Compare commits

...

923 Commits

Author SHA1 Message Date
Arfon Smith
21d7f99a4e Cut release v4.8.2
* Updating grammars
* Bumping to v4.8.2
2016-03-29 17:02:30 -06:00
John Gardner
24b368a30c Add ".es" to recognised ECMAScript extensions
* Add ".es" to recognised JavaScript extensions
* Add heuristic to differentiate Erlang from ECMAScript
* Add test-case for .es heuristic
2016-03-29 13:36:13 -06:00
Arfon Smith
7c8bc8561d Merge pull request #2921 from Alhadis/protocol-fix
Fix protocol of Nix submodule's URL
2016-03-29 07:58:38 -06:00
Alhadis
ce37cd665d Fix protocol of Nix submodule's URL
This stops tests failing when running "bundle exec rake test".
2016-03-30 00:24:50 +11:00
Arfon Smith
bd0f4f6f78 Merge pull request #2914 from github/adding-back-nix
Adding back nix grammar
2016-03-27 20:35:30 -06:00
Arfon Smith
4867db8831 Adding back nix grammar 2016-03-27 20:31:02 -06:00
Arfon Smith
e6ab516fb7 Merge pull request #2911 from github/cut-release-v4.8.1
Cut release v4.8.1
2016-03-25 11:56:13 -06:00
Arfon Smith
7501b82df1 Updating licenses 2016-03-25 11:21:36 -06:00
Arfon Smith
aa6b881971 Bumping to v4.8.1 2016-03-25 11:20:24 -06:00
Arfon Smith
3928734d0f Updating grammars 2016-03-25 11:19:00 -06:00
James Ko
c7868a95bc Merge pull request #2902 from jamesqo/patch-2
Add App.config + NuGet.config to the XML file list
2016-03-23 20:11:36 -06:00
Kepler Sticka-Jones
2012647f78 Merge pull request #2907 from keplersj/clang-format
Add .clang-format as a YAML file
2016-03-23 20:09:34 -06:00
Arfon Smith
84471a5463 Merge pull request #2908 from github/grace
Adding grace grammar back in.
2016-03-23 15:00:46 -06:00
James Ko
57a3c14f2b Merge pull request #2906 from jamesqo/patch-3
Add .vssettings to the list of XML files
2016-03-22 11:57:48 -06:00
Arfon Smith
d9914307eb Merge pull request #2905 from github/ats
Adding ATS grammar
2016-03-21 13:13:52 -06:00
Arfon Smith
71cdf46197 Merge pull request #2903 from github/nesC
Adding nest grammar back
2016-03-21 09:25:02 -06:00
James Ko
8a27884c70 Merge pull request #2899 from jamesqo/patch-1
Add ReSharper's .dotsettings to the list of XML files
2016-03-20 20:16:39 -06:00
Arfon Smith
b881e3e6cb Merge pull request #2900 from github/gdscript
Adding back GDScript grammar
2016-03-20 20:16:01 -06:00
Arfon Smith
ca718d8f2a Fixing up script/licensed verify 2016-03-20 08:47:08 -06:00
Arfon Smith
c6625b1b8a Merge pull request #2898 from github/sourcepawn
Adding back sourcepawn
2016-03-20 08:34:05 -06:00
Arfon Smith
16a6d680c4 Adding Rubygems licenses. 2016-03-19 20:49:41 -06:00
Paul Chaignon
270fa8f5d3 Merge pull request #2894 from pchaigno/fix-warnings
Fix warnings
2016-03-19 20:42:32 -06:00
Arfon Smith
b1f5e93b4a Merge pull request #2897 from github/pig-latin
Adding back Pig Latin grammar
2016-03-19 20:41:13 -06:00
Arfon Smith
79a61c72e1 Restoring curated grammars 2016-03-19 20:33:55 -06:00
Arfon Smith
3f04c11537 Merge pull request #2895 from github/bring-back-boo
Adding back boo
2016-03-19 20:29:11 -06:00
Arfon Smith
b2270613d7 Merge pull request #2896 from github/bring-back-logos
Adding Logos grammar.
2016-03-19 20:26:36 -06:00
Arfon Smith
0fe854421b Merge pull request #2893 from github/extra-assembly
Adding back assembly grammar for object dumps
2016-03-19 08:00:53 -06:00
Arfon Smith
de074f421e Merge pull request #2891 from pchaigno/package-license
MIT license in package.json
2016-03-19 07:47:18 -06:00
Arfon Smith
27590c39bd Merge pull request #2892 from github/bringing-monkey-back
Bringing Monkey grammar back under MIT license
2016-03-19 07:45:05 -06:00
Arfon Smith
67191d4d5e Bringing Monkey grammar back under MIT license 2016-03-19 07:38:59 -06:00
Paul Chaignon
00764f3d59 MIT license in package.json 2016-03-19 13:16:32 +01:00
Arfon Smith
4a2cb32149 Merge pull request #2887 from github/assembly-highlight
Bringing back Assembly highlighting
2016-03-18 20:28:59 -06:00
Arfon Smith
1a11664239 Adding sublimeassembly to license whitelist. 2016-03-18 20:24:06 -06:00
Arfon Smith
9520cbb44c Bringing back Assembly highlighting 2016-03-18 20:15:38 -06:00
Arfon Smith
1aea6b2cdb Merge pull request #2886 from github/puppet-highlight
Adding replacement grammar for Puppet
2016-03-18 17:52:07 -06:00
Arfon Smith
6ff950341a Adding replacement grammar for Puppet 2016-03-18 17:44:05 -06:00
Arfon Smith
b9501e42b2 Merge pull request #2884 from github/licensor-mk2
[WIP] extracting license information
2016-03-18 17:29:05 -06:00
Arfon Smith
065c809dd5 Updating grammars based on script/licensed 2016-03-18 16:52:49 -06:00
Arfon Smith
5b9ea4a78f Updating grammar checks to ensure license compliance 2016-03-18 16:47:34 -06:00
Arfon Smith
b72c4d4400 Fix Ruby deprecation warning 2016-03-18 16:47:09 -06:00
Arfon Smith
d46e214985 Removing InnoSetup grammar 2016-03-18 16:45:56 -06:00
Arfon Smith
799c47ce7a Grammar update 2016-03-18 16:38:21 -06:00
Arfon Smith
b5121e59dd Updating papyrus scopes 2016-03-18 16:38:12 -06:00
Arfon Smith
f6a7b4929f Updating Papyrus grammar 2016-03-18 16:27:56 -06:00
Arfon Smith
162b77ab5a Removing unused grammar 2016-03-18 16:19:44 -06:00
Arfon Smith
92904efd45 Fixing Ruby warning 2016-03-18 16:19:35 -06:00
