45 59.586 26.44  5.69 35.21  2.414
+ 183 actgatcgatcgatgctagcta           117 22  0 45.45 59.586 23.29  7.65 35.21  2.414
+ 184 tagctagctgatcgatcgatgt            72 22  0 45.45 59.586 14.29  2.62 35.21  2.414
+ 185 agctaggcgatgctagcta              415 19  0 52.63 58.572 17.69  3.08 41.54  2.428
+ 186 tagctaggcgatgctagct              414 19  0 52.63 58.572 17.35 17.35 43.53  2.428
+ 187 gatcgatcgatgctagctagg            401 21  0 52.38 58.567 23.89  6.29 35.21  2.433
+ 188 gctagctagctgactgatcgat           105 22  0 50.00 60.434 34.38  0.00 46.11  2.434
+ 189 gatcgatgctagctaggcg              405 19  0 57.89 58.563 15.59  9.02  0.00  2.437
+ 190 cgatcgatgctagctaggc              404 19  0 57.89 58.563 14.87  8.45  0.00  2.437
+ 191 tagctagctgactgatacgc             466 20  0 50.00 57.549 28.29  0.00  0.00  2.451
+ 192 agctagctgactgatcgatc             260 20  0 50.00 57.536 19.32 19.32  0.00  2.464
+ 193 agctagctgactgatcgatc             108 20  0 50.00 57.536 19.32 19.32  0.00  2.464
+ 194 aaagcatcggattagctagctg             1 22  0 45.45 59.524 28.29 10.80  0.00  2.476
+ 195 gctgactgatcgatcatcatgc           265 22  0 50.00 60.493 25.66 25.12 41.77  2.493
+ 196 tagctactatcatctctgcgcg           354 22  0 50.00 60.495  0.00  0.00  0.00  2.495
+ 197 ctgatcgatcgatgtgcggc              79 20  0 60.00 62.497 15.54  4.15 41.65  2.497
+ 198 gctgatcgatcgatgtgcgg              78 20  0 60.00 62.497 29.87 22.23 41.65  2.497
+ 199 tcgtagcggcgatctagct              576 19  0 57.89 61.503 11.03 11.03 36.40  2.503
+ 200 agcggcgatctagctagct              580 19  0 57.89 61.519 23.74 23.74 42.96  2.519
+ 201 ctagctagctgatcatcgatgc           188 22  0 50.00 59.470 21.42  9.22  0.00  2.530
+ 202 gctagctagctgatcatcgatg           187 22  0 50.00 59.470 34.38 20.23 46.11  2.530
+ 203 tcatctctgcgcgatcga               363 18  0 55.56 59.468 22.07  0.00 38.48  2.532
+ 204 tcgatcgatgtgcggcta                83 18  0 55.56 59.465 18.63  0.00 41.65  2.535
+ 205 tgatcgatcgatgtgcggc               80 19  0 57.89 61.549 21.27  8.44 41.65  2.549
+ 206 ctagctaggcgatgctagctag           413 22  0 54.55 60.561 22.99 22.99 46.84  2.561
+ 207 gctagctagctgatcgatcgat           390 22  0 50.00 60.561 34.38 30.53 46.11  2.561
+ 208 gctagctagctgatcgatcgat            70 22  0 50.00 60.561 34.38 30.53 46.11  2.561
+ 209 ctgcgcgatcgatgctag               369 18  0 61.11 59.415 19.79 13.97 38.48  2.585
+ 210 aagcatcggattagctagct               2 20  0 45.00 57.413 23.74 23.74  0.00  2.587
+ 211 gctagctgatcatcgatgcta            191 21  0 47.62 58.410 16.61 13.09  0.00  2.590
+ 212 tagctagctgatcatcgatgc            189 21  0 47.62 58.410 21.42  9.22  0.00  2.590
+ 213 actgatacgcgatgctagc              476 19  0 52.63 58.407  8.61  8.61  0.00  2.593
+ 214 gctagctgactgatcgatcatc           261 22  0 50.00 59.406 23.93 21.92 36.62  2.594
+ 215 atcgatcgatgctagctagg             402 20  0 50.00 57.396 29.65  6.29 33.56  2.604
+ 216 atctctgcgcgatcgatgc              365 19  0 57.89 61.618 22.01 22.01 38.48  2.618
+ 217 tgatcgatcgtagcggcg               569 18  0 61.11 60.621 20.58  0.86  0.00  2.621
+ 218 atcatctctgcgcgatcgatg            362 21  0 52.38 61.633 18.01 18.01 38.48  2.633
+ 219 agctagctgatcgatcgtag             562 20  0 50.00 57.344 17.99 16.86  0.00  2.656
+ 220 ctagctagctgatcgatcgt             560 20  0 50.00 57.344 16.40  2.65  0.00  2.656
+ 221 gctagctgactgatcgatcat            261 21  0 47.62 58.339 26.67 18.02 36.62  2.661
+ 222 ctgatcgatcgtagcggcg              568 19  0 63.16 61.664 14.21  0.86  0.00  2.664
+ 223 ctgactgatacgcgatgct              473 19  0 52.63 58.330  2.33  0.00  0.00  2.670
+ 224 agctgactgatacgcgatg              471 19  0 52.63 58.330  0.00  0.00  0.00  2.670
+ 225 gctagctgatcgatcgtagcg            563 21  0 57.14 61.676 24.18 16.49  0.00  2.676
+ 226 ctagctgactgatcgatcga             110 20  0 50.00 57.276 22.52 22.52  0.00  2.724
+ 227 agctagctactgatcgatgcta           303 22  0 45.45 59.252 17.56 12.23  0.00  2.748
+ 228 tagctagctactgatcgatgct           302 22  0 45.45 59.252 27.80 11.51  0.00  2.748
+ 229 gactgatacgcgatgctagcta           475 22  0 50.00 60.751 17.69  3.08  0.00  2.751
+ 230 actgatacgcgatgctagctag           476 22  0 50.00 60.752 17.46 17.46  0.00  2.752
+ 231 gactgatcgatcgatgctagct           116 22  0 50.00 60.753 18.04  9.56 35.21  2.753
+ 232 gctagctgactgatcgatcgat           109 22  0 50.00 60.753 30.53 30.53 37.90  2.753
+ 233 tgcgcgatcgatgctagcta             370 20  0 55.00 62.756 26.61  9.85 38.48  2.756
+ 234 gcggcgatctagctagctga             581 20  0 60.00 62.765 21.57 16.66 38.70  2.765
+ 235 agcggcgatctagctagctg             580 20  0 60.00 62.771 17.07  8.17 44.87  2.771
+ 236 ctactatcatctctgcgcgatc           357 22  0 50.00 59.220  4.99  0.00  0.00  2.780
+ 237 tatcatctctgcgcgatcg              361 19  0 52.63 58.199 12.19 12.19 39.07  2.801
+ 238 tactatcatctctgcgcgatcg           358 22  0 50.00 60.811 12.19 12.19 39.07  2.811
+ 239 tagctagctgactgatcgatca           259 22  0 45.45 59.187 28.29 26.99 35.44  2.813
+ 240 gctgatcgatcgatgctagcta           398 22  0 50.00 60.816 27.88 12.57 35.21  2.816
+ 241 tagctgatcgatcgatgctagc           396 22  0 50.00 60.816 30.84 27.90 36.80  2.816
+ 242 gctagctgatcgatcgatgcta           394 22  0 50.00 60.816 34.11 32.56 36.80  2.816
+ 243 tagctagctgatcgatcgatgc           392 22  0 50.00 60.816 24.08 21.09 35.21  2.816
+ 244 gctaggcgatgctagctag              416 19  0 57.89 58.179 17.46 17.46 35.42  2.821
+ 245 ctagctaggcgatgctagc              413 19  0 57.89 58.179 18.68  9.44 36.95  2.821
+ 246 gctagctaggcgatgctag              412 19  0 57.89 58.179 23.16 23.16 38.59  2.821
+ 247 catctctgcgcgatcgatgc             364 20  0 60.00 62.823 22.01 22.01 38.48  2.823
+ 248 aaagcatcggattagctagct              1 21  0 42.86 58.168 23.74 23.74  0.00  2.832
+ 249 ctgactgatcgatcgatgctag           114 22  0 50.00 59.155 22.81 19.44 35.21  2.845
+ 250 ctagctgactgatcgatcgatg           110 22  0 50.00 59.155 23.05 13.21 35.21  2.845
+ 251 tactatcatctctgcgcgatc            358 21  0 47.62 58.155  4.99  0.00  0.00  2.845
+ 252 gctagctactgatcgatgctac           304 22  0 50.00 59.151  8.57  4.26  0.00  2.849
+ 253 ctactatcatctctgcgcgat            357 21  0 47.62 58.150  4.99  2.52  0.00  2.850
+ 254 agctgatcatcgatgctact             194 20  0 45.00 57.134 17.14  8.95  0.00  2.866
+ 255 gctagctagctgatcatcgat            187 21  0 47.62 58.132 34.38  0.00 46.11  2.868
+ 256 ctgatacgcgatgctagct              477 19  0 52.63 58.107 17.69  1.35  0.00  2.893
+ 257 ggcgatctagctagctgac              583 19  0 57.89 58.106 14.84  7.25 37.58  2.894
+ 258 tgactgatcgatcgatgctag            115 21  0 47.62 58.084 22.81 19.44 35.21  2.916
+ 259 ctgactgatcgatcgatgcta            114 21  0 47.62 58.084 26.44 14.64 35.21  2.916
+ 260 tagctgactgatcgatcgatg            111 21  0 47.62 58.084 23.05 13.21 35.21  2.916
+ 261 actgatcgatcatcatgctagc           269 22  0 45.45 59.071 26.67  8.61 41.77  2.929
+ 262 agctgactgatcgatcatca             264 20  0 45.00 57.064 26.49 26.49 39.98  2.936
+ 263 ctagctagctgatcgatcga             391 20  0 50.00 57.060 22.52 22.52  0.00  2.940
+ 264 ctagctagctgatcgatcga              71 20  0 50.00 57.060 22.52 22.52  0.00  2.940
+ 265 gatcgatcgatgtgcggctag             81 21  0 57.14 61.947 19.16  0.00 41.65  2.947
+ 266 tgctagctaggcgatgct               411 18  0 55.56 59.050 17.69  7.53  0.00  2.950
+ 267 gctgatcgatcgtagcggc              567 19  0 63.16 61.960 20.49 19.38  0.00  2.960
+ 268 cgatcgatgtgcggctag                84 18  0 61.11 59.032 10.82  0.00 41.65  2.968
+ 269 tgatcgatcgatgtgcggct              80 20  0 55.00 62.987 22.21  0.00 41.65  2.987
+ 270 ctgactgatcgatcatcatgct           266 22  0 45.45 59.004 20.99  6.82 41.77  2.996
+ 271 agctgactgatcgatcatcatg           264 22  0 45.45 59.004 22.70 19.51 41.77  2.996
+ 272 agctagctgactgatacgcga            467 21  0 52.38 62.000 17.99  0.00  0.00  3.000
+ 273 tgactgatcgatcgatgctagc           115 22  0 50.00 61.008 18.17 12.52 35.21  3.008
+ 274 gctgactgatcgatcgatgcta           113 22  0 50.00 61.008 26.44 14.64 35.21  3.008
+ 275 tagctgactgatcgatcgatgc           111 22  0 50.00 61.008 24.08 19.43 35.21  3.008
+ 276 agctagctgatcgatcgatgtg            73 22  0 50.00 61.010 17.99  6.93 35.21  3.010
+ 277 ctgatcgatcgatgctagctag           399 22  0 50.00 58.963 19.70 17.46 35.21  3.037
+ 278 ctagctgatcgatcgatgctag           395 22  0 50.00 58.963 37.86 37.86 43.17  3.037
+ 279 ctagctagctgatcgatcgatg           391 22  0 50.00 58.963 21.99 11.03 35.21  3.037
+ 280 ctgatcgatcgatgctagctag           118 22  0 50.00 58.963 19.70 17.46 35.21  3.037
+ 281 ctagctagctgatcgatcgatg            71 22  0 50.00 58.963 21.99 11.03 35.21  3.037
+ 282 gactgatcgatcatcatgctagc          268 23  0 47.83 60.053 24.51  9.03 41.77  3.053
+ 283 gctagtgatgcatgctagtagtg           25 23  0 47.83 59.929 24.96 10.54  0.00  3.071
+ 284 gctactatcatctctgcgcgat           356 22  0 50.00 61.073  4.99  2.52  0.00  3.073
+ 285 gtagcggcgatctagctag              578 19  0 57.89 57.903 15.64 15.64 37.58  3.097
+ 286 tgactgatcgatcatcatgct            267 21  0 42.86 57.900 26.79 12.28 41.77  3.100
+ 287 ctagctactatcatctctgcgc           353 22  0 50.00 58.892  0.00  0.00  0.00  3.108
+ 288 gctagctactatcatctctgcg           352 22  0 50.00 58.892  8.21  0.00  0.00  3.108
+ 289 ctagctagctactgatcgatgc           301 22  0 50.00 58.892 14.00  1.76  0.00  3.108
+ 290 gctagctagctactgatcgatg           300 22  0 50.00 58.892 34.38  7.78 46.11  3.108
+ 291 catcgatcgatgctagtatgct           325 22  0 45.45 58.885 37.80 10.02 44.93  3.115
+ 292 tgatcgatcgatgctagctag            400 21  0 47.62 57.879 26.44 17.46 35.21  3.121
+ 293 ctgatcgatcgatgctagcta            399 21  0 47.62 57.879 19.70  3.77 35.21  3.121
+ 294 tagctgatcgatcgatgctag            396 21  0 47.62 57.879 34.03 27.12 36.80  3.121
+ 295 ctagctgatcgatcgatgcta            395 21  0 47.62 57.879 34.11 32.56 36.80  3.121
+ 296 tagctagctgatcgatcgatg            392 21  0 47.62 57.879 21.99 11.03 35.21  3.121
+ 297 tgatcgatcgatgctagctag            119 21  0 47.62 57.879 26.44 17.46 35.21  3.121
+ 298 ctgatcgatcgatgctagcta            118 21  0 47.62 57.879 19.70  3.77 35.21  3.121
+ 299 tagctagctgatcgatcgatg             72 21  0 47.62 57.879 21.99 11.03 35.21  3.121
+ 300 gatcgatcgatgctagctagt            120 21  0 47.62 57.878 23.89  3.56 35.21  3.122
+ 301 ctatcatctctgcgcgatcgat           360 22  0 50.00 61.132 22.07 11.47 38.48  3.132
+ 302 tgatcgatcgtagcggcga              569 19  0 57.89 62.144 20.58  8.51 45.59  3.144
+ 303 tcgtagcggcgatctagctag            576 21  0 57.14 62.173 15.64 15.64 36.40  3.173
+ 304 tactagctagctgactgatacgc          463 23  0 47.83 60.176 13.17  0.00  0.00  3.176
+ 305 ctgatcatcatcgatgctagct           517 22  0 45.45 58.807 17.69  1.76 40.32  3.193
+ 306 agctgatcatcatcgatgctag           515 22  0 45.45 58.807  5.93  2.76 40.32  3.193
+ 307 ctagctgatcatcatcgatgct           513 22  0 45.45 58.807 14.14  8.34 40.32  3.193
+ 308 agctagctgatcatcatcgatg           511 22  0 45.45 58.807 20.23 20.23 41.48  3.193
+ 309 ctgatcgatcatcatgctagct           270 22  0 45.45 58.807 26.67  0.00 41.77  3.193
+ 310 ctagctgactgatcgatcgat            110 21  0 47.62 57.806 30.53 30.53 37.90  3.194
+ 311 ttagctagctgactgatcgatca          258 23  0 43.48 59.798 28.29 26.99 35.44  3.202
+ 312 tagctactatcatctctgcgc            354 21  0 47.62 57.798  0.00  0.00  0.00  3.202
+ 313 gctagctactgatcgatgcta            304 21  0 47.62 57.798 12.99 12.23  0.00  3.202
+ 314 tagctagctactgatcgatgc            302 21  0 47.62 57.798 27.80  1.76  0.00  3.202
+ 315 tctctgcgcgatcgatgc               366 18  0 61.11 61.229 22.01 22.01 38.48  3.229
+ 316 ctctgcgcgatcgatgct               367 18  0 61.11 61.232 26.61  0.00 38.48  3.232
+ 317 agctagctactatcatctctgcg          351 23  0 47.83 60.238 17.56  0.00  0.00  3.238
+ 318 ctagctagctactgatcgatgct          301 23  0 47.83 60.238 14.00 11.51  0.00  3.238
+ 319 ctgatcgatcgtagcggc               568 18  0 61.11 58.727 14.21  0.00  0.00  3.273
+ 320 gctgatcgatcgtagcgg               567 18  0 61.11 58.727 20.49 15.03  0.00  3.273
+ 321 agctaggcgatgctagct               415 18  0 55.56 58.725 17.69 13.00 39.84  3.275
+ 322 tgctagtgatgcatgctagtagt           24 23  0 43.48 60.302 24.96 12.98 35.89  3.302
+ 323 gcgcgatcgatgctagct               371 18  0 61.11 61.306 21.66  1.35 38.48  3.306
+ 324 tgatcatcatcgatgctagct            518 21  0 42.86 57.691 17.69  1.76 40.32  3.309
+ 325 agctgatcatcatcgatgcta            515 21  0 42.86 57.691  0.24  0.00 40.32  3.309
+ 326 tagctgatcatcatcgatgct            514 21  0 42.86 57.691 14.14  8.34 40.32  3.309
+ 327 tgatcgatcatcatgctagct            271 21  0 42.86 57.691 27.48  0.00 37.38  3.309
+ 328 ctagctagctgactgatacgcg           465 22  0 54.55 61.313 14.90  3.89  0.00  3.313
+ 329 tgctagtgatgcatgctagtag            24 22  0 45.45 58.673 24.96 19.76 35.89  3.327
+ 330 gctagtgatgcatgctagtagt            25 22  0 45.45 58.672 24.96 12.98  0.00  3.328
+ 331 tagctagctgatcatcgatgcta          189 23  0 43.48 59.671 17.82 15.89  0.00  3.329
+ 332 agctagctgactgatacgc              467 19  0 52.63 57.642 17.99  0.00  0.00  3.358
+ 333 tatcatctctgcgcgatcgatg           361 22  0 50.00 61.383 18.01 18.01 38.48  3.383
+ 334 agctgactgatcgatcatcat            264 21  0 42.86 57.616 26.31 18.90 41.77  3.384
+ 335 actagctagctgatcatcatcga          508 23  0 43.48 59.607 22.43  0.00  0.00  3.393
+ 336 tagctagctgactgatcgatcat          259 23  0 43.48 59.607 28.29 18.02 36.62  3.393
+ 337 gatgctagctaggcgatgctag           409 22  0 54.55 61.393 23.16 23.16 38.59  3.393
+ 338 cggcgatctagctagctgact            582 21  0 57.14 62.394 17.44  7.44 38.70  3.394
+ 339 ctagctagctgatcgatcgat            391 21  0 47.62 57.600 30.53 30.53 37.90  3.400
+ 340 ctagctagctgatcgatcgat             71 21  0 47.62 57.600 30.53 30.53 37.90  3.400
+ 341 actgatcgatcatcatgctagct          269 23  0 43.48 60.428 26.67  4.70 41.77  3.428
+ 342 ctagctagctgactgatcgatc           106 22  0 50.00 58.567 19.32 19.32  0.00  3.433
+ 343 ctgactgatcgatcatcatgc            266 21  0 47.62 57.562 20.99 12.19 41.77  3.438
+ 344 gctgactgatcgatcatcatg            265 21  0 47.62 57.562 22.70 19.51 41.77  3.438
+ 345 gatcgatcgatgctagctaggc           401 22  0 54.55 61.448 23.89  8.45 35.21  3.448
+ 346 gtgatgcatgctagtagtgatgt           29 23  0 43.48 59.551 11.60  0.00  0.00  3.449
+ 347 tgctagtgatgcatgctagta             24 21  0 42.86 57.546 24.96 21.25 35.89  3.454
+ 348 tagcggcgatctagctagctg            579 21  0 57.14 62.457 18.98  9.30 45.57  3.457
+ 349 gtagcggcgatctagctagct            578 21  0 57.14 62.458 23.74 23.74 46.60  3.458
+ 350 tagctgatcgatcgtagcg              565 19  0 52.63 57.539 25.02 11.96  0.00  3.461
+ 351 gctagctagctactgatcgat            300 21  0 47.62 57.517 34.38  0.00 46.11  3.483
+ 352 agctagctactgatcgatgctac          303 23  0 47.83 60.487 17.56  7.81  0.00  3.487
+ 353 atcgatcgatgctagtatgct            326 21  0 42.86 57.502 29.65  2.17 33.56  3.498
+ 354 agctactgatcgatgctacatc           307 22  0 45.45 58.484  7.41  0.00 37.97  3.516
+ 355 agtgatgcatgctagtagtga             28 21  0 42.86 57.471  0.00  0.00  0.00  3.529
+ 356 gactgatcgatcgatgctagcta          116 23  0 47.83 60.546 18.04  4.19 35.21  3.546
+ 357 ctgatcgatcgatgctagctagt          118 23  0 47.83 60.547 22.18  3.56 35.21  3.547
+ 358 actgatcgatcgatgctagctag          117 23  0 47.83 60.547 23.29 17.46 35.21  3.547
+ 359 ctagctagctgatcgatcgatgt           71 23  0 47.83 60.547 14.29  2.62 35.21  3.547
+ 360 catcgatcgatgctagtatgc            325 21  0 47.62 57.452 37.80  0.00 44.93  3.548
+ 361 tagctagctgactgatcgatc            259 21  0 47.62 57.451 28.29 19.32  0.00  3.549
+ 362 tagctagctgactgatcgatc            107 21  0 47.62 57.451 28.29 19.32  0.00  3.549
+ 363 ctagctagctgactgatcgat            106 21  0 47.62 57.445 14.90  0.00  0.00  3.555
+ 364 tcgatgctagctaggcga               407 18  0 55.56 58.427 15.59 13.52  0.00  3.573
+ 365 tgatcgatcgatgctagctagta          119 23  0 43.48 59.424 26.44 18.77 35.21  3.576
+ 366 ctgcgcgatcgatgctagc              369 19  0 63.16 62.586 20.26 12.12 38.48  3.586
+ 367 agctagctgatcatcatcgat            511 21  0 42.86 57.405 17.99  0.00  0.00  3.595
+ 368 tgcgcgatcgatgctagc               370 18  0 61.11 61.605 26.61 17.77 38.48  3.605
+ 369 ctagctagctgatcgatcgtag           560 22  0 50.00 58.387 16.86 16.86  0.00  3.613
+ 370 actagctagctgactgatacg            464 21  0 47.62 57.384 21.52  2.77  0.00  3.616
+ 371 ctagctgactgatacgcga              469 19  0 52.63 57.370 16.29  0.00  0.00  3.630
+ 372 gctactagctagctgactgat            461 21  0 47.62 57.360 15.96  3.00 44.92  3.640
+ 373 ctgatcatcatcgatgctagc            517 21  0 47.62 57.358  8.61  8.61 40.32  3.642
+ 374 gctgatcatcatcgatgctag            516 21  0 47.62 57.358  5.93  2.76 40.32  3.642
+ 375 ctagctgatcatcatcgatgc            513 21  0 47.62 57.358 21.42  7.40 40.32  3.642
+ 376 gctagctgatcatcatcgatg            512 21  0 47.62 57.358 20.23 20.23 41.48  3.642
+ 377 ctgatcgatcatcatgctagc            270 21  0 47.62 57.358 26.67  8.61 41.77  3.642
+ 378 agctactgatcgatgctacat            307 21  0 42.86 57.344  7.41  0.00  0.00  3.656
+ 379 tgatcgatcgatgtgcggcta             80 21  0 52.38 62.663 22.21  0.24 41.65  3.663
+ 380 atctctgcgcgatcgatg               365 18  0 55.56 58.327 12.03  4.19 38.48  3.673
+ 381 catctctgcgcgatcgat               364 18  0 55.56 58.327 22.07  1.26 38.48  3.673
+ 382 atcatctctgcgcgatcg               362 18  0 55.56 58.327 12.19 12.19 39.07  3.673
+ 383 aagcatcggattagctagctgat            2 23  0 43.48 60.682 17.84 15.13  0.00  3.682
+ 384 agtgatgcatgctagtagtgatg           28 23  0 43.48 59.299  7.49  7.49  0.00  3.701
+ 385 gatcgatgctagctaggcgatg           405 22  0 54.55 61.702 24.26  6.24  0.00  3.702
+ 386 atctctgcgcgatcgatgcta            365 21  0 52.38 62.723 26.61 17.10 38.48  3.723
+ 387 tagctagctgactgatacgcga           466 22  0 50.00 61.730 28.29  0.00  0.00  3.730
+ 388 tagctagctgatcgatcgtag            561 21  0 47.62 57.269 16.86 16.86  0.00  3.731
+ 389 ctagctagctgatcgatcgta            560 21  0 47.62 57.269 11.68  3.07  0.00  3.731
+ 390 tcgatcgatgctagctagtag            122 21  0 47.62 57.269 18.63  2.63  0.00  3.731
+ 391 gctagctactgatcgatgctaca          304 23  0 47.83 60.734 11.21  0.06  0.00  3.734
+ 392 agctagctgactgatcgatcatc          260 23  0 47.83 60.736 23.93 21.92 36.62  3.736
+ 393 agctagctgactgatcgatcga           108 22  0 50.00 61.737 22.52 22.52  0.00  3.737
+ 394 tctctgcgcgatcgatgct              366 19  0 57.89 62.740 26.61  0.00 38.48  3.740
+ 395 tgatgcatgctagtagtgatgt            30 22  0 40.91 58.256 11.60  0.00  0.00  3.744
+ 396 tgatcgatcgatgtgcgg                80 18  0 55.56 58.244 21.27  0.00 41.65  3.756
+ 397 cgatcgatgctagctaggcga            404 21  0 57.14 62.770 16.30 16.30  0.00  3.770
+ 398 tcgatcgatgctagctaggcg            403 21  0 57.14 62.770 18.63 11.67  0.00  3.770
+ 399 atcgatcgatgcatgcatg              443 19  0 47.37 57.226 29.65 23.31 37.30  3.774
+ 400 catcgatcgatgcatgcat              442 19  0 47.37 57.226 37.80 33.45 44.93  3.774
+ 401 actagctagctgatcatcatcg           508 22  0 45.45 58.219 22.43  3.40  0.00  3.781
+ 402 ctgatcatcgatgctactagct           196 22  0 45.45 58.219 10.86  0.00 45.92  3.781
+ 403 agctgatcatcgatgctactag           194 22  0 45.45 58.219 13.67  9.68  0.00  3.781
+ 404 ctagctgatcatcgatgctact           192 22  0 45.45 58.219 14.85  7.80  0.00  3.781
+ 405 tttagctagctgactgatcga            257 21  0 42.86 57.216  0.38  0.00  0.00  3.784
+ 406 tagctagctgatcgatcgatgtg           72 23  0 47.83 60.793 10.14  4.94 35.21  3.793
+ 407 gctagctagctgatcatcatct           146 22  0 45.45 58.203 34.38  0.00 46.11  3.797
+ 408 ctagctagctgatcatcgatgct          188 23  0 47.83 60.799 16.29 15.30  0.00  3.799
+ 409 agctagctactatcatcgatcga          429 23  0 43.48 59.170 22.52 22.52  0.00  3.830
+ 410 ttagctagctgactgatcgatc           258 22  0 45.45 58.159 28.29 19.32  0.00  3.841
+ 411 ctagctgactgatcgatcatca           262 22  0 45.45 58.155 26.49 26.49 39.98  3.845
+ 412 aaagcatcggattagctagctga            1 23  0 43.48 60.870 28.29 20.88  0.00  3.870
+ 413 agctgactgatacgcgatgct            471 21  0 52.38 62.876  7.57  2.13  0.00  3.876
+ 414 tagctagctactgatcgatgcta          302 23  0 43.48 59.102 27.80 12.23  0.00  3.898
+ 415 tcatcatcgatgctagctagt            521 21  0 42.86 57.067 22.18  3.56 40.32  3.933
+ 416 tcgatcatcatgctagctact            274 21  0 42.86 57.067  0.00  0.00  0.00  3.933
+ 417 tgatcatcgatgctactagct            197 21  0 42.86 57.067 17.14  0.00 45.92  3.933
+ 418 agctgatcatcgatgctacta            194 21  0 42.86 57.067 17.14  4.89  0.00  3.933
+ 419 tagctgatcatcgatgctact            193 21  0 42.86 57.067 14.85  7.80  0.00  3.933
+ 420 tcgatcgatgctagtatgctag           327 22  0 45.45 58.044 18.63 13.77 46.09  3.956
+ 421 gcgatctagctagctgact              584 19  0 52.63 57.034 17.44  7.44  0.00  3.966
+ 422 gctactgatcgatgctacatc            308 21  0 47.62 57.028  2.44  0.00 37.97  3.972
+ 423 cggcgatctagctagctg               582 18  0 61.11 58.018 17.07  8.17 37.58  3.982
+ 424 gctagctgactgatcgatcatca          261 23  0 47.83 60.983 26.49 26.49 39.98  3.983
+ 425 actatcatctctgcgcgat              359 19  0 47.37 57.015  4.99  2.52  0.00  3.985
+ 426 catcggattagctagctgatg              5 21  0 47.62 57.003 23.69 23.29  0.00  3.997
+ 427 tagctgactgatcgatcatca            263 21  0 42.86 57.000 26.49 26.49 39.98  4.000
+ 428 actagctagctgatcatcatcgat         508 24  0 41.67 59.995 22.43  0.00  0.00  4.005
+ 429 agtgatgcatgctagtagtgat            28 22  0 40.91 57.984  0.00  0.00  0.00  4.016
+ 430 ctagctagctgatcatcatcga           509 22  0 45.45 57.958 11.68  0.00  0.00  4.042
+ 431 gctgatcatcgatgctactagct          195 23  0 47.83 61.046 20.91  5.24 45.92  4.046
+ 432 agctgatcatcgatgctactagc          194 23  0 47.83 61.046 20.78 20.78 45.61  4.046
+ 433 gctagctgatcatcgatgctact          191 23  0 47.83 61.046 12.59  8.92  0.00  4.046
+ 434 agctagctgatcatcgatgctac          190 23  0 47.83 61.046 17.99  7.99  0.00  4.046
+ 435 tagctagctactatcatctctgcg         350 24  0 45.83 60.058 27.80  0.00  0.00  4.058
+ 436 ctagctagctactgatcgatgcta         301 24  0 45.83 60.058 14.00 12.23  0.00  4.058
+ 437 agctactatcatctctgcgcga           355 22  0 50.00 62.058  2.71  2.71  0.00  4.058
+ 438 gctatttagctagctgactgatcg         253 24  0 45.83 60.060  7.27  0.00 46.11  4.060
+ 439 tgatcgatcatcatgctagctac          271 23  0 43.48 58.931 27.48  0.00 37.38  4.069
+ 440 gtgatgcatgctagtagtgatg            29 22  0 45.45 57.921  7.49  7.49  0.00  4.079
+ 441 ctagctagctgactgatcgatcg          106 23  0 52.17 61.091 16.84 13.89  0.00  4.091
+ 442 ctagctactgatcgatgctaca           305 22  0 45.45 57.898 13.79  1.61  0.00  4.102
+ 443 cggcgatctagctagctgacta           582 22  0 54.55 62.109 17.44  5.40 38.70  4.109
+ 444 atgctagctaggcgatgc               410 18  0 55.56 57.890 10.59  0.00  0.00  4.110
+ 445 ctgatcgatcatcatgctagctac         270 24  0 45.83 59.882 26.67  0.00 41.77  4.118
+ 446 gctactagctagctgatcatca           505 22  0 45.45 57.879 14.37  0.00 44.92  4.121
+ 447 gctactagctagctgatcatca           208 22  0 45.45 57.879 14.37  0.00 44.92  4.121
+ 448 ctgactgatacgcgatgctagc           473 22  0 54.55 62.128  8.61  8.61  0.00  4.128
+ 449 gctgactgatacgcgatgctag           472 22  0 54.55 62.128  1.70  0.00  0.00  4.128
+ 450 ctagctgactgatacgcgatgc           469 22  0 54.55 62.128  3.47  0.00  0.00  4.128
+ 451 gctagctgactgatacgcgatg           468 22  0 54.55 62.128  8.21  0.00  0.00  4.128
+ 452 tgactgatcgatcatcatgctag          267 23  0 43.48 58.866 26.79 18.40 41.77  4.134
+ 453 ctgactgatcgatcatcatgcta          266 23  0 43.48 58.866 20.99  8.89 41.77  4.134
+ 454 tagctgactgatcgatcatcatg          263 23  0 43.48 58.866 22.70 19.51 41.77  4.134
+ 455 ctagctagctgatcgatcgtagc          560 23  0 52.17 61.151 26.87 26.87  0.00  4.151
+ 456 gctagctagctgatcgatcgtag          559 23  0 52.17 61.151 34.38 16.86 46.11  4.151
+ 457 ctgatcgatcgatgctagctagg          399 23  0 52.17 61.158 22.67  6.29 35.21  4.158
+ 458 gatcgatcgatgctagctagtag          120 23  0 47.83 58.829 23.89  2.63 35.21  4.171
+ 459 ttagctagctgactgatcgatcat         258 24  0 41.67 60.177 28.29 18.02 36.62  4.177
+ 460 ctgactgatcgatcatcatgctag         266 24  0 45.83 59.822 20.99 12.80 41.77  4.178
+ 461 ctagctgactgatcgatcatcatg         262 24  0 45.83 59.822 22.70 19.51 41.77  4.178
+ 462 ctagctgatcgatcgatgtgcg            75 22  0 54.55 62.180 31.92 20.85 42.69  4.180
+ 463 tttagctagctgactgatcgatc          257 23  0 43.48 58.807 19.32 19.32  0.00  4.193
+ 464 tgactgatcgatcatcatgcta           267 22  0 40.91 57.803 26.79 13.11 41.77  4.197
+ 465 gctagctactatcatcgatcga           430 22  0 45.45 57.783 22.52 22.52  0.00  4.217
+ 466 gatcgatcgatgctagctagta           120 22  0 45.45 57.783 23.89 18.77 35.21  4.217
+ 467 agctagctactatcatcgatcg           429 22  0 45.45 57.777 17.56  9.87  0.00  4.223
+ 468 atcgatcgatgctagctagtag           121 22  0 45.45 57.777 29.65  2.63 33.56  4.223
+ 469 tgatcatcatcgatgctagctagt         518 24  0 41.67 60.238 22.18  3.56 40.32  4.238
+ 470 tgatcgatcatcatgctagctact         271 24  0 41.67 60.238 27.48  0.00 37.38  4.238
+ 471 actgatcgatcatcatgctagcta         269 24  0 41.67 60.238 26.67  2.76 41.77  4.238
+ 472 catcgatcgatgctagtatgcta          325 23  0 43.48 58.753 37.80  6.23 44.93  4.247
+ 473 tttagctagctgactgatcgat           257 22  0 40.91 57.736  0.38  0.00  0.00  4.264
+ 474 atttagctagctgactgatcga           256 22  0 40.91 57.736  4.16  0.00  0.00  4.264
+ 475 cgcgatcgatgctagcta               372 18  0 55.56 57.717 22.07  3.08 38.48  4.283
+ 476 catcgatcgatgctagtatgctag         325 24  0 45.83 59.708 37.80 16.01 44.93  4.292
+ 477 tagctagctactgatcgatgctac         302 24  0 45.83 60.297 27.80  7.81  0.00  4.297
+ 478 agcatcggattagctagctgatg            3 23  0 47.83 61.299 27.81 27.81 33.28  4.299
+ 479 agctagctgactgatacgcgat           467 22  0 50.00 62.317 17.99  0.00  0.00  4.317
+ 480 tgatcatcatcgatgctagctag          518 23  0 43.48 58.678 17.46 17.46 40.32  4.322
+ 481 ctgatcatcatcgatgctagcta          517 23  0 43.48 58.678 17.69  2.41 40.32  4.322
+ 482 tagctgatcatcatcgatgctag          514 23  0 43.48 58.678  9.90  2.76 40.32  4.322
+ 483 ctagctgatcatcatcgatgcta          513 23  0 43.48 58.678 14.58  9.63 40.32  4.322
+ 484 tagctagctgatcatcatcgatg          510 23  0 43.48 58.678 20.23 20.23 41.48  4.322
+ 485 ctgatcgatcatcatgctagcta          270 23  0 43.48 58.678 26.67  2.76 41.77  4.322
+ 486 gatcatcatcgatgctagctagt          519 23  0 43.48 58.677 22.18  3.56 40.32  4.323
+ 487 gatcgatcatcatgctagctact          272 23  0 43.48 58.677 21.11  0.00  0.00  4.323
+ 488 gctagctagctgactgatcgatc          105 23  0 52.17 61.341 34.38 19.32 46.11  4.341
+ 489 tgatcgatcgatgctagctagtag         119 24  0 45.83 60.356 26.44  2.63 35.21  4.356
+ 490 ctgatcgatcgatgctagctagta         118 24  0 45.83 60.356 22.18 18.77 35.21  4.356
+ 491 ctgatcatcatcgatgctagctag         517 24  0 45.83 59.644 17.46 17.46 40.32  4.356
+ 492 ctagctgatcatcatcgatgctag         513 24  0 45.83 59.644 19.54 18.30 42.07  4.356
+ 493 ctagctagctgatcatcatcgatg         509 24  0 45.83 59.644 20.23 20.23 41.48  4.356
+ 494 tttagctagctgactgatcgatca         257 24  0 41.67 60.358 26.99 26.99 35.44  4.358
+ 495 actatcatctctgcgcgatcga           359 22  0 50.00 62.365 22.07  1.72 38.48  4.365
+ 496 agctgatcgatcgtagcg               566 18  0 55.56 57.634 25.02 11.96  0.00  4.366
+ 497 gctactagctagctgactgatac          461 23  0 47.83 58.626 15.96  1.42 44.92  4.374
+ 498 agctgatcgatcgatgctagct           397 22  0 50.00 62.388 30.32 30.32 38.42  4.388
+ 499 agctagctgatcgatcgatgct           393 22  0 50.00 62.388 33.87 33.38 38.16  4.388
+ 500 ctagctgactgatcgatcatcat          262 23  0 43.48 58.612 26.31 20.43 41.77  4.388
+ 501 agctagctactatcatctctgc           351 22  0 45.45 57.608 17.56  0.00  0.00  4.392
+ 502 ctagctactatcatctctgcgcg          353 23  0 52.17 61.393  0.00  0.00  0.00  4.393
+ 503 tgatcatcatcgatgctagcta           518 22  0 40.91 57.602 17.69  3.08 40.32  4.398
+ 504 tagctgatcatcatcgatgcta           514 22  0 40.91 57.602 15.95  9.16 40.32  4.398
+ 505 tgatcgatcatcatgctagcta           271 22  0 40.91 57.602 27.48  3.08 37.38  4.398
+ 506 atcatcatcgatgctagctagt           520 22  0 40.91 57.595 22.18  3.56 40.32  4.405
+ 507 atcgatcatcatgctagctact           273 22  0 40.91 57.595  0.00  0.00  0.00  4.405
+ 508 agctagctactatcatcgatcgat         429 24  0 41.67 59.573 25.37 25.37 35.13  4.427
+ 509 gctagctgatcgatcgatgtgc            74 22  0 54.55 62.443 31.83 30.04 35.21  4.443
+ 510 tagctgactgatcgatcatcat           263 22  0 40.91 57.531 26.31 20.43 41.77  4.469
+ 511 tagctagctgactgatcgatcga          107 23  0 47.83 61.487 28.29 22.52  0.00  4.487
+ 512 atcgatcgatgctagtatgctag          326 23  0 43.48 58.501 29.65 13.77 46.09  4.499
+ 513 ctagtgatgcatgctagtagtga           26 23  0 43.48 58.483 20.00  1.46  0.00  4.517
+ 514 tagctagctgactgatcgatcatc         259 24  0 45.83 60.536 28.29 21.92 36.62  4.536
+ 515 tactagctagctgatcatcatcga         507 24  0 41.67 59.449  0.00  0.00  0.00  4.551
+ 516 gctagctagctactatcatcga           426 22  0 45.45 57.437 34.38  0.00 46.11  4.563
+ 517 tgactgatacgcgatgctagct           474 22  0 50.00 62.569 17.69  1.35  0.00  4.569
+ 518 agctgactgatacgcgatgcta           471 22  0 50.00 62.569  7.57  0.00  0.00  4.569
+ 519 tagctgactgatacgcgatgct           470 22  0 50.00 62.569 10.87  8.44  0.00  4.569
+ 520 atcgatcgatgctagtatgcta           326 22  0 40.91 57.423 29.65  0.00 33.56  4.577
+ 521 ctagctagctgatcatcatcgat          509 23  0 43.48 58.422 11.68  0.00  0.00  4.578
+ 522 agctgactgatcgatcgatgct           112 22  0 50.00 62.580 26.44 23.13 35.21  4.580
+ 523 ctagctagctgatcatcgatgcta         188 24  0 45.83 60.596 16.78 15.81  0.00  4.596
+ 524 gtgatgcatgctagtagtgatgta          29 24  0 41.67 59.398 11.60  8.84  0.00  4.602
+ 525 gctgatcatcatcgatgctagct          516 23  0 47.83 61.603 20.15  8.14 40.32  4.603
+ 526 agctgatcatcatcgatgctagc          515 23  0 47.83 61.603 20.04 19.26 40.32  4.603
+ 527 gctagctgatcatcatcgatgct          512 23  0 47.83 61.603 14.14  8.34 40.32  4.603
+ 528 agctagctgatcatcatcgatgc          511 23  0 47.83 61.603 21.42  7.40 40.32  4.603
+ 529 tagtgatgcatgctagtagtga            27 22  0 40.91 57.391  0.01  0.00  0.00  4.609
+ 530 ctactagctagctgactgatacg          462 23  0 47.83 58.387  3.12  0.00  0.00  4.613
+ 531 tagctactgatcgatgctacatc          306 23  0 43.48 58.368 13.79  0.00 37.97  4.632
+ 532 gactgatacgcgatgctagctag          475 23  0 52.17 61.633 17.46 17.46  0.00  4.633
+ 533 ctagctactgatcgatgctacat          305 23  0 43.48 58.364 13.79  0.09  0.00  4.636
+ 534 gctagctactatcatctctgcgc          352 23  0 52.17 61.644  8.21  0.00  0.00  4.644
+ 535 gctagctagctactgatcgatgc          300 23  0 52.17 61.644 34.38 12.71 46.11  4.644
+ 536 gctactagctagctgatcatcat          505 23  0 43.48 58.350 14.37  0.00 44.92  4.650
+ 537 gctactagctagctgatcatcat          208 23  0 43.48 58.350 14.37  0.00 44.92  4.650
+ 538 ctagctactgatcgatgctacatc         305 24  0 45.83 59.349 13.79  0.00 37.97  4.651
+ 539 gctactagctagctgatcatcatc         505 24  0 45.83 59.343 14.37  0.00 44.92  4.657
+ 540 gctactagctagctgatcatcatc         208 24  0 45.83 59.343 14.37  0.00 44.92  4.657
+ 541 gctgatcatcatctagctagtagc         154 24  0 45.83 59.343 15.25 15.25 45.79  4.657
+ 542 tagctagctgatcatcatcgat           510 22  0 40.91 57.329 10.14  0.00  0.00  4.671
+ 543 ctactatcatctctgcgcgatcg          357 23  0 52.17 61.686 12.19 12.19 39.07  4.686
+ 544 tactagctagctgactgatacg           463 22  0 45.45 57.310 13.17  0.00  0.00  4.690
+ 545 gctgatcgatcgatgctagctag          398 23  0 52.17 61.697 27.88 18.22 35.21  4.697
+ 546 ctagctgatcgatcgatgctagc          395 23  0 52.17 61.697 38.64 35.38 43.05  4.697
+ 547 gctagctgatcgatcgatgctag          394 23  0 52.17 61.697 41.07 41.07 46.89  4.697
+ 548 ctagctagctgatcgatcgatgc          391 23  0 52.17 61.697 24.08 21.09 35.21  4.697
+ 549 gctagctagctgatcgatcgatg          390 23  0 52.17 61.697 34.38 11.03 46.11  4.697
+ 550 gctagctagctgatcgatcgatg           70 23  0 52.17 61.697 34.38 11.03 46.11  4.697
+ 551 gctactagctagctgactgata           461 22  0 45.45 57.286 15.96  3.69 44.92  4.714
+ 552 gatcgatcatcatgctagctac           272 22  0 45.45 57.284 21.11  0.00  0.00  4.716
+ 553 cgatgctagctaggcgat               408 18  0 55.56 57.277 10.81  3.01  0.00  4.723
+ 554 atcgatgctagctaggcg               406 18  0 55.56 57.277 15.59  9.02  0.00  4.723
+ 555 tagctactgatcgatgctacat           306 22  0 40.91 57.270 13.79  0.09  0.00  4.730
+ 556 gctagctactatcatcgatcgat          430 23  0 43.48 58.251 25.37 25.37 35.13  4.749
+ 557 tgcatgctagtagtgatgtatacg          33 24  0 41.67 59.224 20.79  0.00  0.00  4.776
+ 558 gcatgctagtagtgatgtatacgt          34 24  0 41.67 59.223 11.60  0.00  0.00  4.777
+ 559 atttagctagctgactgatcgatc         256 24  0 41.67 59.219 19.32 19.32  0.00  4.781
+ 560 gactgatcgatcatcatgctag           268 22  0 45.45 57.215 24.51 15.87 41.77  4.785
+ 561 atttagctagctgactgatcgat          256 23  0 39.13 58.215  4.16  0.00  0.00  4.785
+ 562 gctgactgatcgatcatcatgct          265 23  0 47.83 61.788 27.72 15.10 41.77  4.788
+ 563 agctgactgatcgatcatcatgc          264 23  0 47.83 61.788 27.74 27.74 41.77  4.788
+ 564 tagctactatcatctctgcgcga          354 23  0 47.83 61.796  2.71  2.71  0.00  4.796
+ 565 gctgatcatcgatgctactagcta         195 24  0 45.83 60.834 20.91  7.37 45.92  4.834
+ 566 tagctgatcatcgatgctactagc         193 24  0 45.83 60.834 20.78 20.78 45.61  4.834
+ 567 gctagctgatcatcgatgctacta         191 24  0 45.83 60.834 11.65  8.83  0.00  4.834
+ 568 tagctagctgatcatcgatgctac         189 24  0 45.83 60.834 17.82 12.06  0.00  4.834
+ 569 tagtgatgcatgctagtagtgatg          27 24  0 41.67 59.155 11.56  7.49  0.00  4.845
+ 570 agtgatgcatgctagtagtgatgt          28 24  0 41.67 60.846 11.60  0.00  0.00  4.846
+ 571 tgatgcatgctagtagtgatgta           30 23  0 39.13 58.147 11.60  8.84  0.00  4.853
+ 572 ctgactgatcgatcgatgctagc          114 23  0 52.17 61.878 18.17 12.52 35.21  4.878
+ 573 gctgactgatcgatcgatgctag          113 23  0 52.17 61.878 22.81 19.44 35.21  4.878
+ 574 ctagctgactgatcgatcgatgc          110 23  0 52.17 61.878 24.08 19.43 35.21  4.878
+ 575 gctagctgactgatcgatcgatg          109 23  0 52.17 61.878 23.05 13.21 35.21  4.878
+ 576 tcatcatcgatgctagctagtag          521 23  0 43.48 58.114  2.81  0.00 40.32  4.886
+ 577 tactagctagctgatcatcatcg          507 23  0 43.48 58.114  0.00  0.00  0.00  4.886
+ 578 tcgatcatcatgctagctactag          274 23  0 43.48 58.114  0.00  0.00 37.62  4.886
+ 579 tgatcatcgatgctactagctag          197 23  0 43.48 58.114 20.04 20.04 45.92  4.886
+ 580 ctgatcatcgatgctactagcta          196 23  0 43.48 58.114 10.86  0.00 45.92  4.886
+ 581 tagctgatcatcgatgctactag          193 23  0 43.48 58.114 13.67  9.68  0.00  4.886
+ 582 ctagctgatcatcgatgctacta          192 23  0 43.48 58.114 11.65  8.83  0.00  4.886
+ 583 ctactagctagctgatcatcatcg         506 24  0 45.83 59.110  1.08  0.00  0.00  4.890
+ 584 ctgatcatcgatgctactagctag         196 24  0 45.83 59.110 20.04 20.04 45.92  4.890
+ 585 ctagctgatcatcgatgctactag         192 24  0 45.83 59.110 15.68 15.68  0.00  4.890
+ 586 gctagctagctgatcatcatctag         146 24  0 45.83 59.102 34.38 13.13 44.71  4.898
+ 587 gctagctagctgatcatcatcta          146 23  0 43.48 58.097 34.38  0.00 46.11  4.903
+ 588 ctagtgatgcatgctagtagtg            26 22  0 45.45 57.072 20.00  3.96  0.00  4.928
+ 589 gctactatcatctctgcgcgatc          356 23  0 52.17 61.936  4.99  0.00  0.00  4.936
+ 590 gctgatcgatcgatgtgc                78 18  0 55.56 57.052 29.71 26.38 35.21  4.948
+ 591 tagctagctactatcatcgatcga         428 24  0 41.67 59.031 27.80 22.52  0.00  4.969
+ 592 agctagctgatcgatcgtagcg           562 22  0 54.55 62.971 27.20 18.31  0.00  4.971
+ 593 tgactgatacgcgatgct               474 18  0 50.00 57.028  2.33  0.00  0.00  4.972
+ 594 gatcatcatcgatgctagctag           519 22  0 45.45 57.019 17.46 17.46 40.32  4.981
+ 595 tcatcatcgatgctagctagta           521 22  0 40.91 57.005 22.18 18.77 40.32  4.995
+ 596 tcgatcatcatgctagctacta           274 22  0 40.91 57.005  0.00  0.00  0.00  4.995
+ 597 tgatcatcgatgctactagcta           197 22  0 40.91 57.005 17.14  1.01 45.92  4.995
+ 598 tagctgatcatcgatgctacta           193 22  0 40.91 57.005 12.62  8.42  0.00  4.995
+ 599 tagctagctgactgatacgcgat          466 23  0 47.83 62.044 28.29  0.00  0.00  5.044
+ 600 ctagctagctactatcatcgatcga        427 25  0 44.00 59.949 27.80 22.52  0.00  5.051
+ 601 agctagctgactgatcgatcgat          108 23  0 47.83 62.053 30.53 30.53 37.90  5.053
+ 602 ctactagctagctgactgatacgc         462 24  0 50.00 61.062  3.61  0.00  0.00  5.062
+ 603 gctactagctagctgactgatacg         461 24  0 50.00 61.062 14.37  0.00 44.92  5.062
+ 604 tgatcatcatcgatgctagctagta        518 25  0 40.00 60.062 22.18 18.77 40.32  5.062
+ 605 tgatcgatcatcatgctagctacta        271 25  0 40.00 60.062 27.48  0.00 37.38  5.062
+ 606 ctagtgatgcatgctagtagtgatg         26 25  0 44.00 60.064 20.00  7.49  0.00  5.064
+ 607 gctagctagctactatcatcgatc         426 24  0 45.83 58.932 34.38  4.20 46.11  5.068
+ 608 gctagctactgatcgatgctacat         304 24  0 45.83 61.072 11.21  0.00  0.00  5.072
+ 609 gctagctagctactatcatcgat          426 23  0 43.48 57.922 34.38  0.00 46.11  5.078
+ 610 ctagtgatgcatgctagtagtgat          26 24  0 41.67 58.911 20.00  4.64  0.00  5.089
+ 611 tactatcatctctgcgcgatcga          358 23  0 47.83 62.092 22.07  1.72 38.48  5.092
+ 612 agctgatcgatcgatgctagcta          397 23  0 47.83 62.111 31.26 14.51 40.03  5.111
+ 613 tagctgatcgatcgatgctagct          396 23  0 47.83 62.111 33.22 33.22 42.08  5.111
+ 614 agctagctgatcgatcgatgcta          393 23  0 47.83 62.111 34.11 32.56 36.80  5.111
+ 615 tagctagctgatcgatcgatgct          392 23  0 47.83 62.111 33.87 33.38 38.16  5.111
+ 616 tagtgatgcatgctagtagtgat           27 23  0 39.13 57.886 11.56  0.00  0.00  5.114
+ 617 tactagctagctgatcatcatcgat        507 25  0 40.00 59.828  0.00  0.00  0.00  5.172
+ 618 gctagctagctgatcatcgatgc          187 23  0 52.17 62.193 34.38  9.22 46.11  5.193
+ 619 gctagtgatgcatgctagtagtga          25 24  0 45.83 61.195 24.96  4.57  0.00  5.195
+ 620 aaagcatcggattagctagctgat           1 24  0 41.67 61.209 17.84 15.13  0.00  5.209
+ 621 gtgatgcatgctagtagtgatgtat         29 25  0 40.00 59.774  1.07  1.07  0.00  5.226
+ 622 ctatcatctctgcgcgatcgatg          360 23  0 52.17 62.227 18.01 18.01 38.48  5.227
+ 623 tgactgatacgcgatgctagcta          474 23  0 47.83 62.287 17.69  3.08  0.00  5.287
+ 624 tagctgactgatacgcgatgcta          470 23  0 47.83 62.287 12.64  9.09  0.00  5.287
+ 625 tgctagtagtgatgtatacgtagct         37 25  0 40.00 59.713  9.37  8.73  0.00  5.287
+ 626 tgactgatcgatcgatgctagct          115 23  0 47.83 62.296 20.19 11.59 35.21  5.296
+ 627 agctgactgatcgatcgatgcta          112 23  0 47.83 62.296 26.44 14.64 35.21  5.296
+ 628 tagctgactgatcgatcgatgct          111 23  0 47.83 62.296 31.98 30.27 35.21  5.296
+ 629 ctagctagctactatcatcgatcg         427 24  0 45.83 58.703 12.49  9.87  0.00  5.297
+ 630 tagctagctactatcatcgatcg          428 23  0 43.48 57.691 27.80  9.87  0.00  5.309
+ 631 gactgatcgatcatcatgctagct         268 24  0 45.83 61.313 24.51  7.81 41.77  5.313
+ 632 gctagctgactgatcgatcatcat         261 24  0 45.83 61.313 26.31 20.43 41.77  5.313
+ 633 ctatttagctagctgactgatcga         254 24  0 41.67 58.679  0.00  0.00  0.00  5.321
+ 634 gcatgctagtagtgatgtatacg           34 23  0 43.48 57.659 11.60  0.00  0.00  5.341
+ 635 tatttagctagctgactgatcga          255 23  0 39.13 57.650  0.00  0.00  0.00  5.350
+ 636 ctactagctagctgatcatcatcga        506 25  0 44.00 60.352  1.08  0.00  0.00  5.352
+ 637 agctactatcatctctgcgcgat          355 23  0 47.83 62.360  4.99  2.52  0.00  5.360
+ 638 gctgatcatcatcgatgctagcta         516 24  0 45.83 61.370 20.15  8.49 40.32  5.370
+ 639 tagctgatcatcatcgatgctagc         514 24  0 45.83 61.370 20.04 19.26 40.32  5.370
+ 640 gctagctgatcatcatcgatgcta         512 24  0 45.83 61.370 14.58  9.63 40.32  5.370
+ 641 tagctagctgatcatcatcgatgc         510 24  0 45.83 61.370 21.42  7.40 40.32  5.370
+ 642 atgcatgctagtagtgatgtatacg         32 25  0 40.00 59.604 11.70  0.00  0.00  5.396
+ 643 tgatgcatgctagtagtgatgtat          30 24  0 37.50 58.592 12.66 12.66  0.00  5.408
+ 644 gactgatcgatcgatgctagctag         116 24  0 50.00 61.409 18.04 17.46 35.21  5.409
+ 645 gctatttagctagctgactgatc          253 23  0 43.48 57.572  7.27  0.00 46.11  5.428
+ 646 tgctagtgatgcatgctagtagtg          24 24  0 45.83 61.434 24.96 10.54 35.89  5.434
+ 647 ctagctagctactatcatctctgc         349 24  0 45.83 58.562 27.80  0.00  0.00  5.438
+ 648 gctagctagctactatcatctctg         348 24  0 45.83 58.562 34.38  6.79 46.11  5.438
+ 649 gatcatcatcgatgctagctagta         519 24  0 41.67 58.557 22.18 18.77 40.32  5.443
+ 650 gatcgatcatcatgctagctacta         272 24  0 41.67 58.557 21.11  0.00  0.00  5.443
+ 651 atcatcatcgatgctagctagtag         520 24  0 41.67 58.554  2.13  0.00 40.32  5.446
+ 652 atcgatcatcatgctagctactag         273 24  0 41.67 58.554  0.00  0.00 37.62  5.446
+ 653 tagctagctactatcatctctgc          350 23  0 43.48 57.527 27.80  0.00  0.00  5.473
+ 654 atcatcatcgatgctagctagta          520 23  0 39.13 57.514 22.18 18.77 40.32  5.486
+ 655 atcgatcatcatgctagctacta          273 23  0 39.13 57.514  0.00  0.00  0.00  5.486
+ 656 gatcatcatcgatgctagctagtag        519 25  0 44.00 59.494  0.21  0.00 40.32  5.506
+ 657 gatcgatcatcatgctagctactag        272 25  0 44.00 59.494 21.11  0.00 37.62  5.506
+ 658 actagctagctgatcatcatctact        211 25  0 40.00 59.471 22.43  6.99  0.00  5.529
+ 659 tgactgatcgatcatcatgctagc         267 24  0 45.83 61.547 26.79 14.13 41.77  5.547
+ 660 gctgactgatcgatcatcatgcta         265 24  0 45.83 61.547 27.72 16.42 41.77  5.547
+ 661 tagctgactgatcgatcatcatgc         263 24  0 45.83 61.547 27.74 27.74 41.77  5.547
+ 662 tgctagtagtgatgtatacgtagc          37 24  0 41.67 58.446  4.93  4.93  0.00  5.554
+ 663 ctagctagctgactgatacgcga          465 23  0 52.17 62.571 14.90  0.00  0.00  5.571
+ 664 tagctagctactatcatcgatcgat        428 25  0 40.00 59.423 27.80 25.37 35.13  5.577
+ 665 gctactagctagctgatcatcatct        208 25  0 44.00 60.585 14.37  0.00 44.92  5.585
+ 666 agctgatcatcatctagctagtagc        153 25  0 44.00 60.585 15.25 15.25 40.45  5.585
+ 667 ctagctagctgatcgatcgatgtg          71 24  0 50.00 61.642 11.68  4.94 35.21  5.642
+ 668 agtgatgcatgctagtagtgatgta         28 25  0 40.00 60.646 11.60  8.84  0.00  5.646
+ 669 tagtgatgcatgctagtagtgatgt         27 25  0 40.00 60.646 11.60  0.00  0.00  5.646
+ 670 actatcatctctgcgcgatcgat          359 23  0 47.83 62.652 22.07 11.47 38.48  5.652
+ 671 ctatttagctagctgactgatcg          254 23  0 43.48 57.339  0.00  0.00  0.00  5.661
+ 672 tagctagctgatcgatcgtagcg          561 23  0 52.17 62.677 27.20 18.31  0.00  5.677
+ 673 gcatcggattagctagctgatgc            4 23  0 52.17 62.687 34.10 34.10 41.15  5.687
+ 674 tgcatgctagtagtgatgtatacgt         33 25  0 40.00 60.700 20.79  0.00  0.00  5.700
+ 675 tttagctagctgactgatcgatcat        257 25  0 40.00 60.702 26.67 18.02 36.62  5.702
+ 676 atttagctagctgactgatcgatca        256 25  0 40.00 60.702 26.99 26.99 35.44  5.702
+ 677 gctagctagctactatcatctct          348 23  0 43.48 57.266 34.38  0.00 46.11  5.734
+ 678 aagcatcggattagctagctgatg           2 24  0 45.83 61.794 27.81 27.81 33.28  5.794
+ 679 agtgatgtatacgtagctagtagc          44 24  0 41.67 58.201 15.25 15.25 45.79  5.799
+ 680 gctagtagtgatgtatacgtagct          38 24  0 41.67 58.201  5.92  5.92  0.00  5.799
+ 681 tagctagctgactgatcgatcgat         107 24  0 45.83 61.800 30.53 30.53 37.90  5.800
+ 682 actagctagctgactgatacgcg          464 23  0 52.17 62.816 21.52  3.89  0.00  5.816
+ 683 actagctagctgatcatcatctac         211 24  0 41.67 58.178 22.43  0.00  0.00  5.822
+ 684 tagctgatcgatcgatgctagcta         396 24  0 45.83 61.857 34.98 33.55 41.05  5.857
+ 685 tagctagctgatcgatcgatgcta         392 24  0 45.83 61.857 34.11 32.56 36.80  5.857
+ 686 tatttagctagctgactgatcgat         255 24  0 37.50 58.112  1.68  0.00  0.00  5.888
+ 687 gcatgctagtagtgatgtatacgta         34 25  0 40.00 59.089 11.60  0.00  0.00  5.911
+ 688 tatttagctagctgactgatcgatc        255 25  0 40.00 59.084 19.32 19.32  0.00  5.916
+ 689 ctatttagctagctgactgatcgat        254 25  0 40.00 59.082  0.00  0.00  0.00  5.918
+ 690 ctagctagctactatcatctctgcg        349 25  0 48.00 60.920 27.80  5.75  0.00  5.920
+ 691 tgatcgatcgatgctagctaggc          400 23  0 52.17 62.955 26.44 12.49 35.21  5.955
+ 692 agctagctactgatcgatgctaca         303 24  0 45.83 61.988 17.56  3.03  0.00  5.988
+ 693 tgactgatcgatcgatgctagcta         115 24  0 45.83 62.034 20.19 11.16 35.21  6.034
+ 694 tagctgactgatcgatcgatgcta         111 24  0 45.83 62.034 33.43 30.74 35.21  6.034
+ 695 catgctagtagtgatgtatacgtagc        35 26  0 42.31 59.961  4.93  4.93  0.00  6.039
+ 696 gcatgctagtagtgatgtatacgtag        34 26  0 42.31 59.961 11.60  0.00  0.00  6.039
+ 697 actgatcgatcgatgctagctagt         117 24  0 45.83 62.039 23.29 15.07 35.21  6.039
+ 698 ctatttagctagctgactgatcgatc       254 26  0 42.31 59.960 19.32 19.32  0.00  6.040
+ 699 ttagctagctgactgatcgatcatc        258 25  0 44.00 61.041 28.29 21.92 36.62  6.041
+ 700 atgctagtagtgatgtatacgtagct        36 26  0 38.46 60.068  9.37  8.73  0.00  6.068
+ 701 ctagctagctgatcatcatctact         212 24  0 41.67 57.930 11.68  6.99  0.00  6.070
+ 702 ctactagctagctgatcatcatct         209 24  0 41.67 57.930  1.08  0.00  0.00  6.070
+ 703 agctgatcatcatctagctagtag         153 24  0 41.67 57.930  7.49  3.73 40.45  6.070
+ 704 ctagctgatcatcatctagctagt         151 24  0 41.67 57.930 21.70  5.56 46.15  6.070
+ 705 tagctactatcatctctgcgcgat         354 24  0 45.83 62.096  4.99  2.52  0.00  6.096
+ 706 gactgatcgatcatcatgctagcta        268 25  0 44.00 61.099 24.51  4.57 41.77  6.099
+ 707 ctgatcatcatcgatgctagctagt        517 25  0 44.00 61.101 22.18  3.56 40.32  6.101
+ 708 actagctagctgatcatcatcgatg        508 25  0 44.00 61.101 22.43 20.23 41.48  6.101
+ 709 ctgatcgatcatcatgctagctact        270 25  0 44.00 61.101 26.67  0.00 41.77  6.101
+ 710 atgctagtagtgatgtatacgtagc         36 25  0 40.00 58.855  4.93  4.93  0.00  6.145
+ 711 ctagctagctactgatcgatgctac        301 25  0 48.00 61.145 14.00  7.81  0.00  6.145
+ 712 gctagctagctactatcatctctgc        348 25  0 48.00 61.152 34.38 11.74 46.11  6.152
+ 713 agctagctgatcatcatctactatca       214 26  0 38.46 59.840 17.99  0.00  0.00  6.160
+ 714 ctgatcgatcgatgctagctagtag        118 25  0 48.00 61.197 19.70  5.49 35.21  6.197
+ 715 agctagctgactgatcgatcatca         260 24  0 45.83 62.232 26.49 26.49 39.98  6.232
+ 716 gctagctagctactatcatcgatcg        426 25  0 48.00 61.252 34.38  9.87 46.11  6.252
+ 717 gctatttagctagctgactgatcga        253 25  0 44.00 61.268  7.27  0.00 46.11  6.268
+ 718 ctagctagctactatcatcgatcgat       427 26  0 42.31 60.291 27.80 25.37 35.13  6.291
+ 719 agctgatcatcgatgctactagct         194 24  0 45.83 62.294 24.11 23.60 45.92  6.294
+ 720 agctagctgatcatcgatgctact         190 24  0 45.83 62.294 17.99 10.88  0.00  6.294
+ 721 ctagctagctgactgatcgatcga         106 24  0 50.00 62.312 22.52 22.52  0.00  6.312
+ 722 actgatcgatcatcatgctagctac        269 25  0 44.00 61.328 26.67  0.00 41.77  6.328
+ 723 tgatgcatgctagtagtgatgtatac        30 26  0 38.46 59.623  9.19  6.43  0.00  6.377
+ 724 gtgatgcatgctagtagtgatgtata        29 26  0 38.46 59.623  4.23  0.00  0.00  6.377
+ 725 tactatcatctctgcgcgatcgat         358 24  0 45.83 62.379 22.07 11.47 38.48  6.379
+ 726 gctagctgatcatcatctactatca        215 25  0 40.00 58.607  8.21  0.00  0.00  6.393
+ 727 gctactagctagctgatcatcatcta       208 26  0 42.31 60.404 14.37  0.00 44.92  6.404
+ 728 tagctgatcatcatctagctagtagc       152 26  0 42.31 60.404 15.25 15.25 41.48  6.404
+ 729 tgctagtagtgatgtatacgtagcta        37 26  0 38.46 59.564 10.00  8.05  0.00  6.436
+ 730 gatgcatgctagtagtgatgtatacg        31 26  0 42.31 60.453  7.40  0.00  0.00  6.453
+ 731 tagtgatgcatgctagtagtgatgta        27 26  0 38.46 60.461 11.60  8.84  0.00  6.461
+ 732 gctagtgatgcatgctagtagtgat         25 25  0 44.00 61.506 24.96  8.51  0.00  6.506
+ 733 tgcatgctagtagtgatgtatacgta        33 26  0 38.46 60.515 20.79  0.00  0.00  6.515
+ 734 tatttagctagctgactgatcgatca       255 26  0 38.46 60.516 26.99 26.99 35.44  6.516
+ 735 tgatgcatgctagtagtgatgtata         30 25  0 36.00 58.479  4.13  0.00  0.00  6.521
+ 736 tactagctagctgactgatacgcg         463 24  0 50.00 62.538 13.17  3.89  0.00  6.538
+ 737 ctagctactatcatctctgcgcga         353 24  0 50.00 62.603  2.71  2.71  0.00  6.603
+ 738 agctagctgatcatcatctactatc        214 25  0 40.00 58.369 17.99  0.00  0.00  6.631
+ 739 agctagctgatcatcatctactat         214 24  0 37.50 57.345 17.99  0.00  0.00  6.655
+ 740 gctactagctagctgatcatcatcg        505 25  0 48.00 61.656 14.37  0.00 44.92  6.656
+ 741 gctgatcatcgatgctactagctag        195 25  0 48.00 61.656 20.91 20.04 45.92  6.656
+ 742 ctagctgatcatcgatgctactagc        192 25  0 48.00 61.656 20.78 20.78 45.61  6.656
+ 743 gctagctgatcatcgatgctactag        191 25  0 48.00 61.656 20.13 20.13  0.00  6.656
+ 744 ctagctagctgatcatcgatgctac        188 25  0 48.00 61.656 17.82 12.06  0.00  6.656
+ 745 actagctagctgatcatcatctacta       211 26  0 38.46 59.328 22.43  8.11  0.00  6.672
+ 746 tactagctagctgatcatcatctact       210 26  0 38.46 59.328  6.99  6.99  0.00  6.672
+ 747 ctactagctagctgatcatcatcgat       506 26  0 42.31 60.681  1.08  0.00  0.00  6.681
+ 748 tagctagctactgatcgatgctaca        302 25  0 44.00 61.746 27.80  5.02  0.00  6.746
+ 749 gtagtgatgtatacgtagctagtagc        42 26  0 42.31 59.249 15.25 15.25 45.79  6.751
+ 750 actgatcgatcgatgctagctagta        117 25  0 44.00 61.797 23.29 18.77 35.21  6.797
+ 751 gatgcatgctagtagtgatgtatac         31 25  0 40.00 58.175 20.79  1.70  0.00  6.825
+ 752 agctgatcatcatcgatgctagct         515 24  0 45.83 62.835 23.00 22.41 41.74  6.835
+ 753 agctagctgatcatcatcgatgct         511 24  0 45.83 62.835 17.99  8.34 40.32  6.835
+ 754 ctagctagctgactgatacgcgat         465 24  0 50.00 62.838 14.90  0.00  0.00  6.838
+ 755 atgcatgctagtagtgatgtatac          32 24  0 37.50 57.161 11.70  0.53  0.00  6.839
+ 756 agctagctactatcatctctgcgc         351 24  0 50.00 62.858 17.56  0.00  0.00  6.858
+ 757 gctagctagctactgatcgatgct         300 24  0 50.00 62.858 34.38 11.51 46.11  6.858
+ 758 ctactatcatctctgcgcgatcga         357 24  0 50.00 62.878 22.07  1.72 38.48  6.878
+ 759 gctagctactgatcgatgctacatc        304 25  0 48.00 61.879 11.21  4.40 37.97  6.879
+ 760 tagtgatgtatacgtagctagtagc         43 25  0 40.00 58.104 15.25 15.25 45.79  6.896
+ 761 gctagtagtgatgtatacgtagcta         38 25  0 40.00 58.104  7.24  5.34  0.00  6.896
+ 762 tgatcatcatcgatgctagctagtag       518 26  0 42.31 60.902 14.93  0.00 40.32  6.902
+ 763 ctgatcatcatcgatgctagctagta       517 26  0 42.31 60.902 22.18 18.77 40.32  6.902
+ 764 tactagctagctgatcatcatcgatg       507 26  0 42.31 60.902 20.23 20.23 41.48  6.902
+ 765 tgatcgatcatcatgctagctactag       271 26  0 42.31 60.902 27.48  0.00 37.38  6.902
+ 766 ctgatcgatcatcatgctagctacta       270 26  0 42.31 60.902 26.67  1.37 41.77  6.902
+ 767 agctgatcgatcgatgctagctag         397 24  0 50.00 62.904 31.26 19.90 40.03  6.904
+ 768 ctagctgatcgatcgatgctagct         395 24  0 50.00 62.904 35.51 33.22 43.05  6.904
+ 769 agctagctgatcgatcgatgctag         393 24  0 50.00 62.904 41.07 41.07 46.89  6.904
+ 770 ctagctagctgatcgatcgatgct         391 24  0 50.00 62.904 33.87 33.38 38.16  6.904
+ 771 tactagctagctgatcatcatctac        210 25  0 40.00 58.081  0.00  0.00  0.00  6.919
+ 772 gctagctgatcatcatctactatc         215 24  0 41.67 57.062  8.21  0.00  0.00  6.938
+ 773 agtgatgcatgctagtagtgatgtat        28 26  0 38.46 60.969  1.07  1.07  0.00  6.969
+ 774 gctagtagtgatgtatacgtagctag        38 26  0 42.31 59.027  8.99  8.99  0.00  6.973
+ 775 tagctagctgactgatcgatcatca        259 25  0 44.00 61.981 28.29 26.49 39.98  6.981
+ 776 ctactagctagctgatcatcatctac       209 26  0 42.31 59.015  1.08  0.00  0.00  6.985
+ 777 agtagtgatgtatacgtagctagt          41 24  0 37.50 57.012  8.68  8.68  0.00  6.988
+ 778 gctagctgatcatcatctactatcat       215 26  0 38.46 59.001  8.21  0.00  0.00  6.999
+ 779 agctgatcatcatctactatcatca        218 25  0 36.00 57.993  0.00  0.00  0.00  7.007
+ 780 atgcatgctagtagtgatgtatacgt        32 26  0 38.46 61.018 11.70  0.00  0.00  7.018
+ 781 atttagctagctgactgatcgatcat       256 26  0 38.46 61.022 26.67 18.02 36.62  7.022
+ 782 agctgatcatcgatgctactagcta        194 25  0 44.00 62.040 24.59  9.79 45.92  7.040
+ 783 tagctgatcatcgatgctactagct        193 25  0 44.00 62.040 27.00 27.00 45.92  7.040
+ 784 agctagctgatcatcgatgctacta        190 25  0 44.00 62.040 17.99 11.59  0.00  7.040
+ 785 tagctagctgatcatcgatgctact        189 25  0 44.00 62.040 17.55 15.53  0.00  7.040
+ 786 atgctagtagtgatgtatacgtagcta       36 27  0 37.04 59.911 10.00  8.05  0.00  7.089
+ 787 gctagctgatcatcatctactatcatc      215 27  0 40.74 59.861  8.21  0.00  0.00  7.139
+ 788 ctagctagctgatcatcatctacta        212 25  0 40.00 57.842 11.68  8.11  0.00  7.158
+ 789 ctactagctagctgatcatcatcta        209 25  0 40.00 57.842  1.08  0.00  0.00  7.158
+ 790 tagctgatcatcatctagctagtag        152 25  0 40.00 57.842 13.40  3.73 41.48  7.158
+ 791 ctagctgatcatcatctagctagta        151 25  0 40.00 57.842 21.70  7.13 46.15  7.158
+ 792 gctgatcatcatcgatgctagctag        516 25  0 48.00 62.165 20.15 17.46 40.32  7.165
+ 793 ctagctgatcatcatcgatgctagc        513 25  0 48.00 62.165 19.27 19.26 41.96  7.165
+ 794 gctagctgatcatcatcgatgctag        512 25  0 48.00 62.165 23.70 23.70 45.51  7.165
+ 795 ctagctagctgatcatcatcgatgc        509 25  0 48.00 62.165 21.42  7.40 40.32  7.165
+ 796 agctagctgatcatcatctactatcat      214 27  0 37.04 60.181 17.99  0.00  0.00  7.181
+ 797 ctactagctagctgatcatcatctact      209 27  0 40.74 60.181  6.99  6.99  0.00  7.181
+ 798 ctagctgatcatcatctagctagtag       151 26  0 42.31 58.789 21.70 10.73 46.15  7.211
+ 799 aaagcatcggattagctagctgatg          1 25  0 44.00 62.249 27.81 27.81 33.28  7.249
+ 800 agctagctactgatcgatgctacat        303 25  0 44.00 62.272 17.56  6.16  0.00  7.272
+ 801 tagctagctgatcatcatctactatca      213 27  0 37.04 59.689  8.31  0.00  0.00  7.311
+ 802 actagctagctgatcatcatctactat      211 27  0 37.04 59.688 22.43  2.36  0.00  7.312
+ 803 ctgactgatcgatcatcatgctagc        266 25  0 48.00 62.333 20.99  8.86 41.77  7.333
+ 804 gctgactgatcgatcatcatgctag        265 25  0 48.00 62.333 27.72 21.73 41.77  7.333
+ 805 ctagctgactgatcgatcatcatgc        262 25  0 48.00 62.333 27.74 27.74 41.77  7.333
+ 806 gctagctgactgatcgatcatcatg        261 25  0 48.00 62.333 22.70 19.51 41.77  7.333
+ 807 tgctagtagtgatgtatacgtagctag       37 27  0 40.74 60.395  8.99  8.99  0.00  7.395
+ 808 agtagtgatgtatacgtagctagtagc       41 27  0 40.74 60.395 15.25 15.25 45.79  7.395
+ 809 gctagtagtgatgtatacgtagctagt       38 27  0 40.74 60.395 15.55 15.55  0.00  7.395
+ 810 ctagtgatgcatgctagtagtgatgt        26 26  0 42.31 61.460 20.00  0.00  0.00  7.460
+ 811 gctgatcatcatctactatcatcatca      219 27  0 37.04 59.533  0.00  0.00  0.00  7.467
+ 812 agctagctgactgatcgatcatcat        260 25  0 44.00 62.507 26.31 20.43 41.77  7.507
+ 813 tttagctagctgactgatcgatcatc       257 26  0 42.31 61.507 23.93 21.92 36.62  7.507
+ 814 catgctagtagtgatgtatacgtag         35 25  0 40.00 57.441  4.74  0.00  0.00  7.559
+ 815 agctgatcatcatcgatgctagcta        515 25  0 44.00 62.561 23.50 10.90 43.19  7.561
+ 816 tagctgatcatcatcgatgctagct        514 25  0 44.00 62.561 26.21 26.21 44.79  7.561
+ 817 agctagctgatcatcatcgatgcta        511 25  0 44.00 62.561 17.99  9.63 40.32  7.561
+ 818 tagctagctgatcatcatcgatgct        510 25  0 44.00 62.561 14.14 10.38 40.32  7.561
+ 819 gctatttagctagctgactgatcgat       253 26  0 42.31 61.564  7.27  0.00 46.11  7.564
+ 820 ctagctagctgactgatcgatcgat        106 25  0 48.00 62.579 30.53 30.53 37.90  7.579
+ 821 agctgatcatcatctactatcatcat       218 26  0 34.62 58.415  0.00  0.00  0.00  7.585
+ 822 tagctagctactatcatctctgcgc        350 25  0 48.00 62.587 27.80  0.00  0.00  7.587
+ 823 gctagctagctactgatcgatgcta        300 25  0 48.00 62.587 34.38 12.23 46.11  7.587
+ 824 tgctagtgatgcatgctagtagtga         24 25  0 44.00 62.622 24.96 13.57 35.89  7.622
+ 825 tagctgatcgatcgatgctagctag        396 25  0 48.00 62.632 33.71 21.46 41.05  7.632
+ 826 ctagctgatcgatcgatgctagcta        395 25  0 48.00 62.632 35.51 32.61 43.05  7.632
+ 827 tagctagctgatcgatcgatgctag        392 25  0 48.00 62.632 41.07 41.07 46.89  7.632
+ 828 ctagctagctgatcgatcgatgcta        391 25  0 48.00 62.632 34.11 32.56 36.80  7.632
+ 829 gtgatgcatgctagtagtgatgtatac       29 27  0 40.74 60.659  9.56  7.17  0.00  7.659
+ 830 agctgatcatcatctactatcatcatc      218 27  0 37.04 59.314  0.00  0.00  0.00  7.686
+ 831 tagctagctgatcatcatctactat        213 25  0 36.00 57.279  8.31  0.00  0.00  7.721
+ 832 tagctagctgatcatcatctactatc       213 26  0 38.46 58.269  8.31  0.00  0.00  7.731
+ 833 tgactgatcgatcatcatgctagct        267 25  0 44.00 62.733 26.79 10.55 41.77  7.733
+ 834 agctgactgatcgatcatcatgcta        264 25  0 44.00 62.733 30.60 18.10 41.77  7.733
+ 835 tagctgactgatcgatcatcatgct        263 25  0 44.00 62.733 32.31 32.31 41.77  7.733
+ 836 ctagctagctgatcatcatctactat       212 26  0 38.46 58.265  9.41  0.00  0.00  7.735
+ 837 agtgatgcatgctagtagtgatgtata       28 27  0 37.04 60.779  4.23  0.00  0.00  7.779
+ 838 tagtgatgcatgctagtagtgatgtat       27 27  0 37.04 60.779 11.56  0.00  0.00  7.779
+ 839 tgactgatcgatcgatgctagctag        115 25  0 48.00 62.800 20.19 17.46 35.21  7.800
+ 840 ctgactgatcgatcgatgctagcta        114 25  0 48.00 62.800 20.19 11.97 35.21  7.800
+ 841 tagctgactgatcgatcgatgctag        111 25  0 48.00 62.800 31.45 26.34 35.21  7.800
+ 842 ctagctgactgatcgatcgatgcta        110 25  0 48.00 62.800 31.54 29.68 35.21  7.800
+ 843 tagctagctgactgatcgatcgatg        107 25  0 48.00 62.800 28.29 13.21 35.21  7.800
+ 844 gactgatcgatcgatgctagctagt        116 25  0 48.00 62.802 22.18 12.64 35.21  7.802
+ 845 tactagctagctgatcatcatctacta      210 27  0 37.04 59.196  8.79  8.11  0.00  7.804
+ 846 tagctgatcatcgatgctactagcta       193 26  0 42.31 61.805 28.86 27.39 45.92  7.805
+ 847 tagctagctgatcatcgatgctacta       189 26  0 42.31 61.805 18.93 16.03  0.00  7.805
+ 848 atgcatgctagtagtgatgtatacgta       32 27  0 37.04 60.828 11.70  0.00  0.00  7.828
+ 849 tatttagctagctgactgatcgatcat      255 27  0 37.04 60.831 26.67 18.02 36.62  7.831
+ 850 ctagctagctgatcatcatctactatc      212 27  0 40.74 59.162  9.41  0.06  0.00  7.838
+ 851 tagctactatcatctctgcgcgatc        354 25  0 48.00 62.854  0.00  0.00  0.00  7.854
+ 852 gctgatcatcatctactatcatcat        219 25  0 36.00 57.142  0.00  0.00  0.00  7.858
+ 853 ctagctactatcatctctgcgcgat        353 25  0 48.00 62.859  4.99  2.52  0.00  7.859
+ 854 gctgatcatcatctactatcatcatc       219 26  0 38.46 58.126  0.00  0.00  0.00  7.874
+ 855 tagctagctactgatcgatgctacat       302 26  0 42.31 62.028 27.80  3.08  0.00  8.028
+ 856 agtagtgatgtatacgtagctagtag        41 26  0 38.46 57.950  9.92  1.30  0.00  8.050
+ 857 ctagtagtgatgtatacgtagctagt        39 26  0 38.46 57.950 15.52 15.52  0.00  8.050
+ 858 catgctagtagtgatgtatacgtagct       35 27  0 40.74 61.089  9.37  8.73  0.00  8.089
+ 859 gactgatcgatcatcatgctagctac       268 26  0 46.15 62.094 24.51  8.36 41.77  8.094
+ 860 tagctgatcatcatctactatcatca       217 26  0 34.62 57.906  0.00  0.00  0.00  8.094
+ 861 ctagctgatcatcatctactatcatca      216 27  0 37.04 58.826  0.00  0.00  0.00  8.174
+ 862 ctagctgatcatcatctagctagtagc      151 27  0 44.44 61.196 21.70 15.25 46.15  8.196
+ 863 tagctagctgactgatcgatcatcat       259 26  0 42.31 62.255 28.29 20.43 41.77  8.255
+ 864 ctagtgatgcatgctagtagtgatgta       26 27  0 40.74 61.255 20.00  8.84  0.00  8.255
+ 865 tgcatgctagtagtgatgtatacgtag       33 27  0 40.74 61.300 20.79  0.00  0.00  8.300
+ 866 ctatttagctagctgactgatcgatca      254 27  0 40.74 61.304 26.99 26.99 35.44  8.304
+ 867 tagctgatcatcatcgatgctagcta       514 26  0 42.31 62.307 28.23 26.63 43.19  8.307
+ 868 tagctagctgatcatcatcgatgcta       510 26  0 42.31 62.307 14.58 11.03 40.32  8.307
+ 869 gctagctagctactatcatcgatcga       426 26  0 46.15 62.381 34.38 22.52 46.11  8.381
+ 870 gctactagctagctgatcatcatctac      208 27  0 44.44 61.407 14.37  0.00 44.92  8.407
+ 871 ttagctagctgactgatcgatcatca       258 26  0 42.31 62.416 28.29 26.49 39.98  8.416
+ 872 tgactgatcgatcatcatgctagcta       267 26  0 42.31 62.472 26.79 11.24 41.77  8.472
+ 873 tagctgactgatcgatcatcatgcta       263 26  0 42.31 62.472 33.83 32.61 41.77  8.472
+ 874 actgatcgatcatcatgctagctact       269 26  0 42.31 62.478 26.67  0.00 41.77  8.478
+ 875 gctagtgatgcatgctagtagtgatg        25 26  0 46.15 62.484 24.96  9.07  0.00  8.484
+ 876 ctagctagctactgatcgatgctaca       301 26  0 46.15 62.503 14.00  5.87  0.00  8.503
+ 877 gactgatcgatcgatgctagctagta       116 26  0 46.15 62.543 22.18 18.77 35.21  8.543
+ 878 actgatcgatcgatgctagctagtag       117 26  0 46.15 62.548 23.29 12.42 35.21  8.548
+ 879 ctagctgatcatcatctactatcatc       216 26  0 38.46 57.395  0.00  0.00  0.00  8.605
+ 880 ctgatcatcatcgatgctagctagtag      517 27  0 44.44 61.665 10.30  1.36 40.32  8.665
+ 881 ctactagctagctgatcatcatcgatg      506 27  0 44.44 61.665 20.23 20.23 41.48  8.665
+ 882 ctgatcgatcatcatgctagctactag      270 27  0 44.44 61.665 26.67  8.14 41.77  8.665
+ 883 tagctgatcatcatctactatcatcat      217 27  0 33.33 58.315  0.00  0.00  0.00  8.685
+ 884 tgatgcatgctagtagtgatgtatacg       30 27  0 40.74 61.778  9.81  0.00  0.00  8.778
+ 885 gatgcatgctagtagtgatgtatacgt       31 27  0 40.74 61.779  7.40  0.00  0.00  8.779
+ 886 gctactagctagctgatcatcatcga       505 26  0 46.15 62.779 14.37  0.00 44.92  8.779
+ 887 agctgatcatcgatgctactagctag       194 26  0 46.15 62.784 24.59 20.04 45.92  8.784
+ 888 ctagctgatcatcgatgctactagct       192 26  0 46.15 62.784 27.00 27.00 45.92  8.784
+ 889 agctagctgatcatcgatgctactag       190 26  0 46.15 62.784 20.13 20.13  0.00  8.784
+ 890 ctagctagctgatcatcgatgctact       188 26  0 46.15 62.784 17.55 15.53  0.00  8.784
+ 891 atttagctagctgactgatcgatcatc      256 27  0 40.74 61.785 23.93 21.92 36.62  8.785
+ 892 tctactatcatcatcatctactagct       230 26  0 34.62 57.155  0.00  0.00  0.00  8.845
+ 893 tgctagtgatgcatgctagtagtgat        24 26  0 42.31 62.874 24.96  8.51 35.89  8.874
+ 894 ctgatcatcatctactatcatcatca       220 26  0 34.62 57.026  0.00  0.00  0.00  8.974
+ 895 agctagctactgatcgatgctacatc       303 26  0 46.15 62.999 17.56  7.89 37.97  8.999
+ 896 tagtagtgatgtatacgtagctagtag       40 27  0 37.04 57.869 16.78  1.30  0.00  9.131
+ 897 ctagtagtgatgtatacgtagctagta       39 27  0 37.04 57.869 16.85 15.97  0.00  9.131
+ 898 actgatcgatcatcatgctagctacta      269 27  0 40.74 62.236 26.67  1.37 41.77  9.236
+ 899 gcatgctagtagtgatgtatacgtagc       34 27  0 44.44 62.283 11.60  4.93  0.00  9.283
+ 900 gctatttagctagctgactgatcgatc      253 27  0 44.44 62.291 19.32 19.32 46.11  9.291
+ 901 atctactatcatcatcatctactagct      229 27  0 33.33 57.592  0.00  0.00  0.00  9.408
+ 902 catctactatcatcatcatctactagc      228 27  0 37.04 57.549  0.00  0.00  0.00  9.451
+ 903 tgatcatcatctactatcatcatcatc      221 27  0 33.33 57.467  0.00  0.00  0.00  9.533
+ 904 tagctgatcatcgatgctactagctag      193 27  0 44.44 62.534 27.70 20.04 45.92  9.534
+ 905 ctagctgatcatcgatgctactagcta      192 27  0 44.44 62.534 27.76 26.73 45.92  9.534
+ 906 tagctagctgatcatcgatgctactag      189 27  0 44.44 62.534 20.13 20.13  0.00  9.534
+ 907 ctagctagctgatcatcgatgctacta      188 27  0 44.44 62.534 17.74 15.95  0.00  9.534
+ 908 ctgatcatcatctactatcatcatcat      220 27  0 33.33 57.462  0.00  0.00  0.00  9.538
+ 909 gctagctagctactatcatcgatcgat      426 27  0 44.44 62.627 34.38 25.37 46.11  9.627
+ 910 ttagctagctgactgatcgatcatcat      258 27  0 40.74 62.665 28.29 20.43 41.77  9.665
+ 911 tagctagctactgatcgatgctacatc      302 27  0 44.44 62.742 27.80  7.89 37.97  9.742
+ 912 ctagctagctactgatcgatgctacat      301 27  0 44.44 62.747 14.00  2.51  0.00  9.747
+ 913 gatcatcatctactatcatcatcatct      222 27  0 33.33 57.242  0.00  0.00  0.00  9.758
+ 914 tttagctagctgactgatcgatcatca      257 27  0 40.74 62.820 26.49 26.49 39.98  9.820
+ 915 tctactatcatcatcatctactagcta      230 27  0 33.33 57.100  0.00  0.00  0.00  9.900