Arfon Smith
93fabe487f Removing openscad grammar 2016-03-18 16:14:54 -06:00
Arfon Smith
74d704bea2 Removing pig latin grammar 2016-03-18 16:13:46 -06:00
Arfon Smith
ee1bd50dd1 Removing oracle grammar 2016-03-18 16:12:17 -06:00
Arfon Smith
07096f84f5 Removing nix grammar 2016-03-18 16:10:33 -06:00
Arfon Smith
a9b3bd632b Removing puppet grammar 2016-03-18 16:08:55 -06:00
Arfon Smith
eec324890e Removing Idris grammar 2016-03-18 16:05:23 -06:00
Arfon Smith
ca6ac8f0db Removing nesC grammar 2016-03-18 16:03:54 -06:00
Arfon Smith
60ab4a5fe7 Removing SourcePawn grammar 2016-03-18 15:57:00 -06:00
Arfon Smith
10eb5830f0 Removing Monkey grammar 2016-03-18 15:19:32 -06:00
Arfon Smith
835ceae6f6 Removing x86 grammar 2016-03-18 15:18:17 -06:00
Arfon Smith
abe3aa47f6 Removing GDScript grammar 2016-03-18 15:16:18 -06:00
Arfon Smith
53e34072ed Removing Grace grammar 2016-03-18 15:15:08 -06:00
Arfon Smith
f83f761d0a Removing Boo grammar 2016-03-18 15:13:53 -06:00
Arfon Smith
9c18bf3a89 Removing AutoIt grammar 2016-03-18 15:11:03 -06:00
Arfon Smith
f6e1ab444e Removing ATS grammar 2016-03-18 14:55:11 -06:00
Arfon Smith
0ae8b2959d Removing Logos grammar 2016-03-18 14:51:22 -06:00
Arfon Smith
46b0b1e5e2 Removing Creole grammar 2016-03-18 14:48:31 -06:00
Arfon Smith
b44dfb4ab8 Removing Clips grammar 2016-03-18 14:43:18 -06:00
Arfon Smith
868e528810 Downcase 2016-03-18 14:30:07 -06:00
Arfon Smith
0a4c850ef1 Merge branch 'licensor-mk2' of github.com:github/linguist into licensor-mk2 2016-03-18 14:27:19 -06:00
Arfon Smith
b3c4232251 Removing old license 2016-03-18 14:27:06 -06:00
Brandon Keepers
0c38df47b9 Save config 2016-03-18 16:09:54 -04:00
Brandon Keepers
bfd4005760 Disable license caching for rubygems and npm 2016-03-18 16:06:02 -04:00
Arfon Smith
fc9fad15a3 Updating license information for dependencies 2016-03-18 14:02:18 -06:00
Arfon Smith
b5091e88ad Updating licensor -> licensed 2016-03-18 12:32:52 -06:00
Arfon Smith
2610808b6d Updating licenses 2016-03-17 20:30:44 -06:00
Arfon Smith
3cfee4f214 Bumping to licensee v6.0.0 2016-03-17 20:30:22 -06:00
Arfon Smith
70fd116eaf Merge branch 'master' into licensor-mk2 2016-03-17 20:24:23 -06:00
Arfon Smith
62aac9c2f7 Merge branch 'licensor' of github.com:github/linguist into licensor 2016-03-17 20:00:52 -06:00
Arfon Smith
afcf1c6c22 Merge branch 'master' into licensor 2016-03-17 19:57:29 -06:00
Arfon Smith
f3f0365b13 Merge pull request #2883 from williamd1k0/master
Fix regex in .rpy disambiguate
2016-03-17 17:32:32 -06:00
William Tumeo
9bc12843fe Fix regex in .rpy disambiguate 2016-03-17 18:01:32 -03:00
Arfon Smith
5e3ceddf69 Merge pull request #2882 from github/2512-local
Pawn TextMate-compatible grammar (take 2)
2016-03-17 14:05:24 -06:00
Arfon Smith
d377e23193 Merge branch 'master' into 2512-local 2016-03-17 14:00:34 -06:00
Arfon Smith
e6dabd59ad Merge pull request #2875 from github/2821-slim
Add Terra support
2016-03-17 10:40:19 -06:00
Arfon Smith
f0c7380132 Updating sublime-terra grammar 2016-03-17 10:27:39 -06:00
Arfon Smith
697ad4c568 Merge branch 'master' into 2821-slim 2016-03-17 10:23:59 -06:00
Arfon Smith
1efd9b384d Merge pull request #2880 from github/cut-release-v4.8.0
v4.8.0 release
2016-03-16 22:46:29 -06:00
Arfon Smith
c1e71dc215 Bumping to v4.8.0 2016-03-16 21:44:20 -06:00
Arfon Smith
d2c7d27d13 Grammar update 2016-03-16 21:30:18 -06:00
Arfon Smith
1efd4c83f9 Merge pull request #2341 from github/api-changes
Move Linguist::Language.detect to Linguist.detect
2016-03-16 21:15:50 -06:00
Arfon Smith
0f7677423f Merge pull request #2877 from pchaigno/fix-plpgsql-heuristic
Fix PLpgSQL heuristic rule
2016-03-12 06:01:59 -07:00
Paul Chaignon
2a0b0e9f93 Fix heuristic rule for PLpgSQL 2016-03-12 11:17:29 +01:00
Paul Chaignon
faec60188f Tests for .sql heuristic rules 2016-03-12 11:04:53 +01:00
Vicent Marti
709a688858 Merge pull request #2876 from github/vmg/git-debug
git-linguist: Print PWD
2016-03-11 10:33:09 +01:00
Vicent Marti
2448ff8314 git-linguist: Print PWD 2016-03-11 10:27:10 +01:00
Arfon Smith
311202102d Merge branch 'master' into 2821-slim 2016-03-10 06:51:35 -06:00
Arfon Smith
6812a22706 Slimming down Terra samples 2016-03-10 06:50:48 -06:00
Arfon Smith
fb727ce731 Merge pull request #2866 from jasonwilliams200OK/master
Classification of props file
2016-03-09 20:53:07 -06:00
Peter Jas
6af499e352 Classification of props file
* Initially treat as XML
* Disambiguate from ini (key-value pair style with `=`)
* If the file is neither XML-style nor INI, classify as SQL
2016-03-10 02:46:57 +00:00
Arfon Smith
66ec33cf8e Merge pull request #2873 from github/2427-local
2427 local
2016-03-09 19:55:29 -06:00
Arfon Smith
f2694f3a74 Merge branch 'master' into 2427-local 2016-03-09 19:49:32 -06:00
Arfon Smith
d069d0e444 Merge pull request #2870 from kusma/hlsl
make .hlsl the primary extension for HLSL
2016-03-09 07:02:11 -06:00
Erik Faye-Lund
56ee61b17c make .hlsl the primary extension for HLSL
When I submitted the HLSL-language, I accidentally missed that the
first extension was the primary one (as is documented in the source
code, which I unfortunately missed), and instead alphabetized the
whole list.