samples/Haskell/HsColour.hs

@@ -0,0 +1,114 @@
+-- | This is a library which colourises Haskell code.
+--   It currently has six output formats:
+--
+-- * ANSI terminal codes
+--
+-- * LaTeX macros
+--
+-- * HTML 3.2 with font tags
+--
+-- * HTML 4.01 with external CSS.
+--
+-- * XHTML 1.0 with internal CSS.
+--
+-- * mIRC chat client colour codes.
+--
+module Language.Haskell.HsColour (Output(..), ColourPrefs(..),
+                                  hscolour) where
+
+import Language.Haskell.HsColour.Colourise  (ColourPrefs(..))
+import qualified Language.Haskell.HsColour.TTY        as TTY
+import qualified Language.Haskell.HsColour.HTML       as HTML
+import qualified Language.Haskell.HsColour.CSS        as CSS
+import qualified Language.Haskell.HsColour.ACSS       as ACSS 
+import qualified Language.Haskell.HsColour.InlineCSS  as ICSS
+import qualified Language.Haskell.HsColour.LaTeX      as LaTeX
+import qualified Language.Haskell.HsColour.MIRC       as MIRC
+import Data.List(mapAccumL, isPrefixOf)
+import Data.Maybe
+import Language.Haskell.HsColour.Output
+--import Debug.Trace
+
+-- | Colourise Haskell source code with the given output format.
+hscolour :: Output      -- ^ Output format.
+         -> ColourPrefs -- ^ Colour preferences (for formats that support them).
+         -> Bool        -- ^ Whether to include anchors.
+         -> Bool        -- ^ Whether output document is partial or complete.
+         -> String	-- ^ Title for output.
+         -> Bool        -- ^ Whether input document is literate haskell or not
+         -> String      -- ^ Haskell source code.
+         -> String      -- ^ Coloured Haskell source code.
+hscolour output pref anchor partial title False =
+        (if partial then id else top'n'tail output title) .
+        hscolour' output pref anchor
+hscolour output pref anchor partial title True  =
+        (if partial then id else top'n'tail output title) .
+        concatMap chunk . joinL . classify . inlines
+  where
+    chunk (Code c) = hscolour' output pref anchor c
+    chunk (Lit c)  = c
+
+-- | The actual colourising worker, despatched on the chosen output format.
+hscolour' :: Output      -- ^ Output format.
+          -> ColourPrefs -- ^ Colour preferences (for formats that support them)
+          -> Bool        -- ^ Whether to include anchors.
+          -> String      -- ^ Haskell source code.
+          -> String      -- ^ Coloured Haskell source code.
+hscolour' TTY       pref _      = TTY.hscolour     pref
+hscolour' (TTYg tt) pref _      = TTY.hscolourG tt pref
+hscolour' MIRC      pref _      = MIRC.hscolour    pref
+hscolour' LaTeX     pref _      = LaTeX.hscolour   pref
+hscolour' HTML      pref anchor = HTML.hscolour    pref anchor
+hscolour' CSS       _    anchor = CSS.hscolour          anchor
+hscolour' ICSS      pref anchor = ICSS.hscolour    pref anchor
+hscolour' ACSS      _    anchor = ACSS.hscolour         anchor
+
+-- | Choose the right headers\/footers, depending on the output format.
+top'n'tail :: Output           -- ^ Output format
+           -> String           -- ^ Title for output
+           -> (String->String) -- ^ Output transformer
+top'n'tail TTY   _     = id
+top'n'tail (TTYg _) _  = id
+top'n'tail MIRC  _     = id
+top'n'tail LaTeX title = LaTeX.top'n'tail title
+top'n'tail HTML  title = HTML.top'n'tail title
+top'n'tail CSS   title = CSS.top'n'tail  title
+top'n'tail ICSS  title = ICSS.top'n'tail title
+top'n'tail ACSS  title = CSS.top'n'tail  title
+
+-- | Separating literate files into code\/comment chunks.
+data Lit = Code {unL :: String} | Lit {unL :: String} deriving (Show)
+
+-- Re-implementation of 'lines', for better efficiency (but decreased laziness).
+-- Also, importantly, accepts non-standard DOS and Mac line ending characters.
+-- And retains the trailing '\n' character in each resultant string.
+inlines :: String -> [String]
+inlines s = lines' s id
+  where
+  lines' []             acc = [acc []]
+  lines' ('\^M':'\n':s) acc = acc ['\n'] : lines' s id	-- DOS
+--lines' ('\^M':s)      acc = acc ['\n'] : lines' s id	-- MacOS
+  lines' ('\n':s)       acc = acc ['\n'] : lines' s id	-- Unix
+  lines' (c:s)          acc = lines' s (acc . (c:))
+
+
+-- | The code for classify is largely stolen from Language.Preprocessor.Unlit.
+classify ::  [String] -> [Lit]
+classify []             = []
+classify (x:xs) | "\\begin{code}"`isPrefixOf`x
+                        = Lit x: allProg xs
+   where allProg []     = []  -- Should give an error message,
+                              -- but I have no good position information.
+         allProg (x:xs) | "\\end{code}"`isPrefixOf`x
+                        = Lit x: classify xs
+         allProg (x:xs) = Code x: allProg xs
+classify (('>':x):xs)   = Code ('>':x) : classify xs
+classify (x:xs)         = Lit x: classify xs
+
+-- | Join up chunks of code\/comment that are next to each other.
+joinL :: [Lit] -> [Lit]
+joinL []                  = []
+joinL (Code c:Code c2:xs) = joinL (Code (c++c2):xs)
+joinL (Lit c :Lit c2 :xs) = joinL (Lit  (c++c2):xs)
+joinL (any:xs)            = any: joinL xs
+

samples/HyPhy/AAModelComparison.bf

@@ -0,0 +1,252 @@
+if (Rows (modelMatrixList) == 0)
+{
+	modelMatrixList = 
+	{
+	{"Equal Input", "EIAA.mdl", "19"}
+	{"Dayhoff","Dayhoff.mdl","0"}
+	{"Dayhoff+F","Dayhoff_F.mdl","19"}
+	{"JTT", "Jones.mdl", "0"}
+	{"JTT+F", "Jones_F.mdl", "19"}
+	{"WAG", "WAG.mdl", "0"}
+	{"WAG+F", "WAG_F.mdl", "19"}
+	{"rtREV", "rtREV.mdl", "0"}
+	{"rtREV+F", "rtREV_F.mdl", "19"}
+	{"mtMAM", 		  "mtMAM.mdl", "0"}
+	{"mtMAM+F", 	  "mtMAM_F.mdl", "19"}
+	{"mtREV 24",      "mtREV_24.mdl", "0"}
+	{"mtREV 24+F",    "mtREV_24_F.mdl", "19"}
+	{"HIV within",    "HIVwithin.mdl", "0"}
+	{"HIV within+F",  "HIVwithin+F.mdl", "19"}
+	{"HIV between",   "HIVbetween.mdl", "0"}
+	{"HIV between+F", "HIVbetween+F.mdl", "19"}
+	{"REV-1 step", "reducedREV.mdl", "19"}
+	{"REV",   "mtREV.mdl",    "19"}
+	};
+}
+
+/*___________________________________________________________________________________________________________*/
+
+function runAModel (modelID, fileName, xtraP, midx)
+{
+	ExecuteCommands ("#include \"TemplateModels/"+fileName+"\";"); 
+	Tree 					givenTree 			= treeString;
+	LikelihoodFunction 		lf 					= (filteredData,givenTree);
+	
+	GetString (lf_info, lf, -1);
+	locals = lf_info["Local Independent"];
+
+	if (Columns (branchLengthStash))
+	{
+		USE_LAST_RESULTS = 1;
+		for (_iv = 0; _iv < Columns (locals); _iv = _iv+1)
+		{
+			ExecuteCommands (locals[_iv] + "=1;\n");
+		}
+		currentBL = BranchLength (givenTree,0);
+		currentBN = BranchName	 (givenTree,-1);
+		for (_iv = 0; _iv < Columns (currentBN); _iv = _iv+1)
+		{
+			ExecuteCommands ("givenTree."+currentBN[_iv]+".t="+branchLengthStash[_iv]/currentBL+";");
+			
+		}
+	}
+	else
+	{
+		for (_iv = 0; _iv < Columns (locals); _iv = _iv+1)
+		{
+			ExecuteCommands (locals[_iv] + "=0.1;\n");
+		}
+		USE_LAST_RESULTS = 1;
+	}
+
+	Optimize (res,lf);
+	
+	fprintf (stdout, "| ", modelID);
+	for (k=0; k<maxModelWidth-Abs(modelID)-1; k=k+1)
+	{
+		fprintf (stdout, " ");
+	}
+
+	params = res[1][1]+xtraP;
+	AIC    =  2(-res[1][0]+params);
+	
+	if (filteredData.sites-params>1)
+	{
+		cAIC   = 2(-res[1][0]+params*(filteredData.sites/(filteredData.sites-params-1)));
+	}
+	else
+	{
+		cAIC = 0;
+	}
+	
+	branchLengths = BranchLength (givenTree,-1);
+	TL = 0;
+	for (k=Rows(branchLengths)*Columns(branchLengths)-1; k>=0; k=k-1)				  
+	{
+		TL = TL + branchLengths[k];
+	}
+
+	fprintf (stdout, "| ", Format (res[1][0],14,3), " | ", Format (params,5,0), " | ",
+						   Format (AIC, 9,3), " | ",);
+					
+	if (cAIC > 0)
+	{
+		 fprintf (stdout, Format (cAIC,11,3), " | ");
+	}
+	else
+	{
+		 fprintf (stdout, "    N/A     | ");
+	}
+		   
+	fprintf (stdout, Format (TL,11,3), " |\n", sepString);
+	
+	resultMatrix[midx][0] = res[1][0];
+	resultMatrix[midx][1] = params;
+	resultMatrix[midx][2] = AIC;
+	resultMatrix[midx][3] = cAIC;
+	resultMatrix[midx][4] = TL;
+	
+	if (AIC < bestAIC)
+	{
+		bestAIC 	= AIC;
+		bestAICidx  = midx;
+		branchLengthStash = BranchLength (givenTree,-1);
+	}
+	
+	if (cAIC > 0)
+	{
+		if (bestCAIC > cAIC)
+		{
+			bestCAIC = cAIC;
+			bestCAICidx = midx;
+			
+		}
+	}
+	
+	return 0;
+}
+
+
+/*___________________________________________________________________________________________________________*/
+
+
+
+maxModelWidth = 7;
+skipCodeSelectionStep = 0;
+
+ChoiceList (doREV, "Include REV?", 1, SKIP_NONE, "Yes", "Include REV and reduced REV models. CAUTION: these models take a long time to fit.",
+												 "No", "Only use empirical models");
+												 
+if (doREV < 0)
+{
+	return 0;
+}
+
+if (doREV == 0)
+{
+	#include "TemplateModels/chooseGeneticCode.def";
+	skipCodeSelectionStep = 1;
+}
+
+modelCount    = Rows (modelMatrixList) - 2*doREV;
+
+for (k=0; k<modelCount; k=k+1)
+{
+	maxModelWidth = Max(maxModelWidth,Abs (modelMatrixList[k][0])+2);
+}
+
+sepString = "";
+capString = "";
+sepString * 256;
+sepString * "+";
+
+capString * 256;
+capString * "| Model";
+
+for (k=0; k<maxModelWidth; k=k+1)
+{
+	sepString * "-";
+}
+
+for (k=0; k<maxModelWidth-6; k=k+1)
+{
+	capString * " ";
+}
+
+capString * "| Log Likelihood | #prms | AIC Score | c-AIC Score | Tree Length |\n";
+sepString * "+----------------+-------+-----------+-------------+-------------+\n";
+sepString * 0;
+capString * 0;
+
+branchLengthStash = 0;
+
+SKIP_MODEL_PARAMETER_LIST = 0;
+
+#include "TemplateModels/modelParameters2.mdl";
+if (modelType == 1)
+{
+	#include "TemplateModels/defineGamma.mdl";
+}
+
+if (modelType == 2)
+{
+	#include "TemplateModels/defineHM.mdl";
+}
+SKIP_MODEL_PARAMETER_LIST = 1;
+
+SetDialogPrompt ("Please load an amino-acid data file:");
+
+DataSet ds = ReadDataFile (PROMPT_FOR_FILE);
+DataSetFilter filteredData = CreateFilter (ds,1);
+
+fprintf (stdout,"\nRunning aminoacid model comparisons on ", LAST_FILE_PATH, "\n\nThe alignment has ",ds.species, " sequences and ", ds.sites, " sites\n");
+
+_DO_TREE_REBALANCE_ = 1;
+
+#include "queryTree.bf";
+
+resultMatrix = {modelCount, 5};
+
+fprintf (stdout, "\n",sepString,capString,sepString);
+
+bestAIC 	= 1e100;
+bestCAIC	= 1e100;
+bestAICidx	= 0;
+bestCAICidx = -1;
+
+for (mid=0; mid<modelCount; mid=mid+1)
+{
+	runAModel (modelMatrixList[mid][0], modelMatrixList[mid][1], 0+modelMatrixList[mid][2], mid);
+}	
+
+fprintf (stdout, "\n\nBest AIC model:\n\t", modelMatrixList[bestAICidx][0], " with the score of ", bestAIC);
+
+if (bestCAICidx>=0)
+{
+	fprintf (stdout, "\n\nBest c-AIC model:\n\t", modelMatrixList[bestCAICidx][0], " with the score of ", bestCAIC);
+}
+
+labelMatrix  = {{"Log-likelihood","Parameters","AIC","c-AIC","Total tree length",""}};
+
+aaString = "Model";
+
+for (fC = 0; fC < modelCount; fC = fC+1)
+{
+	aaString = aaString + ";" + modelMatrixList[fC][0];
+}
+
+USE_LAST_RESULTS = 0;
+
+labelMatrix[5] = aaString;
+skipCodeSelectionStep = 0;
+OpenWindow (CHARTWINDOW,{{"Model Fits"}
+						   {"labelMatrix"},
+						   {"resultMatrix"},
+						   {"Bar Chart"},
+						   {"Index"},
+						   {"c-AIC"},
+						   {"Model Index"},
+						   {""},
+						   {"AIC"}
+						   },
+						   "SCREEN_WIDTH-60;SCREEN_HEIGHT-60;30;30");

samples/HyPhy/MatrixIndexing.bf

@@ -0,0 +1 @@
+fprintf (stdout, "\n1). Spawning a zero-populated 5x6 matrix and setting it's values to random numbers in [0,1].\n");

samples/HyPhy/MolecularClock.bf

@@ -0,0 +1,147 @@
+#include "molclockBootstrap.bf";
+
+RESTORE_GLOBALS 	= 1;
+_DO_TREE_REBALANCE_ = 0;
+VERBOSITY_LEVEL     = -1;
+
+function RestoreGlobalValues (lfIndex)
+{
+	if (lfIndex==0)
+	{
+		for (i=0;i<SAVE_GLOBALS;i=i+1)
+		{
+			SetParameter (lf,i,globalSpoolMatrix[i]);
+		}
+	}
+	if (lfIndex==1)
+	{
+		for (i=0;i<SAVE_GLOBALS2;i=i+1)
+		{
+			SetParameter (lfConstrained,i,globalSpoolMatrix2[i]);
+		}
+	}
+	return 0;
+}
+
+
+
+fprintf(stdout,"\n ---- RUNNING MOLECULAR CLOCK ANALYSIS ---- \n");
+
+ChoiceList (dataType,"Data type",1,SKIP_NONE,"Nucleotide/Protein","Nucleotide or amino-acid (protein).",
+				     "Codon","Codon (several available genetic codes).");
+
+if (dataType<0) 
+{
+	return;
+}
+if (dataType)
+{
+	NICETY_LEVEL = 3;
+	#include "TemplateModels/chooseGeneticCode.def";
+}
+
+SetDialogPrompt ("Choose the data file:");
+
+DataSet ds = ReadDataFile (PROMPT_FOR_FILE);
+
+fprintf (stdout,"The following data was read:\n",ds,"\n");
+
+if (dataType)
+{
+	DataSetFilter filteredData = CreateFilter (ds,3,"","",GeneticCodeExclusions);
+}
+else
+{
+	DataSetFilter filteredData = CreateFilter (ds,1);
+}
+
+SelectTemplateModel(filteredData);
+
+#include "queryTree.bf";
+
+global RelRatio;
+
+RelRatio = 1.0;
+
+relationString = ":=RelRatio*";
+
+parameter2Constrain = 0;
+
+if (Rows("LAST_MODEL_PARAMETER_LIST")>1)
+{
+	ChoiceList (parameter2Constrain, "Parameter(s) to constrain:",1,SKIP_NONE,LAST_MODEL_PARAMETER_LIST);
+
+	if (parameter2Constrain<0)
+	{
+		return;
+	}
+	if (parameter2Constrain==0)
+	{
+		parameter2ConstrainString = "";
+		for (parameter2Constrain=Rows("LAST_MODEL_PARAMETER_LIST")-1; parameter2Constrain; parameter2Constrain = parameter2Constrain-1)
+		{
+			GetString (funnyString,LAST_MODEL_PARAMETER_LIST,parameter2Constrain);
+			parameter2ConstrainString = parameter2ConstrainString + funnyString + ",";
+		}
+		GetString (funnyString,LAST_MODEL_PARAMETER_LIST,0);
+		parameter2ConstrainString = parameter2ConstrainString + funnyString;
+	}
+	else
+	{
+		GetString (parameter2ConstrainString,LAST_MODEL_PARAMETER_LIST,parameter2Constrain-1);
+	}
+}
+else
+{
+	GetString (parameter2ConstrainString,LAST_MODEL_PARAMETER_LIST,0);
+}
+
+timer = Time(0);
+
+LikelihoodFunction lf = (filteredData,givenTree);
+
+Optimize (res,lf);
+
+separator = "*-----------------------------------------------------------*";
+
+fprintf (stdout, "\n", separator, "\nRESULTS WITHOUT THE CLOCK:\n",lf);
+
+fullModelLik = res[1][0];
+
+fullVars = res[1][1];
+
+/* now specify the constraint */
+
+Tree clockTree = treeString;
+
+ExecuteCommands ("MolecularClock (clockTree,"+parameter2ConstrainString+");");
+
+LikelihoodFunction lfConstrained = (filteredData, clockTree);
+
+USE_LAST_RESULTS = 1;
+Optimize (res1,lfConstrained);
+USE_LAST_RESULTS = 0;
+
+SAVE_GLOBALS = res1[1][2];
+
+if (SAVE_GLOBALS)
+{
+	globalSpoolMatrix = {1,SAVE_GLOBALS};
+
+	for (i=0;i<SAVE_GLOBALS;i=i+1)
+	{
+		globalSpoolMatrix[i]=res1[0][i];
+	}
+}
+
+fprintf (stdout, "\n", separator,"\n\nRESULTS WITH THE CLOCK:\n",lfConstrained);
+
+lnLikDiff = 2(fullModelLik-res1[1][0]);
+
+degFDiff = fullVars - res1[1][1];
+
+fprintf (stdout, "\n", separator,"\n\n-2(Ln Likelihood Ratio)=",lnLikDiff,"\n","Constrained parameters:",Format(degFDiff,0,0));
+
+fprintf (stdout, "\nP-Value:",1-CChi2(lnLikDiff,degFDiff));
+
+fprintf (stdout, "\nCPU time taken: ", Time(0)-timer, " seconds.\n");

samples/HyPhy/profile_test.bf

@@ -0,0 +1 @@
+#profile START;

samples/INI/MouseKeyboard.pro

@@ -0,0 +1,71 @@
+update=Sun 15 Feb 2015 01:10:10 PM EST
+last_client=eeschema
+[pcbnew]
+version=1
+PageLayoutDescrFile=
+LastNetListRead=
+UseCmpFile=1
+PadDrill=0.6
+PadDrillOvalY=0.6
+PadSizeH=1.5
+PadSizeV=1.5
+PcbTextSizeV=1.5
+PcbTextSizeH=1.5
+PcbTextThickness=0.3
+ModuleTextSizeV=1
+ModuleTextSizeH=1
+ModuleTextSizeThickness=0.15
+SolderMaskClearance=0
+SolderMaskMinWidth=0
+DrawSegmentWidth=0.2
+BoardOutlineThickness=0.09999999999999999
+ModuleOutlineThickness=0.15
+[pcbnew/libraries]
+LibDir=
+[general]
+version=1
+[eeschema]
+version=1
+PageLayoutDescrFile=
+SubpartIdSeparator=0
+SubpartFirstId=65
+LibDir=/home/hschmale/KiCad/LibMods-3rdParty
+NetFmtName=
+RptD_X=0
+RptD_Y=100
+RptLab=1
+LabSize=60
+[eeschema/libraries]
+LibName1=power
+LibName2=device
+LibName3=transistors
+LibName4=conn
+LibName5=linear
+LibName6=regul
+LibName7=74xx
+LibName8=cmos4000
+LibName9=adc-dac
+LibName10=memory
+LibName11=xilinx
+LibName12=special
+LibName13=microcontrollers
+LibName14=dsp
+LibName15=microchip
+LibName16=analog_switches
+LibName17=motorola
+LibName18=texas
+LibName19=intel
+LibName20=audio
+LibName21=interface
+LibName22=digital-audio
+LibName23=philips
+LibName24=display
+LibName25=cypress
+LibName26=siliconi
+LibName27=opto
+LibName28=atmel
+LibName29=contrib
+LibName30=valves
+LibName31=arduino_shieldsNCL
+LibName32=con-usb-2
+LibName33=2axispotwselect

samples/JFlex/LexScan.flex

@@ -0,0 +1,742 @@
+/* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
+ * JFlex 1.7.0-SNAPSHOT                                                    *
+ * Copyright (C) 1998-2015  Gerwin Klein <lsf@jflex.de>                    *
+ * All rights reserved.                                                    *
+ *                                                                         *
+ * License: BSD                                                            *
+ *                                                                         *
+ * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * */
+
+package jflex;
+
+import java_cup.runtime.Symbol;
+import java.io.*;
+import java.util.Stack;
+import java.util.ArrayList;
+import java.util.List;
+import java.util.Map;
+import java.util.HashMap;
+import jflex.unicode.UnicodeProperties;
+
+%%
+
+%final
+%public
+%class LexScan
+%implements sym, java_cup.runtime.Scanner
+%function next_token
+
+%type Symbol
+%unicode
+
+%column
+%line
+
+%eofclose
+
+%state COMMENT, STATELIST, MACROS, REGEXPSTART
+%state REGEXP, JAVA_CODE, STATES, STRING_CONTENT
+%state CHARCLASS, COPY, REPEATEXP, EATWSPNL
+%state CTOR_ARG, REGEXP_CODEPOINT_SEQUENCE
+%state STRING_CODEPOINT_SEQUENCE, CHARCLASS_CODEPOINT
+
+%inputstreamctor false
+
+%cupdebug
+
+%{
+  int balance = 0;
+  int commentbalance = 0;
+  int action_line = 0;
+  int bufferSize = 16384;
+
+  File file;
+  Stack<File> files = new Stack<File>();
+
+  StringBuilder userCode   = new StringBuilder();
+
+  String classCode;
+  String initCode;
+  String initThrow;
+  String eofCode;
+  String eofThrow;
+  String lexThrow;
+  String eofVal;
+  String scanErrorException;
+  String cupSymbol = "sym";
+
+  StringBuilder actionText = new StringBuilder();
+  StringBuilder string     = new StringBuilder();
+
+  private UnicodeProperties unicodeProperties;
+
+  boolean charCount;
+  boolean lineCount;
+  boolean columnCount;
+  boolean cupCompatible;
+  boolean cup2Compatible;
+  boolean cupDebug;
+  boolean isInteger;
+  boolean isIntWrap;
+  boolean isYYEOF;
+  boolean notUnix;
+  boolean isPublic;
+  boolean isFinal;
+  boolean isAbstract;
+  boolean bolUsed;
+  boolean standalone;
+  boolean debugOption;
+  boolean caseless;
+  boolean inclusive_states;
+  boolean eofclose;
+  boolean isASCII;
+  // TODO: In the version of JFlex after 1.6, the InputStream ctor 
+  // TODO: will never be emitted, and this option will cease to exist.
+  boolean emitInputStreamCtor = Options.emitInputStreamCtor;
+
+  String isImplementing;
+  String isExtending;
+  String className = "Yylex";
+  String functionName;
+  String tokenType;
+  String visibility = "public";
+    
+  List<String> ctorArgs = new ArrayList<String>();
+  List<String> ctorTypes = new ArrayList<String>();
+    
+  LexicalStates states = new LexicalStates();
+
+  List<Action> actions = new ArrayList<Action>();
+
+  private int nextState;
+
+  boolean macroDefinition;
+
+  Timer t = new Timer();
+
+  // CharClasses.init() is delayed until UnicodeProperties.init() has been called,
+  // since the max char code won't be known until then.
+  private CharClasses charClasses = new CharClasses();
+  
+  public CharClasses getCharClasses() {
+    return charClasses;
+  }
+
+  public int currentLine() {
+    return yyline;
+  }
+
+  public void setFile(File file) {
+    this.file = file;
+  }
+
+  private Symbol symbol(int type, Object value) {
+    return new Symbol(type, yyline, yycolumn, value);
+  }
+
+  private Symbol symbol(int type) {
+    return new Symbol(type, yyline, yycolumn);
+  }
+
+  // updates line and column count to the beginning of the first
+  // non whitespace character in yytext, but leaves yyline+yycolumn
+  // untouched
+  private Symbol symbol_countUpdate(int type, Object value) {
+     int lc = yyline;
+     int cc = yycolumn;
+     String text = yytext();
+
+     for (int i=0; i < text.length(); i++) {
+      char c = text.charAt(i);
+
+      if (c != '\n' && c != '\r' && c != ' ' && c != '\t' )
+        return new Symbol(type, lc, cc, value);
+
+      if (c == '\n') {
+        lc++;
+        cc = 0;
+      }
+      else
+        cc++;
+    }
+
+    return new Symbol(type, yyline, yycolumn, value);
+  }
+
+  private String makeMacroIdent() {
+    String matched = yytext().trim();
+    return matched.substring(1, matched.length()-1).trim();
+  }
+
+  public static String conc(Object a, Object b) {
+    if (a == null && b == null) return null;
+    if (a == null) return b.toString();
+    if (b == null) return a.toString();
+
+    return a.toString()+b.toString();
+  }
+
+  public static String concExc(Object a, Object b) {
+    if (a == null && b == null) return null;
+    if (a == null) return b.toString();
+    if (b == null) return a.toString();
+
+    return a.toString()+", "+b.toString();
+  }
+  
+  public UnicodeProperties getUnicodeProperties() {
+    return unicodeProperties;
+  }
+  
+  private void populateDefaultVersionUnicodeProperties() {
+    try {
+      unicodeProperties = new UnicodeProperties();
+    } catch (UnicodeProperties.UnsupportedUnicodeVersionException e) {
+      throw new ScannerException
+        (file, ErrorMessages.UNSUPPORTED_UNICODE_VERSION, yyline);
+    }
+    charClasses.init
+      (Options.jlex ? 127 : unicodeProperties.getMaximumCodePoint(), this);
+  }
+  
+  private void includeFile(String filePath) {
+    File f = new File(file.getParentFile(), filePath);
+    if ( !f.canRead() )
+      throw new ScannerException(file,ErrorMessages.NOT_READABLE, yyline);
+    // check for cycle
+    if (files.search(f) > 0)
+      throw new ScannerException(file,ErrorMessages.FILE_CYCLE, yyline);
+    try {
+      yypushStream( new FileReader(f) );
+      files.push(file);
+      file = f;
+      Out.println("Including \""+file+"\"");
+    }
+    catch (FileNotFoundException e) {
+      throw new ScannerException(file,ErrorMessages.NOT_READABLE, yyline);
+    }
+  }
+%}
+
+%init{
+  states.insert("YYINITIAL", true);
+%init}
+
+
+Digit      = [0-9]
+HexDigit   = [0-9a-fA-F]
+OctDigit   = [0-7]
+
+Number     = {Digit}+
+HexNumber  = \\ x {HexDigit} {2}
+OctNumber  = \\ [0-3]? {OctDigit} {1, 2}
+
+// Unicode4 can encode chars only in the BMP with the 16 bits provided by its
+// 4 hex digits.
+Unicode4  = \\ u {HexDigit} {4}
+
+// Unicode6 can encode all Unicode chars, both in the BMP and in the
+// supplementary planes -- only 21 bits are required as of Unicode 5.0,
+// but its six hex digits provide 24 bits.
+Unicode6  = \\ U {HexDigit} {6}
+
+// see http://www.unicode.org/unicode/reports/tr18/
+WSP        = [ \t\b]
+WSPNL      = [\u2028\u2029\u000A\u000B\u000C\u000D\u0085\t\b\ ]
+NWSPNL     = [^\u2028\u2029\u000A\u000B\u000C\u000D\u0085\t\b\ ]
+NL         = [\u2028\u2029\u000A\u000B\u000C\u000D\u0085] | \u000D\u000A
+NNL        = [^\u2028\u2029\u000A\u000B\u000C\u000D\u0085]
+
+Ident      = {IdentStart} {IdentPart}*
+QualIdent  = {Ident} ( {WSP}* "." {WSP}* {Ident} )*
+QUIL       = {QualIdent} ( {WSP}* "," {WSP}* {QualIdent} )*
+Array      = "[" {WSP}* "]"
+ParamPart  = {IdentStart}|{IdentPart}|"<"|">"|","|{WSP}|"&"|"?"|"."
+GenParam   = "<" {ParamPart}+ ">"
+ClassT     = {Ident} ({WSP}* {GenParam})?
+QClassT    = {QualIdent} ({WSP}* {GenParam})?
+ArrType    = ({GenParam} {WSP}*)? {QClassT} ({WSP}* {Array})*
+
+IdentStart = [:jletter:]
+IdentPart  = [:jletterdigit:]
+
+JFlexCommentChar = [^*/]|"/"+[^*/]|"*"+[^*/]
+JFlexComment = {JFlexCommentChar}+
+
+/* Java comments */
+JavaComment = {TraditionalComment}|{EndOfLineComment}
+TraditionalComment = "/*"{CommentContent}\*+"/"
+EndOfLineComment = "//".*{NL}
+
+CommentContent = ([^*]|\*+[^*/])*
+
+StringCharacter = [^\u2028\u2029\u000A\u000B\u000C\u000D\u0085\"\\]
+
+CharLiteral = \'([^\u2028\u2029\u000A\u000B\u000C\u000D\u0085\'\\]|{EscapeSequence})\'
+StringLiteral = \"({StringCharacter}|{EscapeSequence})*\"
+
+EscapeSequence = \\[^\u2028\u2029\u000A\u000B\u000C\u000D\u0085]|\\+u{HexDigit}{4}|\\[0-3]?{OctDigit}{1,2}
+
+/* \\(b|t|n|f|r|\"|\'|\\|[0-3]?{OctDigit}{1,2}|u{HexDigit}{4}) */
+
+JavaRest = [^\{\}\"\'/]|"/"[^*/]
+JavaCode = ({JavaRest}|{StringLiteral}|{CharLiteral}|{JavaComment})+
+
+DottedVersion =  [1-9][0-9]*(\.[0-9]+){0,2}
+
+%%
+
+<YYINITIAL> {
+  "%%".*{NL}?              {
+                             t.start();
+                             yybegin(MACROS);
+                             macroDefinition = true;
+                             return symbol(USERCODE,userCode);
+                           }
+  .*{NL} | .+              { userCode.append(yytext()); }
+  <<EOF>>                  { return symbol(EOF); }
+}
+
+<MACROS>   ("%{"|"%init{"|"%initthrow{"|"%eof{"|"%eofthrow{"|"%yylexthrow{"|"%eofval{").*{NL}
+                                     { string.setLength(0); yybegin(COPY); }
+<COPY> {
+  "%}".*{NL}                    { classCode = conc(classCode,string);  yybegin(MACROS);  }
+  "%init}".*{NL}                { initCode = conc(initCode,string);    yybegin(MACROS);  }
+  "%initthrow}".*{NL}           { initThrow = concExc(initThrow,string);  yybegin(MACROS); }
+  "%eof}".*{NL}                 { eofCode = conc(eofCode,string); yybegin(MACROS); }
+  "%eofthrow}".*{NL}            { eofThrow = concExc(eofThrow,string); yybegin(MACROS); }
+  "%yylexthrow}".*{NL}          { lexThrow = concExc(lexThrow,string); yybegin(MACROS); }
+  "%eofval}".*{NL}              { eofVal = string.toString(); yybegin(MACROS); }
+
+  .*{NL}                        { string.append(yytext()); }
+
+  <<EOF>>                       { throw new ScannerException(file,ErrorMessages.EOF_IN_MACROS); }
+}
+
+
+<MACROS> ^"%s" ("tate" "s"?)? {WSP}+   { inclusive_states = true; yybegin(STATELIST); }
+<MACROS> ^"%x" ("state" "s"?)? {WSP}+  { inclusive_states = false; yybegin(STATELIST); }
+<STATELIST> {
+  {Ident}                             { states.insert(yytext(),inclusive_states); }
+  ([\ \t]*","[\ \t]*)|([\ \t]+)       { }
+  {NL}                                { yybegin(MACROS);  }
+  <<EOF>>                       { throw new ScannerException(file,ErrorMessages.EOF_IN_MACROS); }
+}
+
+<MACROS> {
+  "%char"                     { charCount = true;  }
+  "%line"                     { lineCount = true;  }
+  "%column"                   { columnCount = true; }
+  "%byaccj"                   { isInteger = true;
+                                if (eofVal == null)
+                                  eofVal = "return 0;";
+                                eofclose = true;
+                              }
+  "%cup2"                     { cup2Compatible = true;
+                                isImplementing = concExc(isImplementing, "Scanner");
+                                lineCount = true;
+                                columnCount = true;
+                                if (functionName == null)
+                                  functionName = "readNextTerminal";
+                                if (tokenType == null)
+                                  tokenType = "ScannerToken<? extends Object>";
+                                if (eofVal == null)
+                                  eofVal = "return token(SpecialTerminals.EndOfInputStream);";
+                                if (!Options.jlex) eofclose = true;
+                                return symbol(UNICODE); // %unicode
+                              }
+  "%cup"                      { cupCompatible = true;
+                                isImplementing = concExc(isImplementing, "java_cup.runtime.Scanner");
+                                if (functionName == null)
+                                  functionName = "next_token";
+                                if (tokenType == null)
+                                  tokenType = "java_cup.runtime.Symbol";
+                                if (eofVal == null)
+                                  eofVal = "return new java_cup.runtime.Symbol("+cupSymbol+".EOF);";
+                                if (!Options.jlex) eofclose = true;
+                              }
+  "%cupsym"{WSP}+{QualIdent} {WSP}*  { cupSymbol = yytext().substring(8).trim();
+                                if (cupCompatible) Out.warning(ErrorMessages.CUPSYM_AFTER_CUP, yyline); }
+  "%cupsym"{WSP}+{NNL}*       { throw new ScannerException(file,ErrorMessages.QUIL_CUPSYM, yyline); }
+  "%cupdebug"                 { cupDebug = true; }
+  "%eofclose"({WSP}+"true")?  { eofclose = true; }
+  "%eofclose"({WSP}+"false")  { eofclose = false; }
+  "%class"{WSP}+{ClassT} {WSP}*     { className = yytext().substring(7).trim();  }
+  "%ctorarg"{WSP}+{ArrType}{WSP}+   { yybegin(CTOR_ARG); ctorTypes.add(yytext().substring(8).trim()); }
+  "%function"{WSP}+{Ident} {WSP}*   { functionName = yytext().substring(10).trim(); }
+  "%type"{WSP}+{ArrType} {WSP}*     { tokenType = yytext().substring(6).trim(); }
+  "%integer"|"%int"           { isInteger = true;  }
+  "%intwrap"                  { isIntWrap = true;  }
+  "%yyeof"                    { isYYEOF = true;  }
+  "%notunix"                  { notUnix = true;  }
+  "%7bit"                     { isASCII = true; return symbol(ASCII); }
+  "%full"|"%8bit"             { return symbol(FULL); }
+  "%16bit"                    { populateDefaultVersionUnicodeProperties();
+                                return symbol(UNICODE);
+                              }
+  "%unicode"({WSP}+{DottedVersion})? { String v = yytext().substring(8).trim();
+                                       if (v.length() == 0) {
+                                         populateDefaultVersionUnicodeProperties();
+                                       } else {
+                                         try {
+                                           unicodeProperties = new UnicodeProperties(v);
+                                         } catch (UnicodeProperties.UnsupportedUnicodeVersionException e) {
+                                           throw new ScannerException
+                                             (file, ErrorMessages.UNSUPPORTED_UNICODE_VERSION, yyline);
+                                         }
+                                         charClasses.init
+                                           (Options.jlex ? 127 : unicodeProperties.getMaximumCodePoint(), this);
+                                       }
+                                       return symbol(UNICODE);
+                                     }
+
+  "%caseless"|"%ignorecase"   { caseless = true; }
+  "%implements"{WSP}+.*       { isImplementing = concExc(isImplementing, yytext().substring(12).trim());  }
+  "%extends"{WSP}+{QClassT}{WSP}* { isExtending = yytext().substring(9).trim(); }
+  "%public"                   { isPublic = true; }
+  "%apiprivate"               { visibility = "private"; Skeleton.makePrivate(); }
+  "%final"                    { isFinal = true; }
+  "%abstract"                 { isAbstract = true; }
+  "%debug"                    { debugOption = true; }
+  "%standalone"               { standalone = true; isInteger = true; }
+  "%pack"                     { /* no-op - this is the only generation method */ }
+  "%include" {WSP}+ .*        { includeFile(yytext().substring(9).trim()); }
+  "%buffer" {WSP}+ {Number} {WSP}*   { bufferSize = Integer.parseInt(yytext().substring(8).trim()); }
+  "%buffer" {WSP}+ {NNL}*     { throw new ScannerException(file,ErrorMessages.NO_BUFFER_SIZE, yyline); }
+  "%initthrow" {WSP}+ {QUIL} {WSP}* { initThrow = concExc(initThrow,yytext().substring(11).trim()); }
+  "%initthrow" {WSP}+ {NNL}*  { throw new ScannerException(file,ErrorMessages.QUIL_INITTHROW, yyline); }
+  "%eofthrow"  {WSP}+ {QUIL} {WSP}*  { eofThrow = concExc(eofThrow,yytext().substring(10).trim()); }
+  "%eofthrow"  {WSP}+ {NNL}*  { throw new ScannerException(file,ErrorMessages.QUIL_EOFTHROW, yyline); }
+  "%yylexthrow"{WSP}+ {QUIL} {WSP}*  { lexThrow = concExc(lexThrow,yytext().substring(12).trim()); }
+  "%throws"    {WSP}+ {QUIL} {WSP}*  { lexThrow = concExc(lexThrow,yytext().substring(8).trim()); }
+  "%yylexthrow"{WSP}+ {NNL}*  { throw new ScannerException(file,ErrorMessages.QUIL_YYLEXTHROW, yyline); }
+  "%throws"    {WSP}+ {NNL}*  { throw new ScannerException(file,ErrorMessages.QUIL_THROW, yyline); }
+  "%scanerror" {WSP}+ {QualIdent} {WSP}* { scanErrorException = yytext().substring(11).trim(); }
+  "%scanerror" {WSP}+ {NNL}*  { throw new ScannerException(file,ErrorMessages.QUIL_SCANERROR, yyline); }
+// TODO: In the version of JFlex after 1.6, the %inputstreamctor directive will become a no-op: the InputStream ctor will never be emitted.  
+  "%inputstreamctor"({WSP}+"true")? { emitInputStreamCtor = true; }  
+  "%inputstreamctor"{WSP}+"false"   { emitInputStreamCtor = false; }
+
+  {Ident}                     { return symbol(IDENT, yytext()); }
+  "="{WSP}*                   { if (null == unicodeProperties && ! isASCII) {
+                                  populateDefaultVersionUnicodeProperties();
+                                }
+                                yybegin(REGEXP); 
+                                return symbol(EQUALS); 
+                              }
+
+  "/*"                        { nextState = MACROS; yybegin(COMMENT); }
+
+  {EndOfLineComment}          { }
+
+  ^"%%" {NNL}*                { if (null == unicodeProperties && ! isASCII) {
+                                  populateDefaultVersionUnicodeProperties();
+                                }
+                                macroDefinition = false; 
+                                yybegin(REGEXPSTART);
+                                return symbol(DELIMITER); 
+                              }
+  "%"{Ident}                  { throw new ScannerException(file,ErrorMessages.UNKNOWN_OPTION, yyline, yycolumn); }
+  "%"                         { throw new ScannerException(file,ErrorMessages.UNKNOWN_OPTION, yyline, yycolumn); }
+  ^{WSP}+"%"                  { Out.warning(ErrorMessages.NOT_AT_BOL, yyline); yypushback(1); }
+
+  {WSP}+                      { }
+  {NL}+                       { }
+  <<EOF>>                     { if ( yymoreStreams() ) {
+                                  file = (File) files.pop();
+                                  yypopStream();
+                                }
+                                else
+                                  throw new ScannerException(file,ErrorMessages.EOF_IN_MACROS);
+                              }
+}
+
+<CTOR_ARG> {
+  {Ident} {WSP}*   { yybegin(MACROS); ctorArgs.add(yytext().trim()); }
+  [^]              { throw new ScannerException(file,ErrorMessages.CTOR_ARG,yyline,yycolumn); }
+}
+
+<REGEXPSTART> {
+  ^ {WSP}* "%include" {WSP}+ .*  { includeFile(yytext().trim().substring(9).trim()); }
+  {WSP}* "/*"                    { nextState = REGEXPSTART; yybegin(COMMENT); }
+  {WSP}* "<"                     { yybegin(STATES); return symbol_countUpdate(LESSTHAN, null); }
+  {WSP}* "}"                     { return symbol_countUpdate(RBRACE, null); }
+  {WSP}* "//" {NNL}*             { }
+  {WSP}* "<<EOF>>" {WSPNL}* "{"  { actionText.setLength(0); yybegin(JAVA_CODE);
+                                   Symbol s = symbol_countUpdate(EOFRULE, null);
+                                   action_line = s.left+1;
+                                   return s;
+                                 }
+  ^ {WSP}* {NWSPNL}              { yypushback(yylength()); yybegin(REGEXP); }
+  {WSP} | {NL}                   { }
+}
+
+<STATES> {
+  {Ident}                     { return symbol(IDENT, yytext()); }
+  ","                         { return symbol(COMMA); }
+  {WSPNL}+                    { }
+
+  // "{" will be caught in REGEXP
+  ">"{WSPNL}*                 { yybegin(REGEXP); return symbol(MORETHAN); }
+
+  <<EOF>>                     { throw new ScannerException(file,ErrorMessages.EOF_IN_STATES); }
+}
+
+
+<REGEXP> {
+  "<<EOF>>" {WSPNL}+ "{"  { actionText.setLength(0); yybegin(JAVA_CODE); action_line = yyline+1; return symbol(EOFRULE); }
+  "<<EOF>>"               { throw new ScannerException(file,ErrorMessages.EOF_WO_ACTION); }
+
+  {WSPNL}*"|"{WSP}*$      { if (macroDefinition) {
+                              yybegin(EATWSPNL);
+                              return symbol(BAR);
+                            }
+                            else {
+                              yybegin(REGEXPSTART);
+                              return symbol(NOACTION);
+                            }
+                          }
+
+  // stategroup
+  "{"            { yybegin(REGEXPSTART); return symbol(LBRACE); }
+
+  {WSPNL}*"|"    { return symbol(BAR); }
+
+  {WSPNL}*\"     { string.setLength(0); nextState = REGEXP; yybegin(STRING_CONTENT); }
+  {WSPNL}*"\\u{" { string.setLength(0); yybegin(REGEXP_CODEPOINT_SEQUENCE); }
+  {WSPNL}*"!"    { return symbol(BANG); }
+  {WSPNL}*"~"    { return symbol(TILDE); }
+  {WSPNL}*"("    { return symbol(OPENBRACKET); }
+  {WSPNL}*")"    { return symbol(CLOSEBRACKET); }
+  {WSPNL}*"*"    { return symbol(STAR); }
+  {WSPNL}*"+"    { return symbol(PLUS); }
+  {WSPNL}*"?"    { return symbol(QUESTION); }
+  {WSPNL}*"$"    { return symbol(DOLLAR); }
+  {WSPNL}*"^"    { bolUsed = true; return symbol(HAT); }
+  {WSPNL}*"."    { return symbol(POINT); }
+  {WSPNL}*"\\R"  { return symbol(NEWLINE); }
+  {WSPNL}*"["    { yybegin(CHARCLASS); return symbol(OPENCLASS); }
+  {WSPNL}*"/"    { return symbol(LOOKAHEAD); }
+  
+  {WSPNL}* "{" {WSP}* {Ident} {WSP}* "}" { return symbol_countUpdate(MACROUSE, makeMacroIdent()); }
+  {WSPNL}* "{" {WSP}* {Number}   { yybegin(REPEATEXP); 
+                                   return symbol(REPEAT, 
+                                                 new Integer(yytext().trim().substring(1).trim())); 
+                                 }
+
+  {WSPNL}+ "{"    { actionText.setLength(0); yybegin(JAVA_CODE); action_line = yyline+1; return symbol(REGEXPEND); }
+  {NL}            { if (macroDefinition) { yybegin(MACROS); } return symbol(REGEXPEND); }
+
+  {WSPNL}*"/*"    { nextState = REGEXP; yybegin(COMMENT); }
+
+  {WSPNL}*"//"{NNL}*  { }
+
+  {WSP}+          { }
+
+  <CHARCLASS> {
+    {WSPNL}*"[:jletter:]"      { return symbol(JLETTERCLASS); }
+    {WSPNL}*"[:jletterdigit:]" { return symbol(JLETTERDIGITCLASS); }
+    {WSPNL}*"[:letter:]"       { return symbol(LETTERCLASS); }
+    {WSPNL}*"[:uppercase:]"    { return symbol(UPPERCLASS); }
+    {WSPNL}*"[:lowercase:]"    { return symbol(LOWERCLASS); }
+    {WSPNL}*"[:digit:]"        { return symbol(DIGITCLASS); }
+    {WSPNL}*"\\d"              { return symbol(DIGITCLASS); }
+    {WSPNL}*"\\D"              { return symbol(DIGITCLASSNOT); }
+    {WSPNL}*"\\s"              { return symbol(WHITESPACECLASS); }
+    {WSPNL}*"\\S"              { return symbol(WHITESPACECLASSNOT); }
+    {WSPNL}*"\\w"              { return symbol(WORDCLASS); }
+    {WSPNL}*"\\W"              { return symbol(WORDCLASSNOT); }
+    {WSPNL}*"\\p{"[^}]*"}"     { String trimmedText = yytext().trim();
+                                 String propertyValue = trimmedText.substring(3,trimmedText.length()-1);
+                                 IntCharSet set = unicodeProperties.getIntCharSet(propertyValue);
+                                 if (null == set) {
+                                   throw new ScannerException(file,ErrorMessages.INVALID_UNICODE_PROPERTY, yyline, yycolumn + 3);
+                                 }
+                                 return symbol(UNIPROPCCLASS, set);
+                               }
+    {WSPNL}*"\\P{"[^}]*"}"     { String trimmedText = yytext().trim();
+                                 String propertyValue = trimmedText.substring(3,trimmedText.length()-1);
+                                 IntCharSet set = unicodeProperties.getIntCharSet(propertyValue);
+                                 if (null == set) {
+                                   throw new ScannerException(file,ErrorMessages.INVALID_UNICODE_PROPERTY, yyline, yycolumn + 3);
+                                 }
+                                 return symbol(UNIPROPCCLASSNOT, set);
+                               }
+  }
+
+  . { return symbol(CHAR, yytext().codePointAt(0)); }
+}
+
+<EATWSPNL> {WSPNL}+  { yybegin(REGEXP); }
+
+
+<REPEATEXP> {
+  "}"          { yybegin(REGEXP); return symbol(RBRACE); }
+  "," {WSP}* {Number}  { return symbol(REPEAT, new Integer(yytext().substring(1).trim())); }
+  {WSP}+       { }
+
+  <<EOF>>                 { throw new ScannerException(file,ErrorMessages.EOF_IN_REGEXP); }
+}
+
+<CHARCLASS> {
+  "{"{Ident}"}" { return symbol(MACROUSE, yytext().substring(1,yylength()-1)); }
+  "["     { balance++; return symbol(OPENCLASS); }
+  "]"     { if (balance > 0) balance--; else yybegin(REGEXP); return symbol(CLOSECLASS); }
+  "^"     { return symbol(HAT); }
+  "-"     { return symbol(DASH); }
+  "--"    { return symbol(DIFFERENCE); }
+  "&&"    { return symbol(INTERSECTION); }
+  "||"    { /* union is the default operation - '||' can be ignored */ }
+  "~~"    { return symbol(SYMMETRICDIFFERENCE); }
+  "\\u{"  { yybegin(CHARCLASS_CODEPOINT); }
+
+  // this is a hack to keep JLex compatibilty with char class
+  // expressions like [+-]
+  "-]"    { yypushback(1); yycolumn--; return symbol(CHAR, (int)'-'); }
+
+  \"      { string.setLength(0); nextState = CHARCLASS; yybegin(STRING_CONTENT); }
+
+  .       { return symbol(CHAR, yytext().codePointAt(0)); }
+
+  \n      { throw new ScannerException(file,ErrorMessages.EOL_IN_CHARCLASS,yyline,yycolumn); }
+
+  <<EOF>> { throw new ScannerException(file,ErrorMessages.EOF_IN_REGEXP); }
+}
+
+<STRING_CONTENT> {
+  \"       { yybegin(nextState); return symbol(STRING, string.toString()); }
+  \\\"     { string.append('\"'); }
+  [^\"\\\u2028\u2029\u000A\u000B\u000C\u000D\u0085]+ { string.append(yytext()); }
+
+  {NL}     { throw new ScannerException(file,ErrorMessages.UNTERMINATED_STR, yyline, yycolumn); }
+
+  {HexNumber} { string.append( (char) Integer.parseInt(yytext().substring(2,yylength()), 16)); }
+  {OctNumber} { string.append( (char) Integer.parseInt(yytext().substring(1,yylength()), 8)); }
+  {Unicode4}  { string.append( (char) Integer.parseInt(yytext().substring(2,yylength()), 16)); }
+  {Unicode6}  { int codePoint = Integer.parseInt(yytext().substring(2,yylength()), 16);
+                if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
+                  string.append(Character.toChars(codePoint));
+                } else {
+                  throw new ScannerException(file,ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn+2);
+                }
+              }
+  
+  "\\u{"      { yybegin(STRING_CODEPOINT_SEQUENCE); }
+
+  \\b { string.append('\b'); }
+  \\n { string.append('\n'); }
+  \\t { string.append('\t'); }
+  \\f { string.append('\f'); }
+  \\r { string.append('\r'); }
+
+  \\. { string.append(yytext().substring(1, yytext().offsetByCodePoints(1, 1))); }
+
+  <<EOF>>     { throw new ScannerException(file,ErrorMessages.EOF_IN_STRING); }
+}
+
+
+<REGEXP, CHARCLASS> {
+  {HexNumber} { return symbol(CHAR, Integer.parseInt(yytext().substring(2,yylength()), 16)); }
+  {OctNumber} { return symbol(CHAR, Integer.parseInt(yytext().substring(1,yylength()), 8)); }
+  {Unicode4}  { return symbol(CHAR, Integer.parseInt(yytext().substring(2,yylength()), 16)); }
+  {Unicode6}  { int codePoint = Integer.parseInt(yytext().substring(2,yylength()), 16);
+                if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
+                  return symbol(CHAR, codePoint);
+                } else {
+                  throw new ScannerException(file,ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn+2);
+                }
+              }
+
+  \\b { return symbol(CHAR, (int)'\b'); }
+  \\n { return symbol(CHAR, (int)'\n'); }
+  \\t { return symbol(CHAR, (int)'\t'); }
+  \\f { return symbol(CHAR, (int)'\f'); }
+  \\r { return symbol(CHAR, (int)'\r'); }
+
+  \\. { return symbol(CHAR, yytext().codePointAt(1)); }
+}
+
+
+<JAVA_CODE> {
+  "{"        { balance++; actionText.append('{'); }
+  "}"        { if (balance > 0) {
+                 balance--;
+                 actionText.append('}');
+               }
+               else {
+                 yybegin(REGEXPSTART);
+                 Action a = new Action(actionText.toString(), action_line);
+                 actions.add(a);
+                 return symbol(ACTION, a);
+               }
+             }
+
+  {JavaCode}     { actionText.append(yytext()); }
+
+  <<EOF>>     { throw new ScannerException(file,ErrorMessages.EOF_IN_ACTION, action_line-1); }
+}
+
+<COMMENT> {
+
+  "/"+ "*"  { commentbalance++; }
+  "*"+ "/"  { if (commentbalance > 0)
+                commentbalance--;
+              else
+                yybegin(nextState);
+            }
+
+  {JFlexComment} { /* ignore */ }
+
+  <<EOF>>     { throw new ScannerException(file,ErrorMessages.EOF_IN_COMMENT); }
+}
+
+<REGEXP_CODEPOINT_SEQUENCE> {
+  "}"             { yybegin(REGEXP); return symbol(STRING, string.toString()); }
+  {HexDigit}{1,6} { int codePoint = Integer.parseInt(yytext(), 16);
+                    if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
+                      string.append(Character.toChars(codePoint));
+                    } else {
+                      throw new ScannerException(file,ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn);
+                    }
+                  }
+  {WSPNL}+        { }
+  <<EOF>>         { throw new ScannerException(file,ErrorMessages.EOF_IN_REGEXP); }
+}
+
+<STRING_CODEPOINT_SEQUENCE> { // Specialized form: newlines disallowed, and doesn't return a symbol
+  "}"             { yybegin(STRING_CONTENT); }
+  {HexDigit}{1,6} { int codePoint = Integer.parseInt(yytext(), 16);
+                    if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
+                      string.append(Character.toChars(codePoint));
+                    } else {
+                      throw new ScannerException(file, ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn);
+                    }
+                  }
+  {NL}            { throw new ScannerException(file,ErrorMessages.UNTERMINATED_STR, yyline, yycolumn); }
+  {WSP}+          { }
+  <<EOF>>         { throw new ScannerException(file,ErrorMessages.EOF_IN_STRING); }
+}
+
+<CHARCLASS_CODEPOINT> { // Specialized form: only one codepoint allowed, no whitespace allowed
+  {HexDigit}{1,6} "}" { int codePoint = Integer.parseInt(yytext().substring(0, yylength() - 1), 16);
+                        if (codePoint <= unicodeProperties.getMaximumCodePoint()) {
+                          yybegin(CHARCLASS);
+                          return symbol(CHAR, codePoint);
+                        } else {
+                          throw new ScannerException(file, ErrorMessages.CODEPOINT_OUT_OF_RANGE, yyline, yycolumn);
+                        }
+                      }
+  <<EOF>>             { throw new ScannerException(file,ErrorMessages.EOF_IN_REGEXP); }
+}
+
+.  { throw new ScannerException(file,ErrorMessages.UNEXPECTED_CHAR, yyline, yycolumn); }
+\R { throw new ScannerException(file,ErrorMessages.UNEXPECTED_NL, yyline, yycolumn); }
+
+<<EOF>>  { if ( yymoreStreams() ) {
+             file = (File) files.pop();
+             yypopStream();
+           }
+           else {
+             return symbol(EOF);
+           }
+         }