The primary extension should be .hlsl, so let's remedy this.
2016-03-09 12:49:29 +00:00
Arfon Smith
b945726017 Merge pull request #1965 from github/combine-gems
Merge github-linguist-grammars into github-linguist
2016-03-09 06:35:31 -06:00
Lars Brinkhoff
6f8a7d1070 Exclude 'filenames' from all_fixtures. 2016-03-09 13:28:00 +01:00
Lars Brinkhoff
b032886c21 Add .me and other text filenames.
click.me by Bram Moolenaar; VIM license.
2016-03-09 13:27:59 +01:00
Arfon Smith
988739d566 Merge branch 'master' into combine-gems 2016-03-09 06:25:35 -06:00
Arfon Smith
8cd80801e8 Fixing indentation 2016-03-09 06:15:41 -06:00
Arfon Smith
c3b7a1a6fb Merge pull request #2146 from pchaigno/norwegian
Support for two Norwegian text extensions
2016-03-09 06:02:58 -06:00
Arfon Smith
9d0eff75ad Merge pull request #2869 from pchaigno/sublime-syntax
Support for YAML .sublime-syntax extension
2016-03-09 06:02:00 -06:00
Paul Chaignon
3ccb548b6d Support for YAML .sublime-syntax extension 2016-03-09 11:29:25 +01:00
Paul Chaignon
eeedd53f32 Support for Text extension .no (Norwegian text) 2016-03-09 10:38:47 +01:00
Paul Chaignon
11a3b5b73c Support for Text extension .nb (Norwegian text) 2016-03-09 10:37:41 +01:00
Lars Brinkhoff
eacc48e8c7 Add .me to Groff file extensions. 2016-03-09 07:52:29 +01:00
Mike Linksvayer
5b72b4d353 move note about grammar repos from LICENSE to README.md 2016-03-08 21:05:55 -08:00
Arfon Smith
3f940ce8b8 Merge pull request #2868 from github/2603-local
2603 local
2016-03-08 22:03:30 -06:00
Arfon Smith
b2e3ea2334 Adding ace_mode back for M4Sugar 2016-03-08 21:56:01 -06:00
Arfon Smith
4637da8c32 Merge branch 'master' into 2603-local 2016-03-08 21:53:23 -06:00
Arfon Smith
6b88c5ba86 Merge pull request #2842 from kusma/hlsl
Add support for HLSL
2016-03-07 20:36:25 -06:00
Arfon Smith
5fdb596214 Merge pull request #2858 from williamd1k0/master
Fix "Ren'Py being detected as Python" #2849
2016-03-07 20:34:44 -06:00
Arfon Smith
c989b02285 Merge pull request #2857 from Dominator008/buck
Add BUCK filename to Python in languages.yml
2016-03-04 12:46:00 -06:00
Arfon Smith
c8301dc20b Merge pull request #2861 from jglick/Jenkinsfile
Recognizing Jenkinsfile as Groovy source
2016-03-04 11:12:00 -06:00
Jesse Glick
ca4ea03828 Recognizing Jenkinsfile as Groovy source. 2016-03-03 19:15:09 -05:00
Michael Zhou
ae27c71d5a Add BUCK filename to Python in languages.yml
BUCK is the filename for the build files of the Facebook Buck build
system. BUCK files are valid Python files.

Eg.:
  https://github.com/GerritCodeReview/gerrit/blob/master/BUCK

Also add a missing sample for Pants / Bazel BUILD files. They are also
valid Python files.
2016-02-29 20:43:55 -05:00
Arfon Smith
3d1555e278 Merge pull request #2856 from github/cut-release-v4.7.6
Cut release v4.7.6
2016-02-29 08:24:58 -07:00
Arfon Smith
54fab9eb4e Bumping to v4.7.6 2016-02-29 07:55:43 -07:00
Arfon Smith
8fea8a0b47 Grammar update 2016-02-29 07:54:29 -07:00
Arfon Smith
f14ae8e51b Merge pull request #2803 from c-lipka/master
Added support for the POV-Ray Scene Description Language.
2016-02-28 07:33:05 -07:00
William Tumeo
6b60e5e786 Remove wrong line in the sample 2016-02-27 23:57:46 -03:00
William Tumeo
40413dfcc7 Add class and def to regex 2016-02-27 23:55:53 -03:00
William Tumeo
07f5ad1daa Merge remote-tracking branch 'upstream/master'
Update fork 3
2016-02-27 23:22:04 -03:00
Arfon Smith
57f5a3e780 Merge pull request #2831 from FarbodSalamat-Zadeh/patch-1
Add CSV as data type to languages.yml
2016-02-27 15:54:44 -07:00
Farbod Salamat-Zadeh
3be007526c Fix fixture_blob("Data/cars.csv")
Changes `fixture_blob("Data/cars.csv")` to `sample_blob("CSV/cars.csv")`
2016-02-27 15:30:22 +00:00
Farbod Salamat-Zadeh
9bfbd0550c Move cars.csv from test/fixtures/Data to samples/CSV 2016-02-27 14:32:50 +00:00
Christoph Lipka
0301a5dcdf Merge remote-tracking branch 'upstream/master' 2016-02-27 06:24:30 +01:00
Farbod Salamat-Zadeh
db994a1197 Remove .txt extension for CSV format 2016-02-27 00:42:03 +00:00
Arfon Smith
855c13ea2a Merge pull request #2851 from edechter/master
Add .yap ext and yap interpreter for Prolog lang
2016-02-26 17:21:11 -07:00
William Claude Tumeo
bfa7eced44 Try fix "Ren'Py being detected as Python"
- Remove Ren'Py from Python group
- Add .rpy to Python + sample
2016-02-26 00:31:58 -03:00
William Claude Tumeo
b1d103b1f3 Merge remote-tracking branch 'upstream/master'
Update fork 2
2016-02-25 21:56:49 -03:00
Arfon Smith
fc816d3429 Merge pull request #2845 from kusma/uno
add support for Uno
2016-02-23 17:56:51 -07:00
William Tumeo
04a4e8c8e6 Merge pull request #1 from github/master
Update fork
2016-02-23 16:09:26 -03:00
Eyal Dechter
ab69fd01ac Add .yap ext and yap interpreter for Prolog lang 2016-02-22 15:59:40 -05:00
Erik Faye-Lund
cc6106f31b add sample ux-files 2016-02-22 18:45:59 +01:00
Erik Faye-Lund
ead85379ed add sample uno-files 2016-02-22 18:44:02 +01:00
Erik Faye-Lund
f8d6be55ee add .ux as an XML extension
This is used by Fusetools' UX markup:
https://www.fusetools.com/learn/fuse#hello-ux-markup
2016-02-20 14:45:31 +01:00
Arfon Smith
a241d75043 Merge pull request #2846 from Dominator008/bzl
Add .bzl extension to Python in languages.yml
2016-02-19 20:14:15 -07:00
Michael Zhou
864a6c0a20 Add .bzl extension to Python in languages.yml
.bzl is the extension for Skylark, a subset of Python that is used
to define build extensions for the Bazel build system.