samples/JFlex/java.jflex

@@ -0,0 +1,305 @@
+/* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
+ * Copyright (C) 1998-2015  Gerwin Klein <lsf@jflex.de>                    *
+ * All rights reserved.                                                    *
+ *                                                                         *
+ * License: BSD                                                            *
+ *                                                                         *
+ * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * */
+
+/* Java 1.2 language lexer specification */
+
+/* Use together with unicode.flex for Unicode preprocesssing */
+/* and java12.cup for a Java 1.2 parser                      */
+
+/* Note that this lexer specification is not tuned for speed.
+   It is in fact quite slow on integer and floating point literals, 
+   because the input is read twice and the methods used to parse
+   the numbers are not very fast. 
+   For a production quality application (e.g. a Java compiler) 
+   this could be optimized */
+
+
+import java_cup.runtime.*;
+
+%%
+
+%public
+%class Scanner
+%implements sym
+
+%unicode
+
+%line
+%column
+
+%cup
+%cupdebug
+
+%{
+  StringBuilder string = new StringBuilder();
+  
+  private Symbol symbol(int type) {
+    return new JavaSymbol(type, yyline+1, yycolumn+1);
+  }
+
+  private Symbol symbol(int type, Object value) {
+    return new JavaSymbol(type, yyline+1, yycolumn+1, value);
+  }
+
+  /** 
+   * assumes correct representation of a long value for 
+   * specified radix in scanner buffer from <code>start</code> 
+   * to <code>end</code> 
+   */
+  private long parseLong(int start, int end, int radix) {
+    long result = 0;
+    long digit;
+
+    for (int i = start; i < end; i++) {
+      digit  = Character.digit(yycharat(i),radix);
+      result*= radix;
+      result+= digit;
+    }
+
+    return result;
+  }
+%}
+
+/* main character classes */
+LineTerminator = \r|\n|\r\n
+InputCharacter = [^\r\n]
+
+WhiteSpace = {LineTerminator} | [ \t\f]
+
+/* comments */
+Comment = {TraditionalComment} | {EndOfLineComment} | 
+          {DocumentationComment}
+
+TraditionalComment = "/*" [^*] ~"*/" | "/*" "*"+ "/"
+EndOfLineComment = "//" {InputCharacter}* {LineTerminator}?
+DocumentationComment = "/*" "*"+ [^/*] ~"*/"
+
+/* identifiers */
+Identifier = [:jletter:][:jletterdigit:]*
+
+/* integer literals */
+DecIntegerLiteral = 0 | [1-9][0-9]*
+DecLongLiteral    = {DecIntegerLiteral} [lL]
+
+HexIntegerLiteral = 0 [xX] 0* {HexDigit} {1,8}
+HexLongLiteral    = 0 [xX] 0* {HexDigit} {1,16} [lL]
+HexDigit          = [0-9a-fA-F]
+
+OctIntegerLiteral = 0+ [1-3]? {OctDigit} {1,15}
+OctLongLiteral    = 0+ 1? {OctDigit} {1,21} [lL]
+OctDigit          = [0-7]
+    
+/* floating point literals */        
+FloatLiteral  = ({FLit1}|{FLit2}|{FLit3}) {Exponent}? [fF]
+DoubleLiteral = ({FLit1}|{FLit2}|{FLit3}) {Exponent}?
+
+FLit1    = [0-9]+ \. [0-9]* 
+FLit2    = \. [0-9]+ 
+FLit3    = [0-9]+ 
+Exponent = [eE] [+-]? [0-9]+
+
+/* string and character literals */
+StringCharacter = [^\r\n\"\\]
+SingleCharacter = [^\r\n\'\\]
+
+%state STRING, CHARLITERAL
+
+%%
+
+<YYINITIAL> {
+
+  /* keywords */
+  "abstract"                     { return symbol(ABSTRACT); }
+  "boolean"                      { return symbol(BOOLEAN); }
+  "break"                        { return symbol(BREAK); }
+  "byte"                         { return symbol(BYTE); }
+  "case"                         { return symbol(CASE); }
+  "catch"                        { return symbol(CATCH); }
+  "char"                         { return symbol(CHAR); }
+  "class"                        { return symbol(CLASS); }
+  "const"                        { return symbol(CONST); }
+  "continue"                     { return symbol(CONTINUE); }
+  "do"                           { return symbol(DO); }
+  "double"                       { return symbol(DOUBLE); }
+  "else"                         { return symbol(ELSE); }
+  "extends"                      { return symbol(EXTENDS); }
+  "final"                        { return symbol(FINAL); }
+  "finally"                      { return symbol(FINALLY); }
+  "float"                        { return symbol(FLOAT); }
+  "for"                          { return symbol(FOR); }
+  "default"                      { return symbol(DEFAULT); }
+  "implements"                   { return symbol(IMPLEMENTS); }
+  "import"                       { return symbol(IMPORT); }
+  "instanceof"                   { return symbol(INSTANCEOF); }
+  "int"                          { return symbol(INT); }
+  "interface"                    { return symbol(INTERFACE); }
+  "long"                         { return symbol(LONG); }
+  "native"                       { return symbol(NATIVE); }
+  "new"                          { return symbol(NEW); }
+  "goto"                         { return symbol(GOTO); }
+  "if"                           { return symbol(IF); }
+  "public"                       { return symbol(PUBLIC); }
+  "short"                        { return symbol(SHORT); }
+  "super"                        { return symbol(SUPER); }
+  "switch"                       { return symbol(SWITCH); }
+  "synchronized"                 { return symbol(SYNCHRONIZED); }
+  "package"                      { return symbol(PACKAGE); }
+  "private"                      { return symbol(PRIVATE); }
+  "protected"                    { return symbol(PROTECTED); }
+  "transient"                    { return symbol(TRANSIENT); }
+  "return"                       { return symbol(RETURN); }
+  "void"                         { return symbol(VOID); }
+  "static"                       { return symbol(STATIC); }
+  "while"                        { return symbol(WHILE); }
+  "this"                         { return symbol(THIS); }
+  "throw"                        { return symbol(THROW); }
+  "throws"                       { return symbol(THROWS); }
+  "try"                          { return symbol(TRY); }
+  "volatile"                     { return symbol(VOLATILE); }
+  "strictfp"                     { return symbol(STRICTFP); }
+  
+  /* boolean literals */
+  "true"                         { return symbol(BOOLEAN_LITERAL, true); }
+  "false"                        { return symbol(BOOLEAN_LITERAL, false); }
+  
+  /* null literal */
+  "null"                         { return symbol(NULL_LITERAL); }
+  
+  
+  /* separators */
+  "("                            { return symbol(LPAREN); }
+  ")"                            { return symbol(RPAREN); }
+  "{"                            { return symbol(LBRACE); }
+  "}"                            { return symbol(RBRACE); }
+  "["                            { return symbol(LBRACK); }
+  "]"                            { return symbol(RBRACK); }
+  ";"                            { return symbol(SEMICOLON); }
+  ","                            { return symbol(COMMA); }
+  "."                            { return symbol(DOT); }
+  
+  /* operators */
+  "="                            { return symbol(EQ); }
+  ">"                            { return symbol(GT); }
+  "<"                            { return symbol(LT); }
+  "!"                            { return symbol(NOT); }
+  "~"                            { return symbol(COMP); }
+  "?"                            { return symbol(QUESTION); }
+  ":"                            { return symbol(COLON); }
+  "=="                           { return symbol(EQEQ); }
+  "<="                           { return symbol(LTEQ); }
+  ">="                           { return symbol(GTEQ); }
+  "!="                           { return symbol(NOTEQ); }
+  "&&"                           { return symbol(ANDAND); }
+  "||"                           { return symbol(OROR); }
+  "++"                           { return symbol(PLUSPLUS); }
+  "--"                           { return symbol(MINUSMINUS); }
+  "+"                            { return symbol(PLUS); }
+  "-"                            { return symbol(MINUS); }
+  "*"                            { return symbol(MULT); }
+  "/"                            { return symbol(DIV); }
+  "&"                            { return symbol(AND); }
+  "|"                            { return symbol(OR); }
+  "^"                            { return symbol(XOR); }
+  "%"                            { return symbol(MOD); }
+  "<<"                           { return symbol(LSHIFT); }
+  ">>"                           { return symbol(RSHIFT); }
+  ">>>"                          { return symbol(URSHIFT); }
+  "+="                           { return symbol(PLUSEQ); }
+  "-="                           { return symbol(MINUSEQ); }
+  "*="                           { return symbol(MULTEQ); }
+  "/="                           { return symbol(DIVEQ); }
+  "&="                           { return symbol(ANDEQ); }
+  "|="                           { return symbol(OREQ); }
+  "^="                           { return symbol(XOREQ); }
+  "%="                           { return symbol(MODEQ); }
+  "<<="                          { return symbol(LSHIFTEQ); }
+  ">>="                          { return symbol(RSHIFTEQ); }
+  ">>>="                         { return symbol(URSHIFTEQ); }
+  
+  /* string literal */
+  \"                             { yybegin(STRING); string.setLength(0); }
+
+  /* character literal */
+  \'                             { yybegin(CHARLITERAL); }
+
+  /* numeric literals */
+
+  /* This is matched together with the minus, because the number is too big to 
+     be represented by a positive integer. */
+  "-2147483648"                  { return symbol(INTEGER_LITERAL, new Integer(Integer.MIN_VALUE)); }
+  
+  {DecIntegerLiteral}            { return symbol(INTEGER_LITERAL, new Integer(yytext())); }
+  {DecLongLiteral}               { return symbol(INTEGER_LITERAL, new Long(yytext().substring(0,yylength()-1))); }
+  
+  {HexIntegerLiteral}            { return symbol(INTEGER_LITERAL, new Integer((int) parseLong(2, yylength(), 16))); }
+  {HexLongLiteral}               { return symbol(INTEGER_LITERAL, new Long(parseLong(2, yylength()-1, 16))); }
+ 
+  {OctIntegerLiteral}            { return symbol(INTEGER_LITERAL, new Integer((int) parseLong(0, yylength(), 8))); }  
+  {OctLongLiteral}               { return symbol(INTEGER_LITERAL, new Long(parseLong(0, yylength()-1, 8))); }
+  
+  {FloatLiteral}                 { return symbol(FLOATING_POINT_LITERAL, new Float(yytext().substring(0,yylength()-1))); }
+  {DoubleLiteral}                { return symbol(FLOATING_POINT_LITERAL, new Double(yytext())); }
+  {DoubleLiteral}[dD]            { return symbol(FLOATING_POINT_LITERAL, new Double(yytext().substring(0,yylength()-1))); }
+  
+  /* comments */
+  {Comment}                      { /* ignore */ }
+
+  /* whitespace */
+  {WhiteSpace}                   { /* ignore */ }
+
+  /* identifiers */ 
+  {Identifier}                   { return symbol(IDENTIFIER, yytext()); }  
+}
+
+<STRING> {
+  \"                             { yybegin(YYINITIAL); return symbol(STRING_LITERAL, string.toString()); }
+  
+  {StringCharacter}+             { string.append( yytext() ); }
+  
+  /* escape sequences */
+  "\\b"                          { string.append( '\b' ); }
+  "\\t"                          { string.append( '\t' ); }
+  "\\n"                          { string.append( '\n' ); }
+  "\\f"                          { string.append( '\f' ); }
+  "\\r"                          { string.append( '\r' ); }
+  "\\\""                         { string.append( '\"' ); }
+  "\\'"                          { string.append( '\'' ); }
+  "\\\\"                         { string.append( '\\' ); }
+  \\[0-3]?{OctDigit}?{OctDigit}  { char val = (char) Integer.parseInt(yytext().substring(1),8);
+                        				   string.append( val ); }
+  
+  /* error cases */
+  \\.                            { throw new RuntimeException("Illegal escape sequence \""+yytext()+"\""); }
+  {LineTerminator}               { throw new RuntimeException("Unterminated string at end of line"); }
+}
+
+<CHARLITERAL> {
+  {SingleCharacter}\'            { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, yytext().charAt(0)); }
+  
+  /* escape sequences */
+  "\\b"\'                        { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, '\b');}
+  "\\t"\'                        { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, '\t');}
+  "\\n"\'                        { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, '\n');}
+  "\\f"\'                        { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, '\f');}
+  "\\r"\'                        { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, '\r');}
+  "\\\""\'                       { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, '\"');}
+  "\\'"\'                        { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, '\'');}
+  "\\\\"\'                       { yybegin(YYINITIAL); return symbol(CHARACTER_LITERAL, '\\'); }
+  \\[0-3]?{OctDigit}?{OctDigit}\' { yybegin(YYINITIAL); 
+			                              int val = Integer.parseInt(yytext().substring(1,yylength()-1),8);
+			                            return symbol(CHARACTER_LITERAL, (char)val); }
+  
+  /* error cases */
+  \\.                            { throw new RuntimeException("Illegal escape sequence \""+yytext()+"\""); }
+  {LineTerminator}               { throw new RuntimeException("Unterminated character literal at end of line"); }
+}
+
+/* error fallback */
+[^]                              { throw new RuntimeException("Illegal character \""+yytext()+
+                                                              "\" at line "+yyline+", column "+yycolumn); }
+<<EOF>>                          { return symbol(EOF); }

samples/KiCad/Volume.sch

@@ -0,0 +1,714 @@
+EESchema Schematic File Version 2
+LIBS:mfk_alps
+LIBS:mfk_connector
+LIBS:mfk_interface
+LIBS:power
+LIBS:device
+LIBS:transistors
+LIBS:conn
+LIBS:linear
+LIBS:regul
+LIBS:74xx
+LIBS:cmos4000
+LIBS:adc-dac
+LIBS:memory
+LIBS:xilinx
+LIBS:special
+LIBS:microcontrollers
+LIBS:dsp
+LIBS:microchip
+LIBS:analog_switches
+LIBS:motorola
+LIBS:texas
+LIBS:intel
+LIBS:audio
+LIBS:interface
+LIBS:digital-audio
+LIBS:philips
+LIBS:display
+LIBS:cypress
+LIBS:siliconi
+LIBS:opto
+LIBS:atmel
+LIBS:contrib
+LIBS:valves
+LIBS:Volume-AlpsRK16814MG-cache
+EELAYER 27 0
+EELAYER END
+$Descr A 11000 8500
+encoding utf-8
+Sheet 1 1
+Title "ALPS RK16816MG with H-bridge"
+Date "4 apr 2015"
+Rev ""
+Comp "Mithat Konar"
+Comment1 "Copyright (C) 2015 Mithat Konar"
+Comment2 "CERN Open Hardware Licence v1.2"
+Comment3 ""
+Comment4 ""
+$EndDescr
+$Comp
+L SN754410 U1
+U 1 1 550CA683
+P 7600 4650
+F 0 "U1" H 7600 5350 60  0000 C CNN
+F 1 "SN754410" H 7600 4000 60  0000 C CNN
+F 2 "mfk-DIP-16_AriesC84_e" H 7600 4650 60  0001 C CNN
+F 3 "~" H 7600 4650 60  0000 C CNN
+	1    7600 4650
+	1    0    0    -1  
+$EndComp
+$Comp
+L DGND #PWR01
+U 1 1 550CA83D
+P 8450 5500
+F 0 "#PWR01" H 8450 5500 40  0001 C CNN
+F 1 "DGND" H 8450 5430 40  0000 C CNN
+F 2 "" H 8450 5500 60  0000 C CNN
+F 3 "" H 8450 5500 60  0000 C CNN
+	1    8450 5500
+	1    0    0    -1  
+$EndComp
+$Comp
+L DGND #PWR02
+U 1 1 550CA86E
+P 6600 5300
+F 0 "#PWR02" H 6600 5300 40  0001 C CNN
+F 1 "DGND" H 6600 5230 40  0000 C CNN
+F 2 "" H 6600 5300 60  0000 C CNN
+F 3 "" H 6600 5300 60  0000 C CNN
+	1    6600 5300
+	1    0    0    -1  
+$EndComp
+Wire Wire Line
+	6900 4550 6600 4550
+Wire Wire Line
+	6600 4550 6600 5300
+Wire Wire Line
+	6900 4700 6600 4700
+Connection ~ 6600 4700
+Wire Wire Line
+	8300 4550 8450 4550
+Wire Wire Line
+	8450 4250 8450 5500
+Wire Wire Line
+	8300 4700 8450 4700
+Connection ~ 8450 4700
+Wire Wire Line
+	3900 4450 4600 4450
+Wire Wire Line
+	4400 4450 4400 4400
+Wire Wire Line
+	4600 4450 4600 4400
+Wire Wire Line
+	4400 5250 4400 5500
+Wire Wire Line
+	4600 5400 4600 5250
+Wire Wire Line
+	5700 4200 5700 4150
+Wire Wire Line
+	5700 4150 6150 4150
+Wire Wire Line
+	6150 4400 6900 4400
+Wire Wire Line
+	5700 4850 6900 4850
+Wire Wire Line
+	5700 4800 5700 4850
+Wire Wire Line
+	8300 4250 8450 4250
+Connection ~ 8450 4550
+Wire Wire Line
+	6400 4250 6900 4250
+Wire Wire Line
+	6400 3250 6400 4250
+Wire Wire Line
+	6750 3750 8450 3750
+Wire Wire Line
+	8300 5000 8450 5000
+Wire Wire Line
+	8300 4100 8700 4100
+Wire Wire Line
+	6750 5150 6900 5150
+$Comp
+L C C1
+U 1 1 550CAD46
+P 8700 4350
+F 0 "C1" H 8700 4450 40  0000 L CNN
+F 1 "100n" H 8706 4265 40  0000 L CNN
+F 2 "mfk-C_4.0_2.5_2.5_0.5" H 8738 4200 30  0001 C CNN
+F 3 "~" H 8700 4350 60  0000 C CNN
+	1    8700 4350
+	1    0    0    -1  
+$EndComp
+Wire Wire Line
+	8700 4100 8700 4150
+$Comp
+L DGND #PWR03
+U 1 1 550CADFB
+P 8700 4700
+F 0 "#PWR03" H 8700 4700 40  0001 C CNN
+F 1 "DGND" H 8700 4630 40  0000 C CNN
+F 2 "" H 8700 4700 60  0000 C CNN
+F 3 "" H 8700 4700 60  0000 C CNN
+	1    8700 4700
+	1    0    0    -1  
+$EndComp
+Wire Wire Line
+	8700 4700 8700 4550
+Text Label 6400 3250 3    50   ~ 0
+VOL_UP
+Text Label 6400 6150 1    50   ~ 0
+VOL_DOWN
+$Comp
+L DGND #PWR04
+U 1 1 550CB0E4
+P 3150 2100
+F 0 "#PWR04" H 3150 2100 40  0001 C CNN
+F 1 "DGND" H 3150 2030 40  0000 C CNN
+F 2 "" H 3150 2100 60  0000 C CNN
+F 3 "" H 3150 2100 60  0000 C CNN
+	1    3150 2100
+	-1   0    0    -1  
+$EndComp
+Wire Wire Line
+	3650 1350 3650 1800
+Wire Wire Line
+	3100 2450 3850 2450
+Text Label 3850 2450 2    50   ~ 0
+VOL_UP
+Wire Wire Line
+	3100 2650 3850 2650
+Text Label 3850 2650 2    50   ~ 0
+VOL_DOWN
+$Comp
+L PWR_FLAG #FLG05
+U 1 1 550CB3B3
+P 3400 2000
+F 0 "#FLG05" H 3400 2095 30  0001 C CNN
+F 1 "PWR_FLAG" H 3400 2180 30  0000 C CNN
+F 2 "" H 3400 2000 60  0000 C CNN
+F 3 "" H 3400 2000 60  0000 C CNN
+	1    3400 2000
+	-1   0    0    1   
+$EndComp
+$Comp
+L PWR_FLAG #FLG06
+U 1 1 550CB3CC
+P 3900 1650
+F 0 "#FLG06" H 3900 1745 30  0001 C CNN
+F 1 "PWR_FLAG" H 3900 1830 30  0000 C CNN
+F 2 "" H 3900 1650 60  0000 C CNN
+F 3 "" H 3900 1650 60  0000 C CNN
+	1    3900 1650
+	-1   0    0    -1  
+$EndComp
+Wire Wire Line
+	3150 1900 3100 1900
+Wire Wire Line
+	3150 1900 3150 2100
+Wire Wire Line
+	3900 1650 3650 1650
+Connection ~ 3650 1650
+Wire Wire Line
+	3400 2000 3150 2000
+Connection ~ 3150 2000
+$Comp
+L CONN_2 P4
+U 1 1 550CCCA8
+P 2750 2550
+F 0 "P4" V 2700 2550 50  0000 C CNN
+F 1 "CTRL" V 2800 2550 50  0000 C CNN
+F 2 "mfk-TE_282834-2" H 2750 2550 60  0001 C CNN
+F 3 "" H 2750 2550 60  0000 C CNN
+	1    2750 2550
+	-1   0    0    -1  
+$EndComp
+Wire Wire Line
+	4150 3250 4150 3850
+$Comp
+L CONN_5 P1
+U 1 1 550CCE69
+P 2750 3450
+F 0 "P1" V 2700 3450 50  0000 C CNN
+F 1 "AB I/O" V 2800 3450 50  0000 C CNN
+F 2 "mfk-TE_282834-5" H 2750 3450 60  0001 C CNN
+F 3 "" H 2750 3450 60  0000 C CNN
+	1    2750 3450
+	-1   0    0    -1  
+$EndComp
+Wire Wire Line
+	3150 3250 4150 3250
+Wire Wire Line
+	4300 4100 4350 4100
+Wire Wire Line
+	4350 4100 4350 3350
+Wire Wire Line
+	4350 3350 3150 3350
+Text Label 3150 3250 0    50   ~ 0
+A_TOP
+Text Label 3150 3350 0    50   ~ 0
+A_WIPER
+Text Label 3150 3550 0    50   ~ 0
+B_TOP
+Text Label 3150 3650 0    50   ~ 0
+B_WIPER
+$Comp
+L CONN_5 P2
+U 1 1 550CCF9F
+P 2800 4800
+F 0 "P2" V 2750 4800 50  0000 C CNN
+F 1 "CD I/O" V 2850 4800 50  0000 C CNN
+F 2 "mfk-TE_282834-5" H 2800 4800 60  0001 C CNN
+F 3 "" H 2800 4800 60  0000 C CNN
+	1    2800 4800
+	-1   0    0    -1  
+$EndComp
+Wire Wire Line
+	3200 4600 4150 4600
+Wire Wire Line
+	3200 4700 3900 4700
+Wire Wire Line
+	3200 4900 3700 4900
+Wire Wire Line
+	5100 4950 5100 5700
+Wire Wire Line
+	5100 4950 4950 4950
+Wire Wire Line
+	3200 4800 3800 4800
+Wire Wire Line
+	5000 4600 5000 5600
+Wire Wire Line
+	5000 4600 4800 4600
+Wire Wire Line
+	4800 4600 4800 4700
+Wire Wire Line
+	4300 5400 4300 4950
+Text Label 3200 4600 0    50   ~ 0
+C_TOP
+Wire Wire Line
+	3900 5400 4300 5400
+Wire Wire Line
+	4400 5400 4600 5400
+Wire Wire Line
+	3900 4700 3900 5400
+$Comp
+L RK16814MG RV1
+U 1 1 550CA765
+P 4500 4500
+F 0 "RV1" H 5850 5250 50  0000 C CNN
+F 1 "RK16814MG" H 5700 3600 50  0000 C CNN
+F 2 "mfk-ALPS_RK16814MG" V 4800 4900 60  0001 C CNN
+F 3 "~" V 4800 4900 60  0000 C CNN
+	1    4500 4500
+	1    0    0    -1  
+$EndComp
+Wire Wire Line
+	4150 4600 4150 4700
+Text Label 3200 4700 0    50   ~ 0
+C_WIPER
+Text Label 3200 4900 0    50   ~ 0
+D_TOP
+Text Label 3200 5000 0    50   ~ 0
+D_WIPER
+Wire Wire Line
+	3900 3450 3900 4450
+Connection ~ 4400 4450
+Connection ~ 4400 5400
+Text Label 3150 3450 0    50   ~ 0
+AB_COMMON
+Wire Wire Line
+	3600 5000 3200 5000
+Text Label 3200 4800 0    50   ~ 0
+CD_COMMON
+$Comp
+L +5VD #PWR07
+U 1 1 550CE6FC
+P 7600 3650
+F 0 "#PWR07" H 7600 3600 20  0001 C CNN
+F 1 "+5VD" H 7600 3750 50  0000 C CNN
+F 2 "" H 7600 3650 60  0000 C CNN
+F 3 "" H 7600 3650 60  0000 C CNN
+	1    7600 3650
+	1    0    0    -1  
+$EndComp
+$Comp
+L +5VD #PWR08
+U 1 1 550CE733
+P 3650 1350
+F 0 "#PWR08" H 3650 1300 20  0001 C CNN
+F 1 "+5VD" H 3650 1450 50  0000 C CNN
+F 2 "" H 3650 1350 60  0000 C CNN
+F 3 "" H 3650 1350 60  0000 C CNN
+	1    3650 1350
+	-1   0    0    -1  
+$EndComp
+Wire Wire Line
+	3900 3450 3150 3450
+Wire Wire Line
+	4800 3850 4800 3550
+Wire Wire Line
+	4800 3550 3150 3550
+Wire Wire Line
+	4950 4100 5000 4100
+Wire Wire Line
+	5000 4100 5000 3650
+Wire Wire Line
+	5000 3650 3150 3650
+Wire Wire Line
+	3600 5000 3600 5700
+Wire Wire Line
+	3700 4900 3700 5600
+Wire Wire Line
+	3800 4800 3800 5500
+Wire Wire Line
+	3800 5500 4400 5500
+Wire Wire Line
+	3700 5600 5000 5600
+Wire Wire Line
+	3600 5700 5100 5700
+$Bitmap
+Pos 10300 6850
+Scale 1.000000
+Data
+89 50 4E 47 0D 0A 1A 0A 00 00 00 0D 49 48 44 52 00 00 00 5F 00 00 00 64 08 06 00 00 00 E0 F1 EC 
+9B 00 00 00 04 73 42 49 54 08 08 08 08 7C 08 64 88 00 00 00 09 70 48 59 73 00 00 07 6C 00 00 07 
+6C 01 9C F3 D5 25 00 00 13 B3 49 44 41 54 78 9C ED 9D 7B 7C 54 D5 B5 C7 BF EB CC 04 C2 43 1E 5A 
+45 D0 2A F6 FA 82 52 A0 6A D5 D6 5A B1 3E 69 21 27 40 A3 F6 E1 55 51 4E 78 5C B5 B4 DA 56 3F 7E 
+8A 69 BD D4 6A 6F 6F AB AD 90 13 90 48 3F B7 B6 E6 16 66 22 8A F6 65 44 AD AD A2 45 B4 A5 D6 17 
+88 12 15 5A 0C F2 CA 64 E6 AC FB C7 3E 93 49 86 10 66 92 7D 48 E8 E5 F7 F9 E4 33 AF BD D7 59 FB 
+77 76 F6 D9 7B ED B5 D6 16 55 E5 40 80 F8 C9 7B 80 59 05 14 5D A0 9E 3B 3B 6A 7D 6C C0 E9 69 05 
+8A C0 85 96 CB F5 38 E4 40 E8 F9 E2 27 0F 01 9A 00 29 A0 B8 02 83 D5 73 3F 88 56 AB EE E3 40 E9 
+F9 63 29 8C 78 C2 72 63 23 D4 C5 1A 0E 14 F2 C7 45 5C BE 47 70 A0 90 3F 3E E2 F2 3D 82 83 E4 F7 
+20 22 27 5F FC E4 67 C5 4F 5E DE 8D FA 31 60 4C 91 D5 C6 84 F5 BA 7A CD CB C5 4F 7E B6 AB F5 0B 
+45 A4 E4 8B 9F 2C 03 56 02 4B C5 4F AE 14 3F 39 A2 0B 62 4E 04 FA 15 59 A7 5F 58 AF 28 88 9F 1C 
+21 7E 72 25 B0 14 58 19 EA 1F 19 22 23 3F 54 BC 0E E8 13 7E 75 31 F0 92 F8 C9 CB 8A 14 75 4A 17 
+55 38 B5 98 C2 A1 5E 2F 61 F4 04 A3 77 5D 94 37 20 92 79 7E 07 C4 E7 E3 01 60 B6 7A EE 3F 3A 91 
+31 00 B8 0C A8 02 8E EA 82 1A 8D C0 AD C0 CF D5 73 B7 77 72 9D C3 80 7B 80 4B F6 52 24 05 54 A8 
+E7 D6 77 41 87 4E 61 9D FC 02 88 CF A2 11 98 A1 9E FB 50 5E FD 31 40 25 70 39 30 D8 82 4A 1F 00 
+3F 03 16 AA E7 BE 98 77 AD CF 03 35 C0 F0 7D C8 88 E4 06 58 25 BF 08 E2 DB 62 11 70 3B F0 49 60 
+26 70 96 35 85 F6 C4 53 C0 42 E0 69 E0 5B C0 35 45 D4 B5 7E 03 AC 91 DF 45 E2 0F 34 58 BD 01 36 
+1F B8 35 FC 6B 13 0F A6 7D 35 B6 84 D9 24 FF 4E 8B B2 7A 33 AC B5 D3 26 F9 3F 04 9E B4 28 AF 37 
+E2 49 4C 3B AD C0 F6 03 F7 23 C0 0B C0 40 6B 42 7B 0F B6 03 E3 D4 73 5F B7 25 D0 EA 22 2B 54 EC 
+06 9B 32 7B 11 6E B0 49 3C 44 B7 C8 5A 49 6E A5 F8 AF 80 47 D4 73 27 DA 16 1A 95 79 E1 6A 60 6B 
+44 B2 F7 37 B6 62 DA 63 1D 91 90 AF 9E BB 09 98 13 85 EC 1E C0 9C B0 3D D6 11 E9 1E AE F8 C9 06 
+E0 9C C8 2E 10 3D 1E 57 CF 9D 10 95 F0 A8 ED F9 F1 88 E5 47 8D 48 F5 8F AC E7 8B 9F 1C 07 AC 89 
+44 F8 FE C5 78 F5 DC 17 A2 10 1C 65 CF BF 2E 42 D9 FB 13 91 B5 23 AA A9 E6 61 C0 5B 40 A9 75 E1 
+39 BC 05 BC 0C 9C 04 1C 1D E1 75 76 03 47 77 B6 F7 D0 55 44 35 A6 CD C0 3E F1 29 E0 2E E0 31 E0 
+39 F5 DC 77 B3 3F 88 9F 1C 86 D9 B9 3A 17 D3 53 6D 1A F8 4A 31 ED B9 DD A2 4C 20 9A CD 94 18 F0 
+06 F0 61 8B 62 D7 00 57 A8 E7 AE 2D E0 FA 63 81 FB B0 EB C1 B0 11 38 4E 3D 37 63 51 66 24 63 FE 
+97 B1 4B FC 7C E0 F4 42 88 07 08 CB 9D 1E D6 B3 85 0F 63 DA 65 15 DD EA F9 E2 27 FB 03 1F C3 F4 
+B2 F1 18 4F B1 D3 81 2E BB 6D E4 A1 4E 3D 77 6F 7B AB FB 84 F8 C9 07 80 0A 4B BA 64 80 67 30 86 
+C3 35 E1 DF 8B EA B9 3B BB 2A B0 60 F2 C5 4F 96 00 E7 63 08 CE 92 7D 02 D1 CD 98 36 03 1F 55 CF 
+DD DC 55 01 E2 27 0F 07 FE 02 1C 6E 4D AB F6 08 80 57 C8 DD 8C 17 80 DF AA E7 B6 14 52 B9 98 07 
+EE 95 80 5F AC 76 DD C0 9C EE 10 0F A0 9E BB 59 FC E4 1C 8C B7 44 14 70 30 B3 AD 93 80 4B C3 EF 
+3C 0A DC ED 2A A6 D7 0E 28 4E AF 6E A1 51 3D B7 CE 86 A0 50 4E A3 0D 59 05 A2 60 9E 7A AB AF E6 
+EA 5E 2E CF 0A 7A 2B F9 CF F5 72 79 56 D0 5B C9 3F D8 F3 7B 10 7B 75 EF EB 25 F2 AC A0 B7 92 7F 
+5C 2F 97 67 05 BD 95 FC 13 7A B9 3C 2B E8 AD E4 5F 22 7E B2 D0 00 B8 4E 11 CA E9 F2 2A 39 4A 14 
+43 FE FE 0C AD 3C 1E B3 9A B6 81 F3 43 79 FB 0B 05 F3 54 CC 0A B7 16 78 8D 9C 0D 67 1C 30 1A E8 
+5B 8C 66 45 60 BE F8 C9 86 42 97 EA 1D 21 34 89 D8 34 B0 E5 A3 19 F8 2B C6 AC 90 B5 F9 3C 51 68 
+E5 82 C9 0F CD A9 0D E1 1F 00 E2 27 E3 C0 C9 E4 6E C6 29 C0 79 85 CA DC 07 4E C3 10 77 63 37 64 
+CC 0F E5 D8 C2 EF 80 E7 C9 91 FD 37 F5 DC 74 57 85 45 61 CF FF 09 F6 DC 46 14 F8 86 7A EE 0F BA 
+A0 C7 0D C0 1D 14 1E 3C BD 2F FC 54 3D F7 3F 2C C9 02 A2 21 7F 14 E6 5F D1 26 EE C5 84 11 35 17 
+70 FD BE 98 30 9F E9 96 75 18 AD 9E BB CE A6 C0 A8 F6 70 57 01 67 5B 16 FB 22 50 DE 99 BF 64 E8 
+A8 9B C0 EC 31 D8 C4 13 EA B9 9F B1 2C 33 B2 A9 66 14 A6 E7 8F 01 1F DD 47 99 8F 62 9F 78 88 C8 
+94 1E 15 F9 FF 8B 7D 5F CD B7 31 31 BD 9D 61 65 58 CE 26 B6 62 DA 63 1D 51 F9 6A EE C6 04 12 DB 
+84 BF AF 99 45 F8 BB ED 5E BA 34 6C 8F 75 44 B9 C2 B5 16 BB 04 A4 8B 90 57 13 96 B7 05 9B ED 68 
+87 C8 C8 57 CF FD 0B F6 86 9E 84 7A 6E 41 BB 51 61 B9 84 A5 EB 6E 0D DB 11 09 A2 0C FF BF 1C 18 
+6A 49 DC 3D 11 97 DF 1B 86 76 27 69 C7 BE 10 D5 54 F3 68 4C 1E 03 1B 11 E4 7F 53 CF 1D D5 05 1D 
+D6 61 56 DF DD 45 13 30 46 3D F7 2D 0B B2 DA C1 7A CF 0F AD 88 4B B0 43 3C C0 82 FD 5C 2F 1F 83 
+81 25 B6 AC AC 6D 11 C5 B0 33 1B 7B 16 C9 1D 18 D7 BF AE E0 BE B0 BE 0D 9C 8F 69 97 55 58 25 5F 
+FC E4 09 18 7B 8A 2D FC 5C 3D B7 A9 2B 15 C3 7A 3F B7 A8 CB 1D 61 FB AC C1 1A F9 A1 83 EC 52 A0 
+BF 2D 99 74 FF C1 69 EB C1 0B A6 5D 4B BB 93 C1 2A 1F 36 7B FE 37 80 33 2D CA FB A3 7A 6E B7 22 
+5B C2 FA 7F B4 A4 0F 98 F6 7D C3 96 30 9B E4 7F D5 A2 2C B0 D7 6B 6D F6 7E B0 D8 4E 9B E4 5F 81 
+D9 D9 B1 81 2D D8 F3 AF 7C 20 94 67 03 CD 98 76 5A 81 35 F2 D5 73 1F 01 CA 29 EE 06 28 F0 3F C0 
+43 79 DF DF 5B 88 ED BE 40 BD 9A 31 FB 01 6D F1 50 78 DD 62 16 39 CD 18 93 F6 23 36 F4 02 FB B9 
+17 8A B9 01 6F 02 E7 A9 E7 7E 45 3D 77 12 26 C3 D4 2A 8C DB 75 B5 4D BD 42 79 41 28 FF 2C F5 DC 
+49 EA B9 5F C1 6C 79 BE 59 40 7D EB C4 43 74 2B DC 8B 31 F6 95 BD 6D AE D7 02 D7 AB E7 6E EB A0 
+EE D1 51 AC 26 F7 26 57 FC E4 20 E0 C7 18 17 F8 8E 10 09 F1 10 6D 1C 6E 47 37 E0 3D C0 53 CF 4D 
+46 72 D1 6E 40 FC A4 8B 31 47 1F D1 E6 EB C8 88 87 68 AD 9A F9 43 50 02 63 23 E9 75 C4 03 84 7A 
+8D 21 67 11 8D 94 78 D8 0F F9 F3 C5 4F 7E 1A 18 6E 2B D8 61 7F 40 FC 64 05 26 40 23 D2 CC 59 07 
+C4 E1 05 FF AA E8 AD BE 9A FF 2F 70 90 FC 1E C4 41 F2 7B 10 07 C9 EF 41 1C 24 BF 07 71 90 FC 1E 
+44 1C 40 FC 15 FD 91 CC 6C 94 B3 50 FA 01 7F 42 32 0B D5 9B DA 08 20 8B 96 1D 4D 26 B6 08 61 23 
+E2 FC 08 74 2E AA 27 80 AE 25 16 FC 40 AF 9E BA 21 2B 50 40 A8 4E 4C C7 61 32 EA 0C 41 83 35 68 
+FC 4E 9D 39 A9 D5 93 4C AA 93 8F 20 A4 08 62 B3 88 65 6E 41 39 09 E1 61 E2 A9 FB F4 AA 8A 4E A3 
+CE A5 BA FE 34 24 98 08 72 2E E8 56 90 75 A4 A9 D6 D9 EE C6 D6 32 FE 8A 0F 41 7A 16 22 67 A2 64 
+10 79 9A DD 25 3F D5 6B 27 6E 33 ED A9 1F 4B 46 EF 40 58 AD 9E 7B 4B 6B BD 9A E5 E7 10 38 37 21 
+34 A8 E7 DE DE AE DD 8E DC 8D EA D7 51 8E 02 EA 29 49 DD AF 57 55 6C 96 EA E5 E3 10 67 16 30 0A 
+65 23 8E 3C CE A6 41 4B 74 DE 84 34 80 DC 5B 7F 08 69 FD 26 AA 9F 44 64 17 C8 E3 34 97 DC A5 D7 
+4E 6C 16 EE 7A 78 10 7D 53 7F 04 F2 3D 04 DE 45 63 67 6B E5 A4 57 C4 5F 71 32 64 D6 61 F6 44 1D 
+DA 1F A3 F1 0E 64 4E 69 BD 51 7E F2 7E CC A1 03 6D B1 0D 71 CE D7 19 93 9F 0D CB 28 C6 D0 B5 85 
+F6 CB F9 9D 88 73 BA CE 98 DC A1 AF 8C F8 89 AF 83 74 E4 2E BE 03 63 A4 FB 93 2C 4C 8C C4 91 A7 
+80 FC 23 42 5E 25 96 3A 43 AF AE F8 A7 2C 4C 4C C0 91 C7 50 1E D5 4A B7 35 FF A7 D4 D4 5F 86 EA 
+FD C0 2F D5 73 2F 6B D3 EE ED 61 BB C3 5D 3A D9 4C 26 7D 26 F1 F8 79 A8 2E 20 3F D1 87 EA EF E9 
+CB 34 00 52 F2 67 60 64 9E 2E 6B E9 D7 EF 53 0E A5 A9 9B 31 C4 6F 04 AE 47 F5 4B 18 8F E0 61 38 
+E9 FC A4 CD 03 80 DF A3 72 0E A2 97 62 6C 35 47 42 7C 96 51 3E 31 11 43 FC 1B 88 7C 11 62 A7 A2 
+F2 00 30 08 0D F2 DD 07 1D 60 13 C8 25 28 D3 41 5E 07 FA A3 C1 BC 0E C8 CD D2 73 63 D8 B8 EB 88 
+65 46 12 E8 19 20 FF 85 92 C0 73 9F 31 52 E5 76 0C F1 EB 40 AE 44 65 16 B0 1E 38 9E 74 C9 B7 F7 
+2E BB 53 0C 04 9E 04 BD 08 F8 1A 9A 71 D1 58 0B AA 3F 0C DB 51 8F 52 16 72 F2 32 48 23 A9 F7 76 
+90 92 2A 60 24 CA A3 08 67 A1 94 61 B8 1D CB AE 5D F3 E2 A8 5C 0C 0A AA DF D4 CA F2 FB 01 A4 7A 
+F9 5F 11 67 8D F9 2D 0F E9 92 6B 74 F6 E7 DE 01 90 9A E4 31 28 77 82 8E 36 A4 38 E5 A1 AC FF 56 
+CF FD 05 80 D4 26 2A 49 89 0B 9C 2C 0B 13 23 75 66 F9 FA 36 64 7E 4D BD B2 C7 CC 35 93 20 DC 0B 
+D2 E1 59 27 52 57 17 83 3E 31 20 4D 89 F3 2B 9D 5E BE 09 D8 80 49 C3 D2 16 46 67 0D AE D6 CA 29 
+4F 1B D9 0F 36 22 41 02 E9 A0 3D 85 41 09 B4 32 D4 FD D7 A6 ED F5 D7 A3 3A 10 58 AD 9E EB B6 EA 
+79 4F DD C3 CC AE D8 A1 A0 E2 27 CB 01 08 32 B3 B5 72 EA EB 21 67 71 94 65 C0 E7 E2 A0 E6 3C 12 
+47 73 21 F2 87 A6 5F 62 6B 9F 9D 40 7F F9 E9 F2 C3 28 29 C9 FE B2 2D 4B 7C 88 D7 C2 D7 21 A1 8E 
+C6 49 49 E4 02 F1 13 6D 49 FC 00 E8 4B 4C 8E C7 F4 42 80 16 1A FF FC 38 84 E7 C1 C4 32 BF 21 88 
+01 DA 61 E2 08 AD A8 C8 88 9F 5C 02 DC 48 5A D7 8B 9F 5C 0B F2 1E 12 AC 03 7E A6 33 CA D7 C8 CF 
+7E 3D 00 E3 67 93 61 67 3A B7 FF 2B 2D CF 84 23 43 57 CE 5E 01 F4 D5 F6 9D 06 50 0D 87 69 6D B7 
+11 A4 B3 2B B6 43 F8 1C 35 49 92 76 10 73 BE 2D 7E 68 AF 13 A7 4F B8 87 73 72 9C 6C C6 6F 4D B7 
+E6 2C 0B 1B BA 19 38 96 52 1D 48 2E B9 55 7B 37 0E 71 9A D0 00 90 AC D9 F8 D0 F0 75 72 87 D1 38 
+81 B4 8D 01 0B 74 DE BC A0 F5 53 AA 34 4D 7C 1F B1 6F 2D C1 F7 29 71 52 98 A8 93 53 CD 7F 99 4C 
+04 E6 C8 E2 FA 31 68 6B 24 E0 07 3A B7 62 57 AE E2 96 2D 30 2C 0D F4 97 AA 2A 87 61 C5 9E DE 27 
+C1 9E 5F 71 98 E1 D0 79 A3 C3 2A 01 43 71 10 60 00 48 6E EB 31 67 4B 8B C5 31 E9 50 8E 43 E2 E3 
+81 C7 01 4C 6F 77 8E 05 60 67 BF 77 E8 9B C9 46 70 1F 25 BE 5F A2 9E D7 12 0A 1A 19 4A 0C 6F 8A 
+FE 1D 64 0C 4A 99 56 BA 0F 16 D9 C2 7D 42 E7 4C F9 07 70 8B 54 55 7D 9B C3 3F 71 04 B1 F4 D1 88 
+7E 0B 98 46 9A CB 78 E7 CF F3 19 3E 3E 03 0C 91 C5 CB 8E 6D 9D 85 39 47 8C 25 20 0E 34 EA BC 79 
+81 D4 2C 57 54 40 F2 D2 91 69 11 E9 C9 94 97 C3 37 17 D2 91 63 D7 CC 49 9B F0 93 3B 00 A5 5F BF 
+23 F5 F2 0B F7 70 E0 72 00 13 66 A3 CE 54 F1 FD 12 01 A1 24 F6 C5 F0 F7 B7 F5 DA 89 CD ED CB 1F 
+99 3B 6F 56 35 FB FE 9F E1 6B F6 34 9E AB A4 AA CA 01 90 BB 57 0E 92 9A FA 2F 4B 5D 5D B7 32 FE 
+49 5D 5D 4C FC E4 0F C5 AF 3F 57 E7 CD 0B 74 F6 E7 DE D1 CA B2 D5 48 E8 1A 22 3A 3E FC 4F 5A 0F 
+40 10 AB 90 AA 2A 47 AA 1A E2 04 8E 09 82 96 B0 AD 69 CD 4E 4B 47 8B BF FC D3 90 1D 26 F4 2B 85 
+2B D4 9A C9 E4 62 59 58 FF F1 D6 AF 6B 12 57 4A F5 F2 71 6A C6 96 97 80 81 EC DA D9 9A 9F 4D 16 
+D7 1F 2F 7E FD E7 01 E2 A8 7E 0F 91 F3 80 EB 60 D8 17 F0 93 4D E4 A6 9D DF DB F3 AA FA 2B F1 93 
+7F 00 8E 6C 2D A7 84 B6 FA F8 4F 20 98 8D E8 14 86 8F 7F 53 AA EB 9F A2 AF 4E 44 39 84 F7 4B AE 
+10 B8 48 8B DB B4 CE 61 6B 89 07 CC 05 FD AA F8 C9 E7 50 5E 02 86 23 61 AE 66 D5 95 E1 EB F7 10 
+59 84 72 27 C3 C7 57 42 53 1F E0 18 F3 9B 98 F6 CC 9A FA 06 7E F2 AF C0 68 70 56 89 9F CC 4E B5 
+87 14 AC CF 0C 37 41 75 F2 09 84 B3 71 F4 79 F1 13 CF 83 F4 03 19 85 C8 56 59 52 77 12 D2 67 1E 
+CA 23 20 D5 E2 27 2A C1 79 37 9C 31 39 E2 27 6E 70 B4 B2 FC 77 66 AA C7 36 CC 14 6D 14 D0 02 F2 
+5D 1A D7 E4 3B 9B 6E 40 B9 1F 93 BF 32 7B 83 6E CF 0E 31 EA 4D DA 82 F2 05 4C B2 D1 A3 10 BD 04 
+38 04 78 0D 8D 7F AB CB C4 03 EA 95 2F 08 A7 72 1B 81 D3 10 AE 44 B8 08 78 15 B8 49 2B CB 17 03 
+50 59 7E 2F 22 37 63 76 A2 8E C7 10 BF 13 74 B6 7A 65 0F 81 79 52 40 6C 1A C8 4A F3 91 4F 82 B4 
+80 14 1C D5 A2 A0 48 E6 52 44 C3 9D 39 39 25 E4 64 13 2A 97 EA 55 15 9B 75 86 FB 28 AA D7 01 4D 
+E6 77 9D 08 38 A8 AC 20 D6 B2 A4 75 33 45 AA 1A E2 1C B9 6D 3C 4E 66 00 DB D3 CF B4 7D 60 B5 59 
+6C BC AC 9E 7B B2 F8 2B 8E 41 83 D1 68 E6 79 9D 39 E5 BD 7C C5 A4 AA 21 CE 51 EF 8F 23 23 23 70 
+82 97 99 31 E5 95 B6 C4 CB A2 07 CF 24 9D 09 74 66 F9 33 B9 6B F8 25 38 C3 4F 25 90 94 7A 93 9E 
+EF AC E1 66 E5 19 1F 43 09 6B 75 7A 59 87 E9 D5 E5 EE 95 7D 29 69 39 8D B8 64 08 1A 9F 6B 7D 4E 
+E5 97 5B 98 18 49 4C 8F A5 74 C0 6A B6 ED 28 A5 6F FC 04 44 B7 E8 D5 65 AF 4A 6D 43 29 E9 0F C6 
+93 49 EF D2 CA 29 7B CD A7 6C 64 30 8A 40 36 68 A5 BB 47 18 AC F8 75 83 71 FA 8C 25 23 03 C8 C4 
+D7 B4 4E D5 0B D9 C9 CA 27 7F 9F 15 22 80 D4 26 86 90 6A 51 F5 2A BA E4 38 DB 1B 71 40 A4 58 97 
+DA 86 52 52 B2 15 FA 34 13 6D 7E E6 FD 8A 83 56 CD 1E C4 41 F2 7B 10 5D 22 5F AA AA 1C 59 52 D7 
+69 96 56 A9 4D 0C 91 BB 57 0E EA F0 37 DF 2F 91 DA 86 D2 D6 B5 C0 E2 BA 43 F3 D7 01 02 22 F7 3C 
+7C 64 87 F5 EF 5E D9 57 6A 1B 4A 25 6F 19 2D BE 5F D2 D1 7A 42 6A 1B 4A A5 B6 A1 B4 7D D9 BA C1 
+E2 D7 75 18 BA D4 AA 5F 5D 5D 0C 40 16 3C 34 54 EE 5E B9 87 F7 9D DC 53 37 50 16 D5 0F EB 48 46 
+21 28 F6 81 FB 77 4C 00 C4 CD 40 7F 84 06 54 7F AC 5E 79 22 57 36 F9 25 CC FA E0 18 4C FE E1 35 
+C0 2A 88 CD 57 6F D2 96 B0 CC 2F 80 4B 41 6F 00 F9 22 26 FD FA 3F 81 85 78 EE 2D F8 89 5B 40 E6 
+62 A2 19 DF 46 E4 86 D0 D4 DB AC 9E 5B 2A 7E 72 35 70 2A 2A 17 6A 65 D9 6F DA 5C FB 15 60 10 8D 
+6B 86 67 4D 17 C6 FE AF CF 02 6F E1 B9 C7 50 9D 9C 86 70 27 C6 CC 1B 00 2F A0 BA 8A 4C 9F DB 5B 
+67 21 7E A2 D6 98 04 E4 D6 70 7A 78 06 F0 3E 48 AD 7A 65 73 A5 66 F9 89 E0 54 A3 9C 83 E9 00 9B 
+40 6E 56 AF AC A8 10 A6 62 7B FE 89 C0 6D 21 A9 01 CA 04 90 5F 49 75 FD 67 20 34 4B A0 B7 62 0E 
+13 58 0B FA 3C 66 EE 3B 17 49 77 10 A2 23 3F C0 E4 E8 69 02 06 A3 D2 80 9F 98 09 F2 1D 0C F1 DB 
+81 41 21 F1 6D B1 DC BC B4 AE B0 91 EA E5 E3 30 F3 FA 23 18 31 36 97 74 C3 E1 82 B0 6C 02 BF 6E 
+10 C2 77 30 1D E3 45 E0 59 E0 44 44 AE 27 D6 D2 81 4B BA DE 8A 21 BE C9 E8 21 0D E2 AF E8 8F 3A 
+BF 35 6D 67 1B C6 B8 38 02 B4 56 6A EA 8B CA 74 52 FC B0 23 7A 1B 3B 52 C3 08 F4 DF 30 C9 42 1D 
+24 B8 02 B2 B6 97 96 4F A0 72 AE 7A EE 38 F5 CA 4F 87 D8 28 20 85 CA 67 43 AB 63 5B AC 27 93 39 
+1E DE 3D 1C 47 4E 09 7B F1 55 E1 85 16 30 34 35 84 C6 C1 87 62 CE CC 6D A3 75 B0 CC 14 E1 A2 9C 
+5E B1 69 6D 0A B4 79 9F BD 41 CE 32 F5 2A 9A 48 A7 4E 07 39 5F 3D 77 AC 7A EE 99 94 A4 8E 03 76 
+21 9C 2D B5 89 FC 15 EE 26 34 76 22 8D 83 3F 84 06 A7 68 E5 E4 24 9A B9 16 63 AD 4C 40 6C 04 9E 
+7B 02 E6 1C 5F 50 BD 23 7F 28 EC 0C C5 92 BF 8B 98 73 87 CE AD D8 A5 33 CB D7 87 BB 38 80 B4 CE 
+FD D5 AB 68 D2 CA B2 55 B9 CF 93 DE C4 1C 66 10 63 FB EE FC E3 35 6A 74 D6 D4 D7 D5 F3 5A F4 9A 
+B2 30 3F BE 7C C8 68 26 4B B5 A2 22 A3 F3 26 A4 D1 A0 9D 7F BD 5E 33 65 1D F0 37 E0 63 E2 2F 0B 
+4F 71 D6 69 98 5E F8 07 94 29 02 62 7A 29 9F 02 FE C1 D0 E6 55 60 4C BE D9 3D 04 00 B3 6D 29 7F 
+07 A0 59 8F CD D3 6F A9 56 4E 7A 45 E7 4D 48 B7 59 64 9D 11 D6 5C A0 DE A4 9D 66 F1 F8 EE BD 98 
+5D B9 C3 A8 5E 51 70 3E B7 62 E7 F9 6F EA F4 B2 5C 02 B7 58 EC 2F 04 01 B4 D9 46 93 EA FA 99 88 
+7A 98 21 2A 2B DF 3C 04 63 4E 5E AF D0 0E 92 22 C9 40 50 48 A7 73 79 75 94 D7 F6 E8 4F AA CB 11 
+B9 09 8D 5D 20 FE 8A 67 80 D1 20 3F 42 78 0F D5 F9 2C 7A F0 0C 24 33 14 95 3E 40 BD 56 54 64 00 
+A4 A6 7E 3A 1A CC 01 39 11 C8 6E 54 18 FD 1C 69 7F 15 D1 97 F7 54 2F 1B 58 2D F5 E2 67 7D 7E 87 
+B5 91 D1 32 02 93 D6 7D 9F B0 BA C8 92 85 F5 67 E1 E8 02 60 37 CA B3 38 6A AC 9D 2A E7 51 F0 49 
+A1 6A 6C E7 71 CD CD 5A E2 DA 87 3D 2C EA CE 32 D0 9B CC D0 93 31 A6 60 47 1E 24 9D 7E 0F C7 99 
+4F 26 98 86 88 E9 14 62 86 29 59 94 38 15 95 C5 20 CD 08 AB 41 B7 84 FA 9D 0B 74 38 33 EB A0 95 
+A9 D0 52 F2 24 A2 7B 66 AA CD 50 F0 C1 36 76 57 B8 4E 30 03 04 54 2E 6A 3B F4 88 9F DC 44 E1 C7 
+B4 6E 07 86 41 EC 38 CC 89 40 90 89 7F 04 69 3F 2B D3 CA B2 D5 E2 27 37 62 02 94 47 03 EF F3 F6 
+21 AB 74 DE 84 B4 F8 C9 0D 88 4C 05 DD 0D 6C 67 77 A9 99 11 05 32 23 AC 5D A6 33 CA 7F DD 46 BF 
+37 28 98 7C 5D 07 8C 43 F5 7E F5 42 63 5E 17 61 79 91 E5 1C 11 4A FD B8 D4 D5 F5 11 90 70 53 7D 
+78 11 42 8C 8B 49 C0 8D E2 AF 38 46 16 2F 3B 16 D1 9B C2 DF F2 E7 C5 CB 31 DE 0F E3 81 47 B2 EE 
+1A C0 0A D0 8F 00 A3 51 79 B8 75 4F 42 B3 9E 12 72 5A 76 9D 20 7E FD B9 EC E9 5D D0 09 E4 29 F3 
+22 D7 C9 A2 07 CF 94 AA 86 B8 D4 D4 5F 26 7E B2 5E 16 D4 9F 54 44 3B 2D 93 AF 7A 5F F8 FA 23 B6 
+F6 79 1F 3F B9 1D 95 87 8B 93 21 3F 0E DF 4D 86 CC 06 32 B1 F5 E4 D2 09 B4 1F 93 03 5D DE E6 53 
+6E E7 4C 65 45 EB 7B 87 5C 19 D1 AC 07 C5 7F 92 6A DA 8A 9F FC 00 F4 F7 45 E9 37 B4 79 01 E8 B3 
+C0 58 82 E0 69 86 37 6D 0B A7 C2 93 89 E9 5D C5 88 2A 90 FC 74 0B B0 01 D5 F6 29 B4 D2 DA 8C F1 
+20 68 04 D0 4A F7 97 88 FE 3B B0 16 D3 4B DF 45 F4 36 CC D9 56 1B 42 39 80 6E 0E EB ED 71 D8 8B 
+56 96 2D 0B ED F6 7F C2 CC A3 57 85 CF 8C 0D E1 5F 0E 87 B5 3C 11 5E EB 0D 32 F1 5C 0A B0 54 C9 
+63 98 05 E1 6B C4 72 91 8E EA 95 27 8C 4B 0B 6B 30 6B 95 2D 08 DF 47 79 14 D8 40 20 A9 90 96 2D 
+E1 E7 3D C6 74 F3 E0 6E B9 00 E4 0E CC EC 2A 00 9E 03 F9 2E 43 53 93 3B E7 B1 3D FE 0F E4 2C B5 
+B8 3A B8 3B 5D 00 00 00 00 49 45 4E 44 AE 42 60 82 AC $EndBitmap
+EndData
+$EndBitmap
+Wire Wire Line
+	5350 4600 5250 4600
+Wire Wire Line
+	5350 4400 5250 4400
+$Comp
+L GND #PWR09
+U 1 1 550CF9FF
+P 5350 4700
+F 0 "#PWR09" H 5350 4700 30  0001 C CNN
+F 1 "GND" H 5350 4630 30  0001 C CNN
+F 2 "" H 5350 4700 60  0000 C CNN
+F 3 "" H 5350 4700 60  0000 C CNN
+	1    5350 4700
+	1    0    0    -1  
+$EndComp
+Wire Wire Line
+	5350 4400 5350 4700
+Connection ~ 5350 4600
+Text Notes 5050 4800 0    40   ~ 0
+chassis ground
+$Comp
+L GND #PWR010
+U 1 1 550CFBE5
+P 5350 6250
+F 0 "#PWR010" H 5350 6250 30  0001 C CNN
+F 1 "GND" H 5350 6180 30  0001 C CNN
+F 2 "" H 5350 6250 60  0000 C CNN
+F 3 "" H 5350 6250 60  0000 C CNN
+	1    5350 6250
+	1    0    0    -1  
+$EndComp
+Text Notes 5150 6400 0    40   ~ 0
+chassis ground
+$Comp
+L PWR_FLAG #FLG011
+U 1 1 550CFBF4
+P 5350 6150
+F 0 "#FLG011" H 5350 6245 30  0001 C CNN
+F 1 "PWR_FLAG" H 5350 6330 30  0000 C CNN
+F 2 "" H 5350 6150 60  0000 C CNN
+F 3 "" H 5350 6150 60  0000 C CNN
+	1    5350 6150
+	1    0    0    -1  
+$EndComp
+Wire Wire Line
+	5350 6150 5350 6250
+$Comp
+L CONN_1 P5
+U 1 1 550D1AD1
+P 5000 6150
+F 0 "P5" H 5080 6150 40  0000 L CNN
+F 1 "GND" H 5000 6205 30  0001 C CNN
+F 2 "mfk-AVA-20ga" H 5000 6150 60  0001 C CNN
+F 3 "" H 5000 6150 60  0000 C CNN
+	1    5000 6150
+	-1   0    0    1   
+$EndComp
+Wire Wire Line
+	5150 6150 5350 6150
+$Comp
+L C C2
+U 1 1 550D2A54
+P 6900 5500
+F 0 "C2" H 6900 5600 40  0000 L CNN
+F 1 "1u" H 6906 5415 40  0000 L CNN
+F 2 "mfk-C_4.0_2.5_2.5_0.5" H 6938 5350 30  0001 C CNN
+F 3 "TDK FK18X5R1A105K" H 6900 5500 60  0001 C CNN
+	1    6900 5500
+	1    0    0    -1  
+$EndComp
+Wire Wire Line
+	6900 5150 6900 5300
+$Comp
+L DGND #PWR012
+U 1 1 550D2ACA
+P 6900 5800
+F 0 "#PWR012" H 6900 5800 40  0001 C CNN
+F 1 "DGND" H 6900 5730 40  0000 C CNN
+F 2 "" H 6900 5800 60  0000 C CNN
+F 3 "" H 6900 5800 60  0000 C CNN
+	1    6900 5800
+	1    0    0    -1  
+$EndComp
+Wire Wire Line
+	6900 5800 6900 5700
+NoConn ~ 8300 4400
+NoConn ~ 8300 4850
+Connection ~ 8450 5000
+Wire Wire Line
+	8450 3750 8450 4100
+Wire Wire Line
+	7600 3650 7600 3750
+Connection ~ 7600 3750
+Wire Wire Line
+	6900 4100 6750 4100
+Wire Wire Line
+	6150 4150 6150 4400
+Connection ~ 8450 4100
+Wire Wire Line
+	8300 5150 8450 5150
+Connection ~ 8450 5150
+Wire Wire Line
+	6900 5000 6400 5000
+Wire Wire Line
+	6400 5000 6400 6150
+$Comp
+L CONN_3 P3
+U 1 1 551F2247
+P 2750 1800
+F 0 "P3" V 2700 1800 50  0000 C CNN
+F 1 "PWR" V 2800 1800 40  0000 C CNN
+F 2 "mfk-TE_282834-3" H 2750 1800 60  0001 C CNN
+F 3 "" H 2750 1800 60  0000 C CNN
+	1    2750 1800
+	-1   0    0    -1  
+$EndComp
+Wire Wire Line
+	3650 1800 3100 1800
+Wire Wire Line
+	3100 1700 3350 1700
+Wire Wire Line
+	3150 1250 3150 1700
+Text Label 3150 1250 3    60   ~ 0
+V_MOT
+Wire Wire Line
+	6750 4100 6750 3750
+Wire Wire Line
+	6750 5150 6750 6150
+Text Label 6750 6150 1    60   ~ 0
+V_MOT
+$Comp
+L PWR_FLAG #FLG013
+U 1 1 551F243F
+P 3350 1650
+F 0 "#FLG013" H 3350 1745 30  0001 C CNN
+F 1 "PWR_FLAG" H 3350 1830 30  0000 C CNN
+F 2 "" H 3350 1650 60  0000 C CNN
+F 3 "" H 3350 1650 60  0000 C CNN
+	1    3350 1650
+	-1   0    0    -1  
+$EndComp
+Connection ~ 3150 1700
+Wire Wire Line
+	3350 1700 3350 1650
+$Comp
+L JUMPER J1
+U 1 1 552023B1
+P 4750 1800
+F 0 "J1" H 4750 1950 60  0000 C CNN
+F 1 "PWR_BR" H 4750 1720 40  0000 C CNN
+F 2 "mfk-SIL-2" H 4750 1800 60  0001 C CNN
+F 3 "~" H 4750 1800 60  0000 C CNN
+	1    4750 1800
+	1    0    0    -1  
+$EndComp
+$Comp
+L +5VD #PWR014
+U 1 1 552023F3
+P 4400 1450
+F 0 "#PWR014" H 4400 1400 20  0001 C CNN
+F 1 "+5VD" H 4400 1550 50  0000 C CNN
+F 2 "" H 4400 1450 60  0000 C CNN
+F 3 "" H 4400 1450 60  0000 C CNN
+	1    4400 1450
+	-1   0    0    -1  
+$EndComp
+Wire Wire Line
+	4450 1800 4400 1800
+Wire Wire Line
+	4400 1800 4400 1450
+Text Label 5100 1350 3    60   ~ 0
+V_MOT
+Wire Wire Line
+	5050 1800 5100 1800
+Wire Wire Line
+	5100 1800 5100 1350
+Text Notes 4000 2000 0    60   ~ 0
+Use jumper to power motor from +5VD.
+$EndSCHEMATC