Eg:
  https://github.com/bazelbuild/bazel/blob/master/tools/build_rules/closure/closure_js_binary.bzl
2016-02-19 19:11:36 -05:00
Arfon Smith
1c20c54191 Fixing ordering of makefile filenames 2016-02-19 16:55:38 -07:00
Arfon Smith
4d722d1fd1 Merge pull request #2838 from scop/makefile
Makefile: Add Makefile.am and Makefile.in filenames
2016-02-19 12:39:59 -07:00
Erik Faye-Lund
b67254e986 add support for Uno
Uno is a fast, native dialect of C#, that includes a lot of
specialized functionality for graphics programming.

https://www.fusetools.com/learn/uno
2016-02-19 18:52:12 +01:00
Arfon Smith
041cf9c94e Merge pull request #2837 from scop/shell-script
Shell: Add shell-script alias for recognizing Emacs modelines
2016-02-19 09:05:37 -07:00
Ville Skyttä
b08c5a8421 Shell: Add .sh.in extension 2016-02-19 17:56:50 +02:00
Arfon Smith
125eaa4cc3 Merge pull request #2844 from pchaigno/hacking.rst.txt
Move HACKING.rst.txt to sample directory
2016-02-19 08:44:01 -07:00
Erik Faye-Lund
6b001cf861 add support for HLSL/FX
Add support for DirectX HLSL / FX files. The FX files are
just HLSL files with some additional syntax to set
render-states and define multiple shader stages in one file.

Samples are either written by me, or taken from Chromium.
2016-02-19 11:32:46 +01:00
Paul Chaignon
5c4129f85b Move HACKING.rst.txt to sample directory
The file was incorrectly placed at the root of the repo
2016-02-19 08:50:01 +01:00
Brandon Keepers
fa56879790 WIP 2016-02-18 19:26:45 -05:00
Erik Faye-Lund
41713d7719 add a sample of FLUX code
These samples were taken from the paper "Flux: A Language for
Programming High-Performance Servers", by Burns et al and Flux V0.02
which can be found here:

https://plasma.cs.umass.edu/emery/flux.1.html
2016-02-18 23:38:56 +01:00
Ville Skyttä
17a9463588 Makefile: Add Makefile.am and Makefile.in filenames 2016-02-14 22:08:21 +02:00
Ville Skyttä
fb9f271720 Shell: Add shell-script alias for recognizing Emacs modelines 2016-02-14 22:00:16 +02:00
Arfon Smith
8de50edb41 ruby for example 2016-02-12 17:05:44 -07:00
Arfon Smith
ab33fccddd Merge pull request #2836 from github/cut-release-v4.7.5
Cut release v4.7.5
2016-02-12 16:58:11 -07:00
Arfon Smith
bd95ac0beb Bumping version 2016-02-12 16:27:29 -07:00
Arfon Smith
7b3efb185f Updating grammars 2016-02-12 16:25:05 -07:00
Farbod Salamat-Zadeh
a0065febe2 Add ace_mode and tm_scope for CSV 2016-02-06 16:34:33 +00:00
Arfon Smith
9374784651 Merge pull request #2805 from jamesqo/patch-1
Add .xproj to list of XML file extensions
2016-02-04 20:28:47 -07:00
Arfon Smith
aa6af3deed Merge pull request #2822 from AbigailBuccaneer/master
Add detection of GrammarKit-generated files
2016-02-04 20:28:12 -07:00
Arfon Smith
a19e501b44 Merge pull request #2833 from pchaigno/less-new-grammar
New grammar for Less
2016-02-03 08:45:08 -07:00
Paul Chaignon
889a395340 Grammar for Less from Atom package 2016-02-03 14:22:23 +01:00
Paul Chaignon
eb8eb28ca7 Remove Less grammar 2016-02-03 14:19:58 +01:00
Arfon Smith
697b3351e6 Merge pull request #2832 from github/better-perl6
Adding Perl6-specific grammar.
2016-02-02 22:43:12 -07:00
Arfon Smith
9fd80bfd67 Updating to latest perl6 grammar 2016-02-02 22:38:50 -07:00
Arfon Smith
7b58b1ea59 Adding Perl6-specific grammar. 2016-02-02 19:37:35 -07:00
Farbod Salamat-Zadeh
c454396c26 Add CSV as data type to languages.xml
Adds the .csv extension (and also .txt extension) so that this file type is shown when searching on GitHub.
2016-02-02 19:41:05 +00:00
Bayu Aldi Yansyah
2e9d8f5520 samples: remove empty file 2016-02-01 16:02:19 +07:00
Bayu Aldi Yansyah
c8ea3fba5a terra use #00004c 3 shades from Lua #000080
http://www.color-hex.com/color/000080
2016-02-01 15:11:46 +07:00
Bayu Aldi Yansyah
56af13047c grammar: add Terra 2016-02-01 15:11:24 +07:00
Arfon Smith
c46900396a Merge pull request #2827 from pchaigno/yang
Support for the YANG modeling language
2016-01-31 18:33:07 -06:00
Paul Chaignon
b235ed1223 Grammar for YANG from Atom package 2016-01-31 10:31:06 +01:00
Paul Chaignon
16d9612603 Support for YANG language 2016-01-31 10:29:06 +01:00
Abigail
721e5b4656 Add detection of GrammarKit-generated files
GrammarKit is a plugin by JetBrains for creating custom language plugins
for JetBrains IDEs (such as IntelliJ, RubyMine, CLion and more). It
defines a BNF parser language which can be used to generate a parser in
Java, and it also integrates JFLex for generating a lexer in Java.

Both of these generated Java files can be recognised by a comment on the
first line of the file, and so classifying them as generated is trivial.
2016-01-28 11:47:33 +00:00
Bayu Aldi Yansyah
9b8b39f444 samples: add Terra samples
source: https://github.com/zdevito/terra/tree/master/tests
2016-01-28 11:22:27 +07:00
Bayu Aldi Yansyah
e32a837fb2 languages.yml: add Terra 2016-01-28 10:52:03 +07:00
Arfon Smith
9961f8bc1c Merge pull request #2797 from lpil/erlang-leex-yecc
support for leex (.xrl) / yecc (.yrl) files
2016-01-23 11:36:43 -05:00
Arfon Smith
c066867d59 Merge pull request #2812 from chrisarcand/improved-vim-modeline-detection
Improved vim modeline detection
2016-01-21 20:12:26 -05:00
Arfon Smith
21093165e1 Merge pull request #2613 from ismailarilik/patch-2
Add colors for some languages.
2016-01-21 20:10:36 -05:00
James Ko
df88de14e3 Add .xproj to list of XML extensions 2016-01-20 19:01:19 -05:00
Arfon Smith
94de431aa5 Merge pull request #2811 from pchaigno/pod-heuristic
Heuristic for Pod vs. Perl
2016-01-18 07:59:47 -05:00
Arfon Smith
502557a97f Merge pull request #2808 from pchaigno/submodules-ssh
HTTPS links for submodules
2016-01-17 16:14:55 -05:00
Paul Chaignon
52938f6dbf Test submodules are using HTTPS links 2016-01-17 18:14:51 +01:00
chrisarcand
d87fad649c Improved vim modeline detection
TLDR: This greatly increases the flexibility of vim modeline detection
to manually set the language of a file.

In vim there are two forms of modelines:

[text]{white}{vi:|vim:|ex:}[white]{options}
examples: 'vim: syntax=perl', 'ex: filetype=ruby'

-and-

[text]{white}{vi:|vim:|Vim:|ex:}[white]se[t] {options}:[text]
examples: 'vim set syntax=perl:', 'Vim: se ft=ruby:'

As you can see, there are many combinations. These changes should allow
most combinations to be used. The two most important additions are the
use of the keyword 'syntax', as well as the addition of the first form
(you now no longer need to use the keyword 'set' with a colon at the end).
The use of first form with 'syntax' is very, very common across GitHub:

https://github.com/search?l=ruby&q=vim%3A+syntax%3D&ref=searchresults&type=Code&utf8=%E2%9C%93
2016-01-16 08:57:20 -05:00
Paul Chaignon
d8666e5309 Heuristic for Pod vs. Perl
.pod files classified as Pod if they contain any Pod syntax
2016-01-16 11:21:26 +01:00
Arfon Smith
0c071990cb Merge pull request #2809 from github/cut-release-v4.7.4
v4.7.4 release
2016-01-15 10:34:50 -05:00
Arfon Smith
77dfb19a50 Bumping to v4.7.4 2016-01-15 09:21:43 -05:00
Arfon Smith
49254f1f74 Grammar update 2016-01-15 09:19:24 -05:00
Arfon Smith
9dd952c175 Merge pull request #2807 from mrmonday/patch-1
Support .rs.in as a file extension for Rust files.
2016-01-15 09:11:36 -05:00
Robert Clipsham
0b9897db1f Support .rs.in as a file extension for Rust files.
When using syntax extensions in stable or beta Rust channels using the syntex package, it is common to use the file extension .rs.in for the source file, and .rs for the generated file.
2016-01-11 19:15:01 +00:00
Christoph Lipka
9d11128362 Updated POV-Ray SDL grammar sub-project 2016-01-10 21:24:02 +01:00
Christoph Lipka
ee17ab3e26 Empty commit to trigger re-run of build checks. 2016-01-10 21:14:17 +01:00
Christoph Lipka
06af36dac2 Fixed POV-Ray SDL entry in grammars.yml and Ace mode in languages.yml 2016-01-10 20:23:09 +01:00
Christoph Lipka
51d6d741e5 Fixed ordering of POV-Ray SDL in languages.yml 2016-01-10 20:11:26 +01:00
Christoph Lipka
b593a8ae67 Added more samples for the POV-Ray Scene Description Language 2016-01-10 18:40:29 +01:00
Christoph Lipka
7b30240a7f Added POV-Ray Scene Description Language 2016-01-10 13:05:41 +01:00
Paul Chaignon
71f124faa5 HTTPS links for submodules
When cloning the repository with all its submodules,
users without an SSH key registered will fail to clone
submodules with an SSH link
2016-01-10 10:10:41 +01:00
Arfon Smith
470bd34349 Merge pull request #2800 from github/2794-local
[UPDATED] Switch to a different (and better) grammar for Inform 7 source code
2016-01-07 16:37:28 -05:00
Arfon Smith
65087dd7b8 Merge branch 'master' into 2794-local 2016-01-07 16:28:54 -05:00
Arfon Smith
89c5361f25 Merge pull request #2772 from ibnfirnas/fix-copypasta-artifact
Remove copypasta artifact.
2016-01-07 16:26:10 -05:00
Arfon Smith
f82cc26e4f Merge pull request #2778 from pchaigno/wiki
New extensions for consistency with Markup
2016-01-07 16:25:47 -05:00
Louis Pilfold
15232fc072 Add the LFE lexer as an example of erlang .xrl 2016-01-04 12:17:31 +00:00
Louis Pilfold
0a7aab947c Add the Elixir parser as an example of erlang .yrl 2016-01-04 12:16:32 +00:00
Louis Pilfold
5906fa81bb support for Erlang leex (.xrl) / yecc (.yrl) files 2016-01-04 11:12:39 +00:00
Arfon Smith
1b2f574af2 Merge pull request #2782 from pchaigno/perl-heuristic-order
Reorder Perl heuristic rules
2016-01-03 07:44:54 -05:00
Paul Chaignon
ca4bc6110f Remove 'use strict' from Perl6 sample 2016-01-03 11:47:09 +01:00
Arfon Smith
a944769d61 Grammars update 2016-01-02 22:18:27 -05:00
Arfon Smith
98a31515ef Merge pull request #2796 from github/2703-local
MagicPython
2016-01-02 22:09:52 -05:00
Arfon Smith
3e665099ac Updating Python grammars 2016-01-02 22:04:16 -05:00
Arfon Smith
5400b534e4 Merge branch 'master' into 2703-local 2016-01-02 21:38:37 -05:00
Arfon Smith
6f2d4dc195 Merge pull request #2788 from nwolverson/update-purescript-submodule
Update PureScript submodule (moved repo, grammar tweak)
2016-01-02 21:33:21 -05:00
Arfon Smith
4f7fac3ba1 Merge pull request #2783 from jrnold/add-stan-extension
Add stan extension
2016-01-02 21:32:14 -05:00
Arfon Smith
fd6569830a Merge pull request #2792 from aqnouch/patch-1
Updated copyright to 2016
2016-01-02 21:23:52 -05:00
Andrew Plotkin
5d4cad6394 Remove the old submodule entry. 2016-01-01 22:40:23 -05:00
Andrew Plotkin
b790a49282 Remove the old Sublime-Inform grammar from the submodules list. 2016-01-01 22:25:11 -05:00
Andrew Plotkin
537b83c759 Switch from Sublime-Inform grammar to language-inform7 grammar
for Inform 7 source code.
2016-01-01 22:23:01 -05:00
Andrew Plotkin
c0b9e2c3f4 Update comment. 2016-01-01 21:52:51 -05:00
Andrew Plotkin
f488b9b9f7 Test strings and substs in a doc comment. 2016-01-01 17:22:06 -05:00
Andrew Plotkin
7060b116f4 Reword a little. 2016-01-01 16:54:55 -05:00
Andrew Plotkin
0f4cf11294 Wrong semicolon. 2016-01-01 16:34:23 -05:00
Andrew Plotkin
048496723b Include lots more forms of Inform7 syntax. Including embedded Inform6
syntax.
2016-01-01 16:15:03 -05:00
AQNOUCH Mohammed
70068f74f1 Updated copyright to 2016 2016-01-01 01:53:09 +00:00
Nicholas Wolverson
6f197bacc7 Update PureScript submodule (moved repo, grammar tweak)
Updated grammar to support triple-quoted strings properly:
0c53f8162e

atom-language-purescript repo has been moved to purescript-contrib org,
update the URL.
2015-12-29 23:22:53 +00:00
jrnold
24a89d2d75 add tm_grammar for Stan 2015-12-28 22:32:53 -08:00
jrnold
1ac16cbec7 add vendor for Stan 2015-12-28 22:31:49 -08:00
jrnold
8144438f39 Add color for Stan
Use the brick-red color of the [Stan logo](https://raw.githubusercontent.com/stan-dev/logos/master/logo.png).
2015-12-27 18:50:43 -08:00
jrnold
f141abbc73 add tm_scope for Stan 2015-12-24 16:05:06 -08:00
jrnold
5329b96793 add Stan samples 2015-12-24 15:55:14 -08:00
jrnold
7a70931066 add Stan to languages 2015-12-24 15:55:00 -08:00
Paul Chaignon
9a070d7bb3 Reorder Perl heuristic rules
Order heuristic rules by accuracy
Heuristic rules which are expected to generated
less false positives should be tested first
2015-12-23 21:43:55 +01:00
Paul Chaignon
189b2d684b .rst.txt and .rest.txt as reStructuredText extensions 2015-12-20 16:21:11 +01:00
Paul Chaignon
71dfac26fe .wiki extension as Mediawiki 2015-12-20 13:09:00 +01:00
Arfon Smith
efdc790374 Merge pull request #2776 from humzashah/minor-code-improvements
minor code improvements
2015-12-18 11:50:25 -05:00
Syed Humza Shah
a3613dc438 fixed a typo 2015-12-18 01:43:01 +00:00
Syed Humza Shah
97afedd861 removed usage of keyword as variable
this was done mainly to fix annoying syntax highlighting
2015-12-18 01:27:58 +00:00
Syed Humza Shah
00a436f175 used proper 'if/elsif/end' syntax 2015-12-18 01:24:05 +00:00
Siraaj Khandkar
aa2e3000cd Remove copypasta artifact. 2015-12-16 14:00:48 -05:00
Arfon Smith
10e0fa4360 Merge pull request #2771 from ibnfirnas/add-mathematica-test-file-extension
Add mathematica unit test file extension
2015-12-15 19:48:05 -05:00
Siraaj Khandkar
0473af368f Add sample Mathematica test files. 2015-12-15 13:37:55 -05:00
Siraaj Khandkar
b82f563c38 Add Mathematica test file extension: .mt 2015-12-15 13:33:03 -05:00
Arfon Smith
344297895b Merge pull request #2768 from williamd1k0/master
Add Ren'Py language and grammars
2015-12-14 09:41:45 -05:00
William Claude Tumeo
d3c525645b Fix sample folder name and language order 2015-12-13 15:58:14 -02:00
William Claude Tumeo
59d02e5138 Add language-renpy submodule 2015-12-13 00:20:25 -02:00
William Claude Tumeo
8522dc1d33 Add Ren'Py language and grammars 2015-12-13 00:16:09 -02:00
Vicent Marti
53d238f310 Merge pull request #2766 from github/piki/clear-cache
Catch `ENOENT` in `clear_cache`
2015-12-10 09:08:40 +01:00
Patrick Reynolds
92ed2d189e Catch ENOENT in clear_cache
There's no need for `clear_cache` to fail if the cache doesn't exist,
either because we call `clear_cache` twice or because no cache was
previously written on this particular repo.
2015-12-09 23:24:32 -06:00
Arfon Smith
7133c3b11a Merge pull request #2765 from github/cut-release-v4.7.3
Bumping version to v4.7.3
2015-12-08 23:17:35 -05:00
Arfon Smith
d72114083b Bumping version to v4.7.3 2015-12-08 22:30:17 -05:00
Arfon Smith
683925fcd5 Updating grammars 2015-12-08 22:28:46 -05:00
Arfon Smith
1c8bf32d35 Merge pull request #2759 from pchaigno/click
Support for the Click modular router language
2015-12-08 16:08:55 -05:00
Paul Chaignon
28913833f4 Merge branch 'master' into click 2015-12-08 22:00:49 +01:00
Arfon Smith
c6752be546 Merge pull request #2749 from Alhadis/maxscript
Add language support for MAXScript
2015-12-08 08:04:13 -05:00
Arfon Smith
395e474cad Merge pull request #2763 from github/2746-local
Jupyter notebook, version 2
2015-12-08 07:45:57 -05:00
Arfon Smith
16ea189aa6 Colour switch 2015-12-08 07:39:43 -05:00
marcelo-ramires
ac81fc5da9 Changing Jupyter Notebook color to a further darker shade to make it even more different from Mask's one 2015-12-07 14:12:18 -02:00
marcelo-ramires
58191c10b3 Changing Jupyter Notebook color to make it more different from Mask's one 2015-12-07 14:00:18 -02:00
marcelo-ramires
c2ca23d580 Removing extra leading space 2015-12-05 19:38:02 -02:00
marcelo-ramires
b5dfb40c7d Setting Jupyter Notebook's language property tm_scope to source.json 2015-12-05 18:57:40 -02:00
marcelo-ramires
7e647fd915 Renaming the sample folder to match Jupyter Notebook's, making the language type markup, and adding a real sample file instead of a dummy one 2015-12-05 18:48:17 -02:00
Paul Chaignon
5b9f9bc0e6 Grammar for Click from Atom package 2015-12-05 14:03:02 +01:00
Paul Chaignon
b1c057fa30 Support for the Click router config language 2015-12-05 13:58:14 +01:00
marcelo-ramires
ca348dd373 Moving .ipynb extension from python language to a new language called Jupyter Notebook 2015-12-05 03:25:38 -02:00
Arfon Smith
b802045c5c Grammar updates 2015-12-03 17:27:17 -06:00
Arfon Smith
3c244a9501 Merge pull request #2758 from github/2667-local
Add Ur/Web support
2015-12-03 16:03:12 -06:00
Arfon Smith
832a7b9b06 Merge branch 'master' into 2667-local 2015-12-03 15:41:25 -06:00
Arfon Smith
e7d856345f Merge pull request #2757 from scottclowe/octave-alias
Add octave as an alias for Matlab syntax
2015-12-03 15:35:55 -06:00
Scott Lowe
ac559effaa Add octave as an alias for Matlab syntax
Since Octave is a clone of Matlab, the syntax is exactly the same
and hence it is desirable for highlighting to be exactly the same
as well.
Adding octave as an alias for Matlab will trivially provide support
for highlighting Octave code, and will ensure the two languages
always use the same syntax highlighting rules.
2015-12-03 21:00:21 +00:00
Arfon Smith
95d0daba80 Merge pull request #2755 from github/add-elixir-interpreter
Adding elixir as an interpreter
2015-12-02 16:23:14 -06:00
Arfon Smith
a0ad1523a1 Adding elixir as an interpreter 2015-12-02 14:52:29 -06:00
Alhadis
06c049b8c0 Change ".ms" heuristic to accommodate MAXScript
Linguist currently uses the presence of "move" commands to differentiate
a GAS file from Groff. This is problematic with MAXScript, with includes
a built-in function of that name. Furthermore, because of the language's
exhaustive vocabulary, case insensitive nature and flexible syntax, it's
difficult to impose rigid criteria on classifying it.

This commit modifies the heuristic to assume the following flow:

    1. If a line contains ".include" or ".global"/".globl" which doesn't
       follow a non-whitespace character, assume GAS.

    2. Otherwise, if the line starts with a command like ".LG7E0" with a
       possible string of whitespace before it, assume it's also GAS.

       UNLESS either of the following conditions are true:
       2a. The token is enclosed by a string or /* multiline comment */
       2b. The previous line ends with a backslash to denote a statement
           broken between lines, with possible whitespace and/or comment
           sequences between the backslash and the actual newline.

    3. If neither of the above are met, assume the file is MAXScript.

This approach may appear overly-inclusive, but given real-world usage of
MAXScript includes writing brief files with few distinguishing keywords,
it's reasonable to permit this leniency.
2015-11-28 04:40:29 +11:00
marcelo-ramires
24c7380765 Adding .ipynb (Jupyter Notebook) extension to python, and a sample file 2015-11-26 02:55:39 -02:00
Alhadis
73ef1bf156 Update MAXScript submodule to version v1.0
This is the first "real" version of the language package, which I pushed
to Atom's packages repository earlier before.
2015-11-26 05:58:10 +11:00
Arfon Smith
c8b30a62f9 Merge pull request #2741 from github/cut-release-v4.7.2
Cut release v4.7.2
2015-11-23 15:24:29 -06:00
Arfon Smith
48dfdd2dfe Bumping version to v4.7.2 2015-11-23 14:04:48 -06:00
Arfon Smith
68727f724a Grammars update 2015-11-23 13:53:53 -06:00
Alhadis
f46e053633 Darken MAXScript's language colour
Rake's tests are failing because #0AA is too similar to the colour being
used by another language (Dart: #00B4AB). This commit increases contrast
enough to satisfy the build (with 00A6A6 being the closest shade allowed
by the current colour threshold).

See also: github/linguist@3c96f9e
2015-11-23 19:04:09 +11:00
Alhadis
d2e739ba8c Update MAXScript submodule to include license file
See also: Alhadis/language-maxscript@96dbacf5b
2015-11-23 19:02:50 +11:00
Alhadis
37174e1d2c Include MAXScript submodule in grammars directory 2015-11-23 17:34:43 +11:00
Alhadis
cdb5206def Define MAXScript's language traits
The colour chosen to represent the language is taken from Autodesk's own
colouring scheme, which should easily be recognised by their userbase.
2015-11-23 17:14:35 +11:00
Alhadis
d636eaf1e3 Add example MAXScript files from Autodesk reference 2015-11-23 17:12:18 +11:00
Arfon Smith
49f3eb1286 Merge pull request #2736 from ppwwyyxx/patch-1
add jquery.fancybox.css to vendor list
2015-11-22 21:16:45 -06:00
Yuxin Wu
8ab94a8643 Use one line for jquery fancybox in vendor
(just another commit to pass CLA check
2015-11-21 21:55:08 -05:00
Yuxin Wu
f72c337c5b add jquery.fancybox.css to vendor list
fancybox has both js and css
2015-11-21 21:48:03 -05:00
Arfon Smith
d22321de07 Merge pull request #2733 from github/cake
.cake
2015-11-19 20:34:36 -06:00
Arfon Smith
473e5db51f Adding sample for Coffeescript too 2015-11-19 20:24:23 -06:00
Arfon Smith
8b9fc4683a Merge branch 'master' into cake 2015-11-19 20:19:08 -06:00
Arfon Smith
3b4415cc3c Merge pull request #2729 from larsbrinkhoff/fortran
Recognise END statement in FORTRAN files.
2015-11-19 20:07:10 -06:00
Arfon Smith
2afce1754a Merge pull request #2731 from soc/patch-1
Change Scala language color to Scala language's main color
2015-11-19 20:06:22 -06:00
Arfon Smith
f232b93214 Merge pull request #2728 from larsbrinkhoff/fs
Add new .eam.fs sample for Formatted.
2015-11-19 20:05:45 -06:00
soc
db64f192fa Change Scala language color to Scala language's main color 2015-11-19 15:25:55 +01:00
Lars Brinkhoff
ca96ecdc55 Recognise END statement in FORTRAN files. 2015-11-19 08:51:13 +01:00
Lars Brinkhoff
2a06d1aa19 Add new sample for Formatted.
Sample from qingguang/lammps-sph; GPL v2 license.
2015-11-19 07:59:31 +01:00
Arfon Smith
b2fa2a1f46 Merge pull request #2655 from iblech/pickle
Detect Pickle data dumps (.p, .pkl, .pickle)
2015-11-16 17:57:53 -06:00
Ingo Blechschmidt
6839516b5c Only classify .pkl files as Pickle data dumps
It seems to be the dominant extension at the moment, even though several
Python resources use `.p` or `.pickle`. This was discussed in #2655.
2015-11-17 00:05:22 +01:00
Arfon Smith
7247c80fac Merge pull request #2722 from github/cut-release-v4.7.1
Cut release v4.7.1
2015-11-12 19:51:41 -06:00
Arfon Smith
01d05d1d4e Bumping to v4.7.1 2015-11-12 18:43:16 -06:00
Arfon Smith
8db4cc482e Grammar update 2015-11-12 18:42:24 -06:00
Arfon Smith
074f17ed98 Merge pull request #2712 from matiasinsaurralde/master
Support for JSCAD files
2015-11-12 18:18:52 -06:00
Arfon Smith
68b553ea55 Updating grammars 2015-11-10 09:57:04 +00:00
Arfon Smith
fd5da9cb15 Merge pull request #2690 from github/licensee-6
Upgrade to licensee 6
2015-11-10 09:41:09 +00:00
Arfon Smith
d081f687b0 Merge branch 'master' into licensee-6 2015-11-10 09:34:39 +00:00
Arfon Smith
34abe5b983 Merge pull request #2717 from meatballhat/supercollider-grammar
Add SuperCollider grammar
2015-11-10 09:31:24 +00:00
Arfon Smith
5765f1faf1 Merge pull request #2718 from meatballhat/travis-apt-update
Fetch libicu via Travis, switch back to container-based
2015-11-10 09:30:04 +00:00
Dan Buch
550b67215c Fetch libicu via Travis, switch back to container-based
This is a test.  I don't understand the details of how the `bundle config
build.charlock_holmes` bit works/fails, so the intent here is to get a PR posted
for purposes of getting feedback via the full Travis machinery.
2015-11-08 06:41:22 -05:00
Dan Buch
d7b2826113 Add SuperCollider grammar
plus a few minor language support updates including:

- recognize `sclang` and `scsynth` interpreters
- set `tm_scope: source.supercollider`
- reorder extensions so that `.sc` is primary
2015-11-08 06:28:14 -05:00
Arfon Smith
b4f94c7c25 Merge pull request #2706 from redroot/add-csl-as-xml-support
adding csl as an extension for XML, included sample
2015-11-05 09:07:49 -08:00
Arfon Smith
d24677adbb Merge pull request #2716 from github/faster-string-tokenizer
Use negative lookbehind when tokenizing string literals
2015-11-05 08:40:34 -08:00
Arfon Smith
04f981eeac Merge pull request #2714 from github/aroben-patch-1
Remove mentions of treatment of vendored files in diffs
2015-11-05 08:14:26 -08:00
Arfon Smith
b53d84d8ff Merge pull request #2600 from manveru/pony-language
Add Pony language
2015-11-05 08:08:38 -08:00
Adam Roben
fea8bb21a0 Use negative lookbehind when tokenizing string literals
This can double the speed of tokenizing large RTF files that use \'hh
escape sequences.
2015-11-05 10:18:44 -05:00
Adam Roben
996ed8a8b1 Remove mentions of treatment of vendored files in diffs
Vendored files are treated just like any other files when diffing on github.com.
2015-11-04 13:26:24 -05:00
Matias Insaurralde
daef164163 adding jscad sample file 2015-11-03 00:24:15 -03:00
Matias Insaurralde
61a5cab1f2 adding extension for OpenJSCAD 2015-11-03 00:03:00 -03:00
Redth
2fddaaf3d7 Reordered extensions so the primary .cs is first 2015-10-31 12:45:54 -04:00
Redth
741d246581 Add .cake extension for C#
This adds the .cake file extension to the C# language.

Here is a search in the wild: https://github.com/search?q=extension%3Acake+NOT+coffee&type=Code

Cake (C# Make) is a cross platform build automation system with a C# DSL to do things like compiling code, copy files/folders, running unit tests, compress files and build NuGet packages.

You can find out out more about cake here: http://cakebuild.net/
2015-10-30 15:06:38 -04:00
redroot
1b23e81541 adding csl as an extension for XML, included sample 2015-10-30 10:40:15 +00:00
Arfon Smith
362d300cb0 Blob not FileBlob 2015-10-26 09:06:42 +00:00
Dario Bertini
7b185cc2f3 Switch to MagicPython for Python sources 2015-10-23 20:49:05 +01:00
Arfon Smith
932726863f Merge branch 'master' into licensee-6 2015-10-23 10:29:47 +01:00
Arfon Smith
a35a3e98ce Merge pull request #2702 from github/drop-ruby-1.9.3
Dropping support for Ruby 1.9.3
2015-10-23 10:29:13 +01:00
Arfon Smith
7c404e72d2 Dropping support for Ruby 1.9.3 2015-10-23 10:20:31 +01:00
Arfon Smith
8736e2305d Merge pull request #2700 from pchaigno/django-alias
Django as an alias for HTML+Django
2015-10-22 20:39:14 +01:00
Paul Chaignon
a13664698f Django as an alias for HTML+Django 2015-10-22 20:28:40 +02:00
Arfon Smith
6e934067a8 Merge pull request #2698 from phase/master
Change D color to match the website
2015-10-22 09:26:31 +01:00
phase
3040642f97 Change D color to its logo 2015-10-21 16:42:43 -07:00
phase
dd7e44f957 Change D color to match the website
The original yellow color doesn't fit D very well, and it looks an awful lot like the color for JavaScript. This changes it to the color used on the website's sidebar, and nice dark maroon: http://www.colorpicker.com/2e2324
2015-10-21 15:34:25 -07:00
Arfon Smith
6b56a243e7 Merge pull request #2696 from github/cut-linguist-4.7.0
Bumping to version 4.7.0
2015-10-21 10:19:16 +01:00
Arfon Smith
5d08605aef Bumping