samples/KiCad/ultimate-temp-controller.sch

@@ -0,0 +1,69 @@
+EESchema Schematic File Version 2
+LIBS:power
+LIBS:device
+LIBS:transistors
+LIBS:conn
+LIBS:linear
+LIBS:regul
+LIBS:74xx
+LIBS:cmos4000
+LIBS:adc-dac
+LIBS:memory
+LIBS:xilinx
+LIBS:special
+LIBS:microcontrollers
+LIBS:dsp
+LIBS:microchip
+LIBS:analog_switches
+LIBS:motorola
+LIBS:texas
+LIBS:intel
+LIBS:audio
+LIBS:interface
+LIBS:digital-audio
+LIBS:philips
+LIBS:display
+LIBS:cypress
+LIBS:siliconi
+LIBS:opto
+LIBS:atmel
+LIBS:contrib
+LIBS:valves
+LIBS:relays
+LIBS:w_relay
+LIBS:ultimate-temp-controller-cache
+EELAYER 25 0
+EELAYER END
+$Descr A4 11693 8268
+encoding utf-8
+Sheet 1 2
+Title ""
+Date ""
+Rev ""
+Comp ""
+Comment1 ""
+Comment2 ""
+Comment3 ""
+Comment4 ""
+$EndDescr
+$Sheet
+S 1400 2100 2150 2000
+U 54E5B803
+F0 "controller" 60
+F1 "controller.sch" 60
+F2 "TC+" I L 1400 2300 60 
+F3 "TC-" I L 1400 2400 60 
+F4 "VCC" I L 1400 3750 60 
+F5 "GND" I L 1400 3900 60 
+F6 "RS485A" I R 3550 3700 60 
+F7 "RS485B" I R 3550 3800 60 
+F8 "DRAIN" O R 3550 3300 60 
+F9 "+5V" O R 3550 2250 60 
+F10 "SDA" B R 3550 2350 60 
+F11 "SCL" B R 3550 2450 60 
+F12 "GND" O R 3550 2550 60 
+F13 "RELAY_NO" I R 3550 2850 60 
+F14 "RELAY_COM" I R 3550 3050 60 
+F15 "RELAY_NC" I R 3550 2950 60 
+$EndSheet
+$EndSCHEMATC

samples/Lean/binary.lean

@@ -0,0 +1,75 @@
+/-
+Copyright (c) 2014 Microsoft Corporation. All rights reserved.
+Released under Apache 2.0 license as described in the file LICENSE.
+
+Module: algebra.binary
+Authors: Leonardo de Moura, Jeremy Avigad
+
+General properties of binary operations.
+-/
+
+import logic.eq
+open eq.ops
+
+namespace binary
+  section
+    variable {A : Type}
+    variables (op₁ : A → A → A) (inv : A → A) (one : A)
+
+    local notation a * b := op₁ a b
+    local notation a ⁻¹  := inv a
+    local notation 1     := one
+
+    definition commutative := ∀a b, a * b = b * a
+    definition associative := ∀a b c, (a * b) * c = a * (b * c)
+    definition left_identity := ∀a, 1 * a = a
+    definition right_identity := ∀a, a * 1 = a
+    definition left_inverse := ∀a, a⁻¹ * a = 1
+    definition right_inverse := ∀a, a * a⁻¹ = 1
+    definition left_cancelative := ∀a b c, a * b = a * c → b = c
+    definition right_cancelative := ∀a b c, a * b = c * b → a = c
+
+    definition inv_op_cancel_left := ∀a b, a⁻¹ * (a * b) = b
+    definition op_inv_cancel_left := ∀a b, a * (a⁻¹ * b) = b
+    definition inv_op_cancel_right := ∀a b, a * b⁻¹ * b =  a
+    definition op_inv_cancel_right := ∀a b, a * b * b⁻¹ = a
+
+    variable (op₂ : A → A → A)
+
+    local notation a + b := op₂ a b
+
+    definition left_distributive := ∀a b c, a * (b + c) = a * b + a * c
+    definition right_distributive := ∀a b c, (a + b) * c = a * c + b * c
+  end
+
+  context
+    variable {A : Type}
+    variable {f : A → A → A}
+    variable H_comm : commutative f
+    variable H_assoc : associative f
+    infixl `*` := f
+    theorem left_comm : ∀a b c, a*(b*c) = b*(a*c) :=
+    take a b c, calc
+      a*(b*c) = (a*b)*c  : H_assoc
+        ...   = (b*a)*c  : H_comm
+        ...   = b*(a*c)  : H_assoc
+
+    theorem right_comm : ∀a b c, (a*b)*c = (a*c)*b :=
+    take a b c, calc
+      (a*b)*c = a*(b*c) : H_assoc
+        ...   = a*(c*b) : H_comm
+        ...   = (a*c)*b : H_assoc
+  end
+
+  context
+    variable {A : Type}
+    variable {f : A → A → A}
+    variable H_assoc : associative f
+    infixl `*` := f
+    theorem assoc4helper (a b c d) : (a*b)*(c*d) = a*((b*c)*d) :=
+    calc
+      (a*b)*(c*d) = a*(b*(c*d)) : H_assoc
+              ... = a*((b*c)*d) : H_assoc
+  end
+
+end binary

samples/Lean/set.hlean

@@ -0,0 +1,70 @@
+-- Copyright (c) 2015 Jakob von Raumer. All rights reserved.
+-- Released under Apache 2.0 license as described in the file LICENSE.
+-- Authors: Jakob von Raumer
+-- Category of sets
+
+import .basic types.pi trunc
+
+open truncation sigma sigma.ops pi function eq morphism precategory
+open equiv
+
+namespace precategory
+
+  universe variable l
+
+  definition set_precategory : precategory.{l+1 l} (Σ (A : Type.{l}), is_hset A) :=
+  begin
+    fapply precategory.mk.{l+1 l},
+                  intros, apply (a.1 → a_1.1),
+                intros, apply trunc_pi, intros, apply b.2,
+              intros, intro x, exact (a_1 (a_2 x)),
+            intros, exact (λ (x : a.1), x),
+          intros, apply funext.path_pi, intro x, apply idp,
+        intros, apply funext.path_pi, intro x, apply idp,
+      intros, apply funext.path_pi, intro x, apply idp,
+  end
+
+end precategory
+
+namespace category
+
+  universe variable l
+  local attribute precategory.set_precategory.{l+1 l} [instance]
+
+  definition set_category_equiv_iso (a b : (Σ (A : Type.{l}), is_hset A))
+    : (a ≅ b) = (a.1 ≃ b.1) :=
+  /-begin
+    apply ua, fapply equiv.mk,
+      intro H,
+        apply (isomorphic.rec_on H), intros (H1, H2),
+        apply (is_iso.rec_on H2), intros (H3, H4, H5),
+        fapply equiv.mk,
+        apply (isomorphic.rec_on H), intros (H1, H2),
+        exact H1,
+      fapply is_equiv.adjointify, exact H3,
+          exact sorry,
+        exact sorry,
+  end-/ sorry
+
+  definition set_category : category.{l+1 l} (Σ (A : Type.{l}), is_hset A) :=
+  /-begin
+    assert (C : precategory.{l+1 l} (Σ (A : Type.{l}), is_hset A)),
+      apply precategory.set_precategory,
+    apply category.mk,
+    assert (p : (λ A B p, (set_category_equiv_iso A B) ▹ iso_of_path p) = (λ A B p, @equiv_path A.1 B.1 p)),
+    apply is_equiv.adjointify,
+        intros,
+        apply (isomorphic.rec_on a_1), intros (iso', is_iso'),
+        apply (is_iso.rec_on is_iso'), intros (f', f'sect, f'retr),
+        fapply sigma.path,
+          apply ua, fapply equiv.mk, exact iso',
+          fapply is_equiv.adjointify,
+              exact f',
+            intros, apply (f'retr ▹ _),
+          intros, apply (f'sect ▹ _),
+        apply (@is_hprop.elim),
+        apply is_trunc_is_hprop,
+      intros,
+  end -/ sorry
+
+end category

samples/Limbo/cat.b

@@ -0,0 +1,48 @@
+implement Cat;
+
+include "sys.m";
+	sys: Sys;
+
+include "draw.m";
+
+Cat: module
+{
+	init:	fn(ctxt: ref Draw->Context, argv: list of string);
+};
+
+stdout: ref Sys->FD;
+
+init(nil: ref Draw->Context, args: list of string)
+{
+	sys = load Sys Sys->PATH;
+	stdout = sys->fildes(1);
+	args = tl args;
+	if(args == nil)
+		args = "-" :: nil;
+	for(; args != nil; args = tl args){
+		file := hd args;
+		if(file != "-"){
+			fd := sys->open(file, Sys->OREAD);
+			if(fd == nil){
+				sys->fprint(sys->fildes(2), "cat: cannot open %s: %r\n", file);
+				raise "fail:bad open";
+			}
+			cat(fd, file);
+		}else
+			cat(sys->fildes(0), "<stdin>");
+	}
+}
+
+cat(fd: ref Sys->FD, file: string)
+{
+	buf := array[Sys->ATOMICIO] of byte;
+	while((n := sys->read(fd, buf, len buf)) > 0)
+		if(sys->write(stdout, buf, n) < n) {
+			sys->fprint(sys->fildes(2), "cat: write error: %r\n");
+			raise "fail:write error";
+		}
+	if(n < 0) {
+		sys->fprint(sys->fildes(2), "cat: error reading %s: %r\n", file);
+		raise "fail:read error";
+	}
+}

samples/Limbo/lock.b

@@ -0,0 +1,26 @@
+implement Lock;
+
+include "sys.m";
+	sys:	Sys;
+include "lock.m";
+
+Semaphore.obtain(l: self ref Semaphore)
+{
+	l.c <-= 0;
+}
+
+Semaphore.release(l: self ref Semaphore)
+{
+	<-l.c;
+}
+
+Semaphore.new(): ref Semaphore
+{
+	l := ref Semaphore;
+	l.c = chan[1] of int;
+	return l;
+}
+
+init()
+{
+}

samples/Limbo/lock.m

@@ -0,0 +1,13 @@
+Lock: module
+{
+	PATH:	con "/dis/lib/lock.dis";
+
+	Semaphore: adt {
+		c: chan of int;
+		obtain:	fn(nil: self ref Semaphore);
+		release: fn(nil: self ref Semaphore);
+		new: fn(): ref Semaphore;
+	};
+	
+	init: fn();
+};

samples/Linker Script/filenames/ld.script

@@ -0,0 +1,50 @@
+/*
+ * ld.script for compressed kernel support of MIPS
+ *
+ * Copyright (C) 2009 Lemote Inc.
+ * Author: Wu Zhangjin <wuzhanjing@gmail.com>
+ * Copyright (C) 2010 "Wu Zhangjin" <wuzhanjing@gmail.com>
+ */
+
+OUTPUT_ARCH(mips)
+ENTRY(start)
+SECTIONS
+{
+	/* Text and read-only data */
+	/* . = VMLINUZ_LOAD_ADDRESS; */
+	.text : {
+		*(.text)
+		*(.rodata)
+	}
+	/* End of text section */
+
+	/* Writable data */
+	.data : {
+		*(.data)
+		/* Put the compressed image here */
+		__image_begin = .;
+		*(.image)
+		__image_end = .;
+		CONSTRUCTORS
+	}
+	. = ALIGN(16);
+	_edata = .;
+	/* End of data section */
+
+	/* BSS */
+	.bss : {
+		*(.bss)
+	}
+	. = ALIGN(16);
+	_end = .;
+
+	/* Sections to be discarded */
+	/DISCARD/ : {
+		*(.MIPS.options)
+		*(.options)
+		*(.pdr)
+		*(.reginfo)
+		*(.comment)
+		*(.note)
+	}
+}

samples/Linker Script/link.ld

@@ -0,0 +1,12 @@
+/*
+*  link.ld
+*/
+OUTPUT_FORMAT(elf32-i386)
+ENTRY(start)
+SECTIONS
+ {
+   . = 0x100000;
+   .text : { *(.text) }
+   .data : { *(.data) }
+   .bss  : { *(.bss)  }
+ }

samples/Linker Script/vmlinux.lds

@@ -0,0 +1,373 @@
+/*
+ * ld script for the x86 kernel
+ *
+ * Historic 32-bit version written by Martin Mares <mj@atrey.karlin.mff.cuni.cz>
+ *
+ * Modernisation, unification and other changes and fixes:
+ *   Copyright (C) 2007-2009  Sam Ravnborg <sam@ravnborg.org>
+ *
+ *
+ * Don't define absolute symbols until and unless you know that symbol
+ * value is should remain constant even if kernel image is relocated
+ * at run time. Absolute symbols are not relocated. If symbol value should
+ * change if kernel is relocated, make the symbol section relative and
+ * put it inside the section definition.
+ */
+
+#ifdef CONFIG_X86_32
+#define LOAD_OFFSET __PAGE_OFFSET
+#else
+#define LOAD_OFFSET __START_KERNEL_map
+#endif
+
+#include <asm-generic/vmlinux.lds.h>
+#include <asm/asm-offsets.h>
+#include <asm/thread_info.h>
+#include <asm/page_types.h>
+#include <asm/cache.h>
+#include <asm/boot.h>
+
+#undef i386     /* in case the preprocessor is a 32bit one */
+
+OUTPUT_FORMAT(CONFIG_OUTPUT_FORMAT, CONFIG_OUTPUT_FORMAT, CONFIG_OUTPUT_FORMAT)
+
+#ifdef CONFIG_X86_32
+OUTPUT_ARCH(i386)
+ENTRY(phys_startup_32)
+jiffies = jiffies_64;
+#else
+OUTPUT_ARCH(i386:x86-64)
+ENTRY(phys_startup_64)
+jiffies_64 = jiffies;
+#endif
+
+#if defined(CONFIG_X86_64) && defined(CONFIG_DEBUG_RODATA)
+/*
+ * On 64-bit, align RODATA to 2MB so that even with CONFIG_DEBUG_RODATA
+ * we retain large page mappings for boundaries spanning kernel text, rodata
+ * and data sections.
+ *
+ * However, kernel identity mappings will have different RWX permissions
+ * to the pages mapping to text and to the pages padding (which are freed) the
+ * text section. Hence kernel identity mappings will be broken to smaller
+ * pages. For 64-bit, kernel text and kernel identity mappings are different,
+ * so we can enable protection checks that come with CONFIG_DEBUG_RODATA,
+ * as well as retain 2MB large page mappings for kernel text.
+ */
+#define X64_ALIGN_DEBUG_RODATA_BEGIN	. = ALIGN(HPAGE_SIZE);
+
+#define X64_ALIGN_DEBUG_RODATA_END				\
+		. = ALIGN(HPAGE_SIZE);				\
+		__end_rodata_hpage_align = .;
+
+#else
+
+#define X64_ALIGN_DEBUG_RODATA_BEGIN
+#define X64_ALIGN_DEBUG_RODATA_END
+
+#endif
+
+PHDRS {
+	text PT_LOAD FLAGS(5);          /* R_E */
+	data PT_LOAD FLAGS(6);          /* RW_ */
+#ifdef CONFIG_X86_64
+#ifdef CONFIG_SMP
+	percpu PT_LOAD FLAGS(6);        /* RW_ */
+#endif
+	init PT_LOAD FLAGS(7);          /* RWE */
+#endif
+	note PT_NOTE FLAGS(0);          /* ___ */
+}
+
+SECTIONS
+{
+#ifdef CONFIG_X86_32
+        . = LOAD_OFFSET + LOAD_PHYSICAL_ADDR;
+        phys_startup_32 = startup_32 - LOAD_OFFSET;
+#else
+        . = __START_KERNEL;
+        phys_startup_64 = startup_64 - LOAD_OFFSET;
+#endif
+
+	/* Text and read-only data */
+	.text :  AT(ADDR(.text) - LOAD_OFFSET) {
+		_text = .;
+		/* bootstrapping code */
+		HEAD_TEXT
+		. = ALIGN(8);
+		_stext = .;
+		TEXT_TEXT
+		SCHED_TEXT
+		LOCK_TEXT
+		KPROBES_TEXT
+		ENTRY_TEXT
+		IRQENTRY_TEXT
+		*(.fixup)
+		*(.gnu.warning)
+		/* End of text section */
+		_etext = .;
+	} :text = 0x9090
+
+	NOTES :text :note
+
+	EXCEPTION_TABLE(16) :text = 0x9090
+
+#if defined(CONFIG_DEBUG_RODATA)
+	/* .text should occupy whole number of pages */
+	. = ALIGN(PAGE_SIZE);
+#endif
+	X64_ALIGN_DEBUG_RODATA_BEGIN
+	RO_DATA(PAGE_SIZE)
+	X64_ALIGN_DEBUG_RODATA_END
+
+	/* Data */
+	.data : AT(ADDR(.data) - LOAD_OFFSET) {
+		/* Start of data section */
+		_sdata = .;
+
+		/* init_task */
+		INIT_TASK_DATA(THREAD_SIZE)
+
+#ifdef CONFIG_X86_32
+		/* 32 bit has nosave before _edata */
+		NOSAVE_DATA
+#endif
+
+		PAGE_ALIGNED_DATA(PAGE_SIZE)
+
+		CACHELINE_ALIGNED_DATA(L1_CACHE_BYTES)
+
+		DATA_DATA
+		CONSTRUCTORS
+
+		/* rarely changed data like cpu maps */
+		READ_MOSTLY_DATA(INTERNODE_CACHE_BYTES)
+
+		/* End of data section */
+		_edata = .;
+	} :data
+
+
+	. = ALIGN(PAGE_SIZE);
+	__vvar_page = .;
+
+	.vvar : AT(ADDR(.vvar) - LOAD_OFFSET) {
+		/* work around gold bug 13023 */
+		__vvar_beginning_hack = .;
+
+		/* Place all vvars at the offsets in asm/vvar.h. */
+#define EMIT_VVAR(name, offset) 			\
+		. = __vvar_beginning_hack + offset;	\
+		*(.vvar_ ## name)
+#define __VVAR_KERNEL_LDS
+#include <asm/vvar.h>
+#undef __VVAR_KERNEL_LDS
+#undef EMIT_VVAR
+
+		/*
+		 * Pad the rest of the page with zeros.  Otherwise the loader
+		 * can leave garbage here.
+		 */
+		. = __vvar_beginning_hack + PAGE_SIZE;
+	} :data
+
+       . = ALIGN(__vvar_page + PAGE_SIZE, PAGE_SIZE);
+
+	/* Init code and data - will be freed after init */
+	. = ALIGN(PAGE_SIZE);
+	.init.begin : AT(ADDR(.init.begin) - LOAD_OFFSET) {
+		__init_begin = .; /* paired with __init_end */
+	}
+
+#if defined(CONFIG_X86_64) && defined(CONFIG_SMP)
+	/*
+	 * percpu offsets are zero-based on SMP.  PERCPU_VADDR() changes the
+	 * output PHDR, so the next output section - .init.text - should
+	 * start another segment - init.
+	 */
+	PERCPU_VADDR(INTERNODE_CACHE_BYTES, 0, :percpu)
+	ASSERT(SIZEOF(.data..percpu) < CONFIG_PHYSICAL_START,
+	       "per-CPU data too large - increase CONFIG_PHYSICAL_START")
+#endif
+
+	INIT_TEXT_SECTION(PAGE_SIZE)
+#ifdef CONFIG_X86_64
+	:init
+#endif
+
+	INIT_DATA_SECTION(16)
+
+	.x86_cpu_dev.init : AT(ADDR(.x86_cpu_dev.init) - LOAD_OFFSET) {
+		__x86_cpu_dev_start = .;
+		*(.x86_cpu_dev.init)
+		__x86_cpu_dev_end = .;
+	}
+
+#ifdef CONFIG_X86_INTEL_MID
+	.x86_intel_mid_dev.init : AT(ADDR(.x86_intel_mid_dev.init) - \
+								LOAD_OFFSET) {
+		__x86_intel_mid_dev_start = .;
+		*(.x86_intel_mid_dev.init)
+		__x86_intel_mid_dev_end = .;
+	}
+#endif
+
+	/*
+	 * start address and size of operations which during runtime
+	 * can be patched with virtualization friendly instructions or
+	 * baremetal native ones. Think page table operations.
+	 * Details in paravirt_types.h
+	 */
+	. = ALIGN(8);
+	.parainstructions : AT(ADDR(.parainstructions) - LOAD_OFFSET) {
+		__parainstructions = .;
+		*(.parainstructions)
+		__parainstructions_end = .;
+	}
+
+	/*
+	 * struct alt_inst entries. From the header (alternative.h):
+	 * "Alternative instructions for different CPU types or capabilities"
+	 * Think locking instructions on spinlocks.
+	 */
+	. = ALIGN(8);
+	.altinstructions : AT(ADDR(.altinstructions) - LOAD_OFFSET) {
+		__alt_instructions = .;
+		*(.altinstructions)
+		__alt_instructions_end = .;
+	}
+
+	/*
+	 * And here are the replacement instructions. The linker sticks
+	 * them as binary blobs. The .altinstructions has enough data to
+	 * get the address and the length of them to patch the kernel safely.
+	 */
+	.altinstr_replacement : AT(ADDR(.altinstr_replacement) - LOAD_OFFSET) {
+		*(.altinstr_replacement)
+	}
+
+	/*
+	 * struct iommu_table_entry entries are injected in this section.
+	 * It is an array of IOMMUs which during run time gets sorted depending
+	 * on its dependency order. After rootfs_initcall is complete
+	 * this section can be safely removed.
+	 */
+	.iommu_table : AT(ADDR(.iommu_table) - LOAD_OFFSET) {
+		__iommu_table = .;
+		*(.iommu_table)
+		__iommu_table_end = .;
+	}
+
+	. = ALIGN(8);
+	.apicdrivers : AT(ADDR(.apicdrivers) - LOAD_OFFSET) {
+		__apicdrivers = .;
+		*(.apicdrivers);
+		__apicdrivers_end = .;
+	}
+
+	. = ALIGN(8);
+	/*
+	 * .exit.text is discard at runtime, not link time, to deal with
+	 *  references from .altinstructions and .eh_frame
+	 */
+	.exit.text : AT(ADDR(.exit.text) - LOAD_OFFSET) {
+		EXIT_TEXT
+	}
+
+	.exit.data : AT(ADDR(.exit.data) - LOAD_OFFSET) {
+		EXIT_DATA
+	}
+
+#if !defined(CONFIG_X86_64) || !defined(CONFIG_SMP)
+	PERCPU_SECTION(INTERNODE_CACHE_BYTES)
+#endif
+
+	. = ALIGN(PAGE_SIZE);
+
+	/* freed after init ends here */
+	.init.end : AT(ADDR(.init.end) - LOAD_OFFSET) {
+		__init_end = .;
+	}
+
+	/*
+	 * smp_locks might be freed after init
+	 * start/end must be page aligned
+	 */
+	. = ALIGN(PAGE_SIZE);
+	.smp_locks : AT(ADDR(.smp_locks) - LOAD_OFFSET) {
+		__smp_locks = .;
+		*(.smp_locks)
+		. = ALIGN(PAGE_SIZE);
+		__smp_locks_end = .;
+	}
+
+#ifdef CONFIG_X86_64
+	.data_nosave : AT(ADDR(.data_nosave) - LOAD_OFFSET) {
+		NOSAVE_DATA
+	}
+#endif
+
+	/* BSS */
+	. = ALIGN(PAGE_SIZE);
+	.bss : AT(ADDR(.bss) - LOAD_OFFSET) {
+		__bss_start = .;
+		*(.bss..page_aligned)
+		*(.bss)
+		. = ALIGN(PAGE_SIZE);
+		__bss_stop = .;
+	}
+
+	. = ALIGN(PAGE_SIZE);
+	.brk : AT(ADDR(.brk) - LOAD_OFFSET) {
+		__brk_base = .;
+		. += 64 * 1024;		/* 64k alignment slop space */
+		*(.brk_reservation)	/* areas brk users have reserved */
+		__brk_limit = .;
+	}
+
+	_end = .;
+
+        STABS_DEBUG
+        DWARF_DEBUG
+
+	/* Sections to be discarded */
+	DISCARDS
+	/DISCARD/ : { *(.eh_frame) }
+}
+
+
+#ifdef CONFIG_X86_32
+/*
+ * The ASSERT() sink to . is intentional, for binutils 2.14 compatibility:
+ */
+. = ASSERT((_end - LOAD_OFFSET <= KERNEL_IMAGE_SIZE),
+	   "kernel image bigger than KERNEL_IMAGE_SIZE");
+#else
+/*
+ * Per-cpu symbols which need to be offset from __per_cpu_load
+ * for the boot processor.
+ */
+#define INIT_PER_CPU(x) init_per_cpu__##x = x + __per_cpu_load
+INIT_PER_CPU(gdt_page);
+INIT_PER_CPU(irq_stack_union);
+
+/*
+ * Build-time check on the image size:
+ */
+. = ASSERT((_end - _text <= KERNEL_IMAGE_SIZE),
+	   "kernel image bigger than KERNEL_IMAGE_SIZE");
+
+#ifdef CONFIG_SMP
+. = ASSERT((irq_stack_union == 0),
+           "irq_stack_union is not at start of per-cpu area");
+#endif
+
+#endif /* CONFIG_X86_32 */
+
+#ifdef CONFIG_KEXEC
+#include <asm/kexec.h>
+
+. = ASSERT(kexec_control_code_size <= KEXEC_CONTROL_CODE_MAX_SIZE,
+           "kexec control code size is too big");
+#endif
+

samples/MUF/39.m

@@ -0,0 +1,278 @@
+$include $lib/strings
+$include $lib/match
+lvar check-obj-addr
+   
+: check-next-loop (d -- )
+   dup not if pop exit then
+   dup exit? over thing? or
+   me @ 3 pick .controls and if
+      dup check-obj-addr @ execute
+   then
+   next check-next-loop
+;
+   
+: check-contents (d -- )
+   contents check-next-loop
+;
+   
+: check-exits (d -- )
+   exits check-next-loop
+;
+   
+: exec-err (d mtypestr warnstr -- )
+   "On " 4 rotate unparseobj strcat
+   ", in it's " strcat rot strcat
+   ", " strcat swap strcat .tell
+;
+   
+: can-linkto? (player object -- i)
+   dup "link_ok" flag? if pop pop 1 exit then
+   .controls
+;
+   
+: check-exec (d mtype execstr -- )
+   dup "@" 1 strncmp if pop pop pop exit then
+   1 strcut swap pop
+   " " .split pop
+   dup "$" 1 strncmp not if
+      dup match ok? not if
+         " is not a known registered program." strcat
+         exec-err exit
+      then
+      dup match program? not if
+         " is not a program." strcat
+         exec-err exit
+      then
+      3 pick owner over match can-linkto? not if
+         " is not Link_OK." strcat
+         exec-err exit
+      then
+   else
+      dup number? not if
+         " is not a program dbref." strcat
+         "@" swap strcat exec-err exit
+      then
+      dup atoi dbref ok? not if
+         " is not a valid program reference." strcat
+         "@" swap strcat exec-err exit
+      then
+      dup atoi dbref program? not if
+         " is not a valid program reference." strcat
+         "@" swap strcat exec-err exit
+      then
+      3 pick owner over atoi dbref can-linkto? not if
+         " is not Link_OK." strcat
+         "@" swap strcat exec-err exit
+      then
+   then
+   pop pop pop
+;
+   
+   
+: missing-err ( d s -- )
+   swap unparseobj
+   " is missing an "
+   strcat swap strcat
+   " message." strcat .tell
+;
+   
+: colon-err ( d s -- )
+   swap unparseobj
+   " has an unnecesary ':' at the start of its "
+   strcat swap strcat
+   " message." strcat .tell
+;
+   
+: check-desc (d -- )
+   dup desc not if
+      "@description" missing-err
+   else
+      "@description" over
+      desc check-exec
+   then
+;
+   
+: check-succ (d -- )
+   dup succ not if
+      "@success" missing-err
+   else
+      "@success" over
+      succ check-exec
+   then
+;
+   
+: check-fail (d -- )
+   dup fail not if
+      "@fail" missing-err
+   else
+      "@fail" over
+      fail check-exec
+   then
+;
+   
+: check-drop (d -- )
+   dup drop not if
+      "@drop" missing-err
+   else
+      "@drop" over
+      drop check-exec
+   then
+;
+   
+: check-osucc (d -- )
+   dup osucc not if
+      "@osuccess" missing-err
+   else
+      dup osucc ":" 1 strncmp not if
+         "@osuccess" colon-err
+      else pop
+      then
+   then
+;
+   
+: check-ofail (d -- )
+   dup ofail not if
+      "@ofail" missing-err
+   else
+      dup ofail ":" 1 strncmp not if
+         "@ofail" colon-err
+      else pop
+      then
+   then
+;
+   
+: check-odrop (d -- )
+   dup odrop not if
+      "@odrop" missing-err
+   else
+      dup odrop ":" 1 strncmp not if
+         "@odrop" colon-err
+      else pop
+      then
+   then
+;
+   
+   
+$define islocked? (d -- i) getlockstr "*UNLOCKED*" stringcmp $enddef
+   
+: islocked_always? (d -- i)
+   getlockstr dup "#0" stringcmp not if pop 1 exit then
+   dup "#" STRsplit swap pop atoi
+   "#" swap intostr strcat
+   (lockstr "#dbref")
+   dup "&!" over strcat strcat
+   3 pick stringcmp not if pop pop 1 exit then
+   "&" over strcat strcat "!" swap strcat
+   stringcmp not if 1 exit then
+   0
+;
+   
+: check-link ( d -- )
+   dup getlink not if
+      dup unparseobj " is unlinked." strcat .tell
+   else
+      dup getlink over location dbcmp if
+         dup islocked? not if
+            dup unparseobj
+            " is linked to it's location, but is unlocked."
+            strcat .tell
+         then
+      else (is not linked to it's location)
+         dup getlink program? if
+            dup dup owner swap getlink can-linkto? not if
+               dup unparseobj
+               " is linked to a program which is not Link_OK."
+               strcat .tell
+            then
+         then
+      then
+   then
+   pop
+;
+         
+: check-room (d -- )
+   dup check-desc
+   dup islocked? if
+      dup islocked_always? not if
+         dup check-succ
+      then
+      dup check-fail
+   then
+   dup getlink if
+      dup check-drop
+      dup check-odrop
+   then
+   dup check-contents
+   check-exits
+;
+   
+: check-exit ( d -- )
+   dup check-link
+   dup check-desc
+   dup getlink dup ok? if
+      program? not if
+         dup islocked_always? not if
+            dup check-succ
+            dup check-osucc
+            dup check-odrop
+         then
+         dup islocked? if
+            dup check-fail
+            dup check-ofail
+         then
+      then
+   else pop
+   then
+   pop
+;
+   
+: check-thing ( d -- )
+   dup check-desc
+   dup islocked_always? not if
+      dup check-succ
+      dup check-osucc
+   then
+   dup islocked? if
+      dup check-fail
+      dup check-ofail
+   then
+   dup check-drop
+   dup check-odrop
+   check-exits
+;
+   
+: check-player ( d -- )
+   dup check-desc
+   dup islocked_always? not if
+      dup check-succ
+      dup check-osucc
+   then
+   dup islocked? if
+      dup check-fail
+      dup check-ofail
+   then
+   dup check-contents
+   check-exits
+;
+   
+: check-program ( d -- )
+   check-desc
+;
+   
+: check-obj (d -- )
+   dup room?   if check-room   exit then
+   dup exit?   if check-exit   exit then
+   dup thing?  if check-thing  exit then
+   dup player? if check-player exit then
+   check-program
+;
+   
+: main
+   'check-obj check-obj-addr !
+   .strip dup not if pop "here" then
+   .match_controlled
+   dup #-3 dbcmp if pop me @ getlink then
+   dup ok? not if pop exit then
+   check-obj
+   me @ "Check done." notify
+;

samples/MUF/cmd-say.muf

@@ -0,0 +1,275 @@
+@program cmd-say.muf
+1 1000 d
+i
+( cmd-say.muf by Natasha@HLM
+
+  Copyright 2002-2004 Natasha Snunkmeox. Copyright 2002-2004 Here Lie Monsters.
+  "@view $box/mit" for license information.
+)
+$author Natasha Snunkmeox <natmeox@neologasm.org>
+$note Say for Fuzzball 6.
+$version 1.0
+
+$include $lib/ignore
+$include $lib/strings
+$include $lib/match
+
+$def str_program "saypose"
+$def prop_third "_prefs/say/third"
+$def prop_quotes "_say/def/quotes"
+$def prop_overb "_say/def/osay"
+$def prop_verb "_say/def/say"
+$def prop_split "_prefs/say/split"
+$def prop_color "_prefs/say/color"
+$def prop_meow "_prefs/say/meow"
+
+lvar randomWord
+
+lvar verb
+lvar overb
+lvar lquo
+lvar rquo
+lvar splitsay
+
+: rtn-getThirdVerb[ var:overb -- ]
+    ( Get the third-person verb. )
+    me @ prop_overb getpropstr dup if  ( str strOverb )
+        strip dup dup "," instr not and if "," strcat then
+    else pop "says," then  ( str strOverb )
+    me @ "%D %s" fmtstring overb @ !  ( str )
+;
+
+: rtn-getFirstVerb[ var:verb var:overb -- ]
+    me @ prop_third getpropstr .yes? not if  ( str )
+        ( Get the first-person verb. )
+        me @ prop_verb getpropstr dup if  ( str strVerb )
+            strip dup dup "," instr not and if "," strcat then
+        else pop "say," then  ( str strVerb )
+        splitsay @ if "you %s" else "You %s" then fmtstring  ( str strVerb )
+    else overb @ @ then verb @ !  ( str )
+;
+
+: rtn-getQuotes[ var:lquo var:rquo -- ]
+    me @ prop_quotes getpropstr dup "%m" instr if  ( strQuotes )
+        "%m" split  ( strLquo strRquo )
+    else pop "\"" dup then  ( strLquo strRquo )
+    rquo @ ! lquo @ !  (  )
+;
+
+: do-say  ( str -- )
+    "" randomWord !
+
+    var who
+    var exclude
+
+    ( Ignoring? Get 'em outta here. )
+    loc @ contents_array  ( str arrHere )
+    dup me @ str_program array_get_ignorers  ( str arrHere arrIgnorers )
+    dup exclude !
+    swap array_diff who !
+
+
+    ( Anyone #meowing this player? Go ahead and notify before special formatting. )
+    who @ prop_meow me @ owner "*{%d}*" fmtstring array_filter_prop  ( str arrMeow )
+    dup if  ( str arrMeow )
+        dup who @ array_diff who !  ( str arrMeow )
+        dup exclude @ array_union exclude !  ( str arrMeow )
+
+        over ansi_strip  ( str arrMeow str )
+        "\\b[A-Z0-9_]+\\b" "MEOW" REG_ALL regsub  ( str arrMeow str' )
+        "\\b[A-Z0-9_][A-Za-z0-9_]*[a-z][A-Za-z0-9_]*\\b" "Meow" REG_ALL regsub  ( str arrMeow str' )
+        "\\b[a-z_][A-Za-z0-9_]*\\b" "meow" REG_ALL regsub  ( str arrMeow str' )
+        me @ "%D meows, \"%s\"" fmtstring  ( str arrMeow str" )
+        1 array_make swap array_notify  ( str )
+    else pop then  ( str )
+
+
+    var msg
+
+    dup ",," instr  ( str boolCommas )
+    me @ prop_split getpropstr .no? not  ( str boolCommas boolSplitOK )
+    and if  ( str )
+        ",," split  ( str- -str )
+
+        ( User-supplied verb? )
+        dup ",," instr if
+            ",," split  ( str- strVerb -str )
+            swap dup if  ( str- -str strVerb )
+                strip  ( str- -str strVerb )
+                dup me @ name instr over tolower "%n" instr or if  ( str- -str strVerb )
+                    "%n" "%N" subst me @ name "%n" subst  ( str- -str strVerb )
+                else
+                    me @ swap "%s %D," fmtstring  ( str- -str -str- )
+                then  ( str- -str -str- )
+                dup "*[-!.,:;]" smatch not if "," strcat then  ( str- -str -str- )
+                dup verb ! overb !  ( str- -str )
+            else pop then  ( str- -str )
+        then  ( str- -str )
+
+        2 array_make  ( arrMsg )
+        1
+    else 0 then splitsay ! msg !
+
+
+    verb @ string? not if
+        overb rtn-getThirdVerb
+        verb overb rtn-getFirstVerb
+    then
+    lquo rquo rtn-getQuotes  ( str )
+
+
+    ( Say. )
+    msg @ string? if
+        rquo @ msg @ lquo @  ( strRquo strMsg strLquo )
+        "%s %s%s%s"  ( strRquo strMsg strLquo strFormat )
+
+        4 dupn
+        verb  @ swap fmtstring .tell  ( strRquo strMsg strLquo strFormat )
+        overb @ swap fmtstring  ( strOsay )
+    else
+        rquo @ msg @ array_vals pop  ( strRquo strMsg strMsg2 )
+        swap dup "*[-!.,:;]" smatch not if "," strcat then swap  ( strRquo strMsg strMsg2 )
+        ( Only handle strMsg if there's no strMsg2. )
+        dup if  ( strRquo strMsg strMsg2 )
+            swap  ( strRquo strMsg2 strMsg )
+            lquo @ swap rquo @ swap lquo @  ( strRquo strMsg2 strLquo strRquo strMsg' strLquo )
+            "%s%s%s %s %s%s%s"  ( strRquo strMsg2 strLquo strRquo strMsg' strLquo strFormat )
+
+            7
+        else  ( strRquo strMsg strMsg2 )
+            pop lquo @  ( strRquo strMsg' strLquo )
+            "%s%s%s %s"  ( strRquo strMsg' strLquo strFormat )
+
+            verb @ ",$" "." 0 regsub verb !
+            overb @ ",$" "." 0 regsub overb !
+
+            4
+        then  ( ... strRquo strMsg strLquo strFormat intDepth )
+
+        dupn
+        verb  @ -5 rotate fmtstring .tell  ( ... strRquo strMsg strLquo strFormat )
+        overb @ -5 rotate fmtstring  ( strOsay )
+    then  ( strOsay )
+
+
+    ( Is there color to avoid? )
+    dup "\[[" instr if
+        who @ prop_color "{n*|0}" array_filter_prop  ( strOsay arrGreyed )
+        dup if  ( strOsay arrGreyed )
+            over ansi_strip 1 array_make  ( strOsay arrGreyed arrMsg )
+            over array_notify  ( strOsay arrGreyed )
+
+            exclude @ array_union exclude !  ( strOsay )
+        else pop then  ( strOsay )
+    then  ( strOsay )
+
+    loc @  ( strOsay db )
+    exclude @ array_vals  ( strOsay db dbExcludeN..dbExclude1 intN )
+    me @ swap ++  ( strOsay db dbGreyedN..dbGreyed1' intN' )
+    dup 3 + rotate  ( db dbGreyedN..dbGreyed1 intN strOsay )
+    notify_exclude  (  )
+;
+
+: do-help pop pop .showhelp ;
+: do-ignore pop str_program cmd-ignore-add ;
+: do-unignore pop str_program cmd-ignore-del ;
+
+: do-third  ( strY strZ -- )
+    pop pop  (  )
+    me @ prop_third "yes" setprop
+    me @ "You will see your own says in the third person (\"%D says\")." fmtstring .tellgood
+;
+: do-unthird  ( strY strZ -- )
+    pop pop  (  )
+    me @ prop_third remove_prop
+    "You will see your own says in the second person (\"You say\")." .tellgood
+;
+
+: do-grey  ( strY strZ -- )
+    pop pop  (  )
+    me @ prop_color "no" setprop
+    me @ "You will not see color in any says. Note you will see color in your own says." fmtstring .tellgood
+;
+: do-ungrey  ( strY strZ -- )
+    pop pop  (  )
+    me @ prop_color remove_prop
+    "You will see color in says." .tellgood
+;
+
+: do-meow  ( strY strZ -- )
+    pop  ( strY )
+    dup if
+        .noisy_pmatch dup ok? not if pop exit then  ( db )
+        me @ prop_meow 3 pick reflist_find if  ( db )
+            "%D is already in your #meow list." fmtstring .tellbad exit  (  )
+        then  ( db )
+        me @ prop_meow 3 pick reflist_add  ( db )
+        "%D added." fmtstring .tellgood
+    else
+        me @ prop_meow array_get_reflist  ( arr )
+        "" swap foreach swap pop "%D %s" fmtstring repeat
+        "Your meowlist: " swap strcat .tellgood
+    then
+;
+: do-unmeow  ( strY strZ -- )
+    pop  ( strY )
+    .noisy_pmatch dup ok? not if pop exit then  ( db )
+    me @ prop_meow 3 pick reflist_find not if  ( db )
+        "%D is not in your #meow list." fmtstring .tellbad exit  (  )
+    then  ( db )
+    me @ prop_meow 3 pick reflist_del  ( db )
+    "%D removed." fmtstring .tellgood
+;
+
+$define dict_commands {
+    "help"    'do-help
+    "ignore"  'do-ignore
+    "!ignore" 'do-unignore
+    "meow"    'do-meow
+    "!meow"   'do-unmeow
+    "third"   'do-third
+    "!third"  'do-unthird
+    "grey"    'do-grey
+    "gray"    'do-grey
+    "!grey"   'do-ungrey
+    "!gray"   'do-ungrey
+}dict $enddef
+
+: main  ( str -- )
+    dup STRparse  ( str strX strY strZ )
+    3 pick string? if 3 pick "#" stringpfx if  ( str strX strY strZ )
+        pop pop pop  ( str )
+        "#" split strcat  ( str' )
+        do-say exit  (  )
+    then then
+    3 pick int? if pop pop pop do-say exit then
+    4 rotate pop  ( strX strY strZ )
+
+    rot dict_commands over array_getitem  ( strY strZ strX ? )
+    dup address? if  ( strY strZ strX adr )
+        swap pop  ( strY strZ adr )
+        execute  (  )
+    else pop  ( strY strZ strX )
+        "I don't recognize the command '#%s'. Try 'say #help' for help, or using '##' to say something starting with '#'." fmtstring .tellbad  ( strY strZ )
+        pop pop  (  )
+    then  (  )
+;
+.
+c
+q
+
+lsedit #257=_help
+.del 1 $
+say <message>
+."<message>
+say #[!]ignore <names>
+say #[!]third
+say #[!]grey
+say #[!]meow <names>
+
+Speaks <message> to the room. Use #ignore <name> to not see <name>'s says, poses, and spoofs; use #meow <name> to see <name>'s says with all the words replaced with "meow." Use #third to see your own says in the third person (that is, "Puck says" instead of the normal "You say"). Use #grey to turn off color in others' says and poses.
+
+Say supports a "split" say if you put two consecutive commas in your message. For example, if CobaltBlue typed '"Hello,,how are you?' everyone would see '"Hello," says CobaltBlue, "how are you?"' You can also specify an "ad-hoc" verb by putting a message with your name or '%N' between pairs of commas: '"Hello,,%N welcomes Weiran,,how are you?' would display '"Hello," CobaltBlue welcomes Weiran, "how are you?"'
+.format 10=78
+.format 8=78
+.end

samples/Makefile/filenames/Makefile.boot

@@ -0,0 +1,159 @@
+# $NetBSD$
+
+S=	${.CURDIR}/../../../../..
+
+NOMAN=
+PROG?= boot
+NEWVERSWHAT?= "BIOS Boot"
+VERSIONFILE?= ${.CURDIR}/../version
+
+AFLAGS.biosboot.S= ${${ACTIVE_CC} == "clang":?-no-integrated-as:}
+
+SOURCES?= biosboot.S boot2.c conf.c devopen.c exec.c
+SRCS= ${SOURCES}
+.if !make(depend)
+SRCS+= vers.c
+.endif
+
+PIE_CFLAGS=
+PIE_AFLAGS=
+PIE_LDFLAGS=
+
+.include <bsd.own.mk>
+
+STRIPFLAG=	# nothing
+
+LIBCRT0=	# nothing
+LIBCRTI=	# nothing
+LIBCRTBEGIN=	# nothing
+LIBCRTEND=	# nothing
+LIBC=		# nothing
+
+BINDIR=/usr/mdec
+BINMODE=444
+
+.PATH:	${.CURDIR}/.. ${.CURDIR}/../../lib
+
+LDFLAGS+= -nostdlib -Wl,-N -Wl,-e,boot_start
+CPPFLAGS+= -I ${.CURDIR}/..  -I ${.CURDIR}/../../lib -I ${S}/lib/libsa
+CPPFLAGS+= -I ${.OBJDIR}
+# Make sure we override any optimization options specified by the user
+COPTS=  -Os
+
+.if ${MACHINE_ARCH} == "x86_64"
+LDFLAGS+=  -Wl,-m,elf_i386
+AFLAGS+=   -m32
+CPUFLAGS=  -m32
+LIBKERN_ARCH=i386
+KERNMISCMAKEFLAGS="LIBKERN_ARCH=i386"
+.else
+CPUFLAGS=  -march=i386 -mtune=i386
+.endif
+
+CFLAGS+=   -mno-sse -mno-sse2 -mno-sse3
+
+COPTS+=    -ffreestanding
+CFLAGS+= -Wall -Wmissing-prototypes -Wstrict-prototypes
+CPPFLAGS+= -nostdinc -D_STANDALONE
+CPPFLAGS+= -I$S
+
+CPPFLAGS+= -DSUPPORT_PS2
+CPPFLAGS+= -DDIRECT_SERIAL
+CPPFLAGS+= -DSUPPORT_SERIAL=boot_params.bp_consdev
+
+CPPFLAGS+= -DCONSPEED=boot_params.bp_conspeed
+CPPFLAGS+= -DCONSADDR=boot_params.bp_consaddr
+CPPFLAGS+= -DCONSOLE_KEYMAP=boot_params.bp_keymap
+
+CPPFLAGS+= -DSUPPORT_CD9660
+CPPFLAGS+= -DSUPPORT_USTARFS
+CPPFLAGS+= -DSUPPORT_DOSFS
+CPPFLAGS+= -DSUPPORT_EXT2FS
+#CPPFLAGS+= -DSUPPORT_MINIXFS3
+CPPFLAGS+= -DPASS_BIOSGEOM
+CPPFLAGS+= -DPASS_MEMMAP
+#CPPFLAGS+= -DBOOTPASSWD
+CPPFLAGS+= -DEPIA_HACK
+#CPPFLAGS+= -DDEBUG_MEMSIZE
+#CPPFLAGS+= -DBOOT_MSG_COM0
+CPPFLAGS+= -DLIBSA_ENABLE_LS_OP
+
+# The biosboot code is linked to 'virtual' address of zero and is
+# loaded at physical address 0x10000.
+# XXX The heap values should be determined from _end.
+SAMISCCPPFLAGS+= -DHEAP_START=0x40000 -DHEAP_LIMIT=0x70000
+SAMISCCPPFLAGS+= -DLIBSA_PRINTF_LONGLONG_SUPPORT
+SAMISCMAKEFLAGS+= SA_USE_CREAD=yes	# Read compressed kernels
+SAMISCMAKEFLAGS+= SA_INCLUDE_NET=no	# Netboot via TFTP, NFS
+
+CPPFLAGS+=	-Wno-pointer-sign
+
+# CPPFLAGS+= -DBOOTXX_RAID1_SUPPORT
+
+I386_STAND_DIR?= $S/arch/i386/stand
+
+### find out what to use for libi386
+I386DIR= ${I386_STAND_DIR}/lib
+.include "${I386DIR}/Makefile.inc"
+LIBI386= ${I386LIB}
+
+### find out what to use for libsa
+SA_AS= library
+SAMISCMAKEFLAGS+="SA_USE_LOADFILE=yes"
+SAMISCMAKEFLAGS+="SA_ENABLE_LS_OP=yes"
+.include "${S}/lib/libsa/Makefile.inc"
+LIBSA= ${SALIB}
+
+### find out what to use for libkern
+KERN_AS= library
+.include "${S}/lib/libkern/Makefile.inc"
+LIBKERN= ${KERNLIB}
+
+### find out what to use for libz
+Z_AS= library
+.include "${S}/lib/libz/Makefile.inc"
+LIBZ= ${ZLIB}
+
+LDSCRIPT ?= $S/arch/i386/conf/stand.ldscript
+
+cleandir distclean: .WAIT cleanlibdir
+
+cleanlibdir:
+	-rm -rf lib
+
+LIBLIST= ${LIBI386} ${LIBSA} ${LIBZ} ${LIBKERN} ${LIBI386} ${LIBSA}
+# LIBLIST= ${LIBSA} ${LIBKERN} ${LIBI386} ${LIBSA} ${LIBZ} ${LIBKERN}
+
+CLEANFILES+= ${PROG}.tmp ${PROG}.map ${PROG}.sym vers.c
+
+vers.c: ${VERSIONFILE} ${SOURCES} ${LIBLIST} ${.CURDIR}/../Makefile.boot
+	${HOST_SH} ${S}/conf/newvers_stand.sh ${VERSIONFILE} x86 ${NEWVERSWHAT}
+
+# Anything that calls 'real_to_prot' must have a %pc < 0x10000.
+# We link the program, find the callers (all in libi386), then
+# explicitly pull in the required objects before any other library code.
+${PROG}: ${OBJS} ${LIBLIST} ${.CURDIR}/../Makefile.boot
+	${_MKTARGET_LINK}
+	bb="$$( ${CC} -o ${PROG}.sym ${LDFLAGS} -Wl,-Ttext,0 -Wl,-cref \
+	    ${OBJS} ${LIBLIST} | ( \
+		while read symbol file; do \
+			[ -z "$$file" ] && continue; \
+			[ "$$symbol" = real_to_prot ] && break; \
+		done; \
+		while \
+			oifs="$$IFS"; \
+			IFS='()'; \
+			set -- $$file; \
+			IFS="$$oifs"; \
+			[ -n "$$2" ] && echo "${I386DST}/$$2"; \
+			read file rest && [ -z "$$rest" ]; \
+		do :; \
+		done; \
+	) )"; \
+	${CC} -o ${PROG}.sym ${LDFLAGS} -Wl,-Ttext,0 -T ${LDSCRIPT} \
+		-Wl,-Map,${PROG}.map -Wl,-cref ${OBJS} $$bb ${LIBLIST}
+	${OBJCOPY} -O binary ${PROG}.sym ${PROG}
+
+.include <bsd.prog.mk>
+KLINK_MACHINE=	i386
+.include <bsd.klinks.mk>

samples/Makefile/foo.o.d

@@ -0,0 +1,5 @@
+bar/foo.o: \
+ bar/foo.c \
+ bar/baz.h
+
+bar/baz.h:

samples/Mathematica/Predicates.wl

@@ -0,0 +1,150 @@
+(* ::Package:: *)
+
+BeginPackage["Predicates`"];
+
+
+(* ::Title:: *)
+(*Predicates*)
+
+
+(* ::Section::Closed:: *)
+(*Fuzzy Logic*)
+
+
+(* ::Subsection:: *)
+(*Documentation*)
+
+
+PossiblyTrueQ::usage="Returns True if the argument is not definitely False.";
+PossiblyFalseQ::usage="Returns True if the argument is not definitely True.";
+PossiblyNonzeroQ::usage="Returns True if and only if its argument is not definitely zero.";
+
+
+(* ::Subsection:: *)
+(*Implimentation*)
+
+
+Begin["`Private`"];
+
+
+PossiblyTrueQ[expr_]:=\[Not]TrueQ[\[Not]expr]
+
+
+PossiblyFalseQ[expr_]:=\[Not]TrueQ[expr]
+
+
+End[];
+
+
+(* ::Section::Closed:: *)
+(*Numbers and Lists*)
+
+
+(* ::Subsection:: *)
+(*Documentation*)
+
+
+AnyQ::usage="Given a predicate and a list, retuns True if and only if that predicate is True for at least one element of the list.";
+AnyElementQ::usage="Returns True if cond matches any element of L.";
+AllQ::usage="Given a predicate and a list, retuns True if and only if that predicate is True for all elements of the list.";
+AllElementQ::usage="Returns True if cond matches any element of L.";
+
+
+AnyNonzeroQ::usage="Returns True if L is a list such that at least one element is definitely not zero.";
+AnyPossiblyNonzeroQ::usage="Returns True if expr is a list such that at least one element is not definitely zero.";
+
+
+RealQ::usage="Returns True if and only if the argument is a real number";
+PositiveQ::usage="Returns True if and only if the argument is a positive real number";
+NonnegativeQ::usage="Returns True if and only if the argument is a non-negative real number";
+PositiveIntegerQ::usage="Returns True if and only if the argument is a positive integer";
+NonnegativeIntegerQ::usage="Returns True if and only if the argument is a non-negative integer";
+
+
+IntegerListQ::usage="Returns True if and only if the input is a list of integers.";
+PositiveIntegerListQ::usage="Returns True if and only if the input is a list of positive integers.";
+NonnegativeIntegerListQ::usage="Returns True if and only if the input is a list of non-negative integers.";
+IntegerOrListQ::usage="Returns True if and only if the input is a list of integers or an integer.";
+PositiveIntegerOrListQ::usage="Returns True if and only if the input is a list of positive integers or a positive integer.";
+NonnegativeIntegerOrListQ::usage="Returns True if and only if the input is a list of positive integers or a positive integer.";
+
+
+SymbolQ::usage="Returns True if argument is an unassigned symbol.";
+SymbolOrNumberQ::usage="Returns True if argument is a number of has head 'Symbol'";
+
+
+(* ::Subsection:: *)
+(*Implimentation*)
+
+
+Begin["`Private`"];
+
+
+AnyQ[cond_, L_] := Fold[Or, False, cond /@ L]
+
+
+AnyElementQ[cond_,L_]:=AnyQ[cond,Flatten[L]]
+
+
+AllQ[cond_, L_] := Fold[And, True, cond /@ L]
+
+
+AllElementQ[cond_, L_] := Fold[And, True, cond /@ L]
+
+
+AnyNonzeroQ[L_]:=AnyElementQ[#!=0&,L]
+
+
+PossiblyNonzeroQ[expr_]:=PossiblyTrueQ[expr!=0]
+
+
+AnyPossiblyNonzeroQ[expr_]:=AnyElementQ[PossiblyNonzeroQ,expr]
+
+
+RealQ[n_]:=TrueQ[Im[n]==0];
+
+
+PositiveQ[n_]:=Positive[n];
+
+
+PositiveIntegerQ[n_]:=PositiveQ[n]\[And]IntegerQ[n];
+
+
+NonnegativeQ[n_]:=TrueQ[RealQ[n]&&n>=0];
+
+
+NonnegativeIntegerQ[n_]:=NonnegativeQ[n]\[And]IntegerQ[n];
+
+
+IntegerListQ[input_]:=ListQ[input]&&Not[MemberQ[IntegerQ/@input,False]];
+
+
+IntegerOrListQ[input_]:=IntegerListQ[input]||IntegerQ[input];
+
+
+PositiveIntegerListQ[input_]:=IntegerListQ[input]&&Not[MemberQ[Positive[input],False]];
+
+
+PositiveIntegerOrListQ[input_]:=PositiveIntegerListQ[input]||PositiveIntegerQ[input];
+
+
+NonnegativeIntegerListQ[input_]:=IntegerListQ[input]&&Not[MemberQ[NonnegativeIntegerQ[input],False]];
+
+
+NonnegativeIntegerOrListQ[input_]:=NonnegativeIntegerListQ[input]||NonnegativeIntegerQ[input];
+
+
+SymbolQ[a_]:=Head[a]===Symbol;
+
+
+SymbolOrNumberQ[a_]:=NumericQ[a]||Head[a]===Symbol;
+
+
+End[];
+
+
+(* ::Section:: *)
+(*Epilogue*)
+
+
+EndPackage[];

samples/Mathematica/UnitTest.wlt

@@ -0,0 +1,17 @@
+BeginTestSection["Untitled-5"]
+
+VerificationTest[(* 1 *)
+	RotationMatrix[phi]
+	,
+	List[List[Cos[phi], Times[-1, Sin[phi]]], List[Sin[phi], Cos[phi]]]	
+]
+
+VerificationTest[(* 2 *)
+	Times[1, Power[Plus[a, Times[-1, a]], -1]]
+	,
+	ComplexInfinity
+	,
+	{Power::infy}
+]
+
+EndTestSection[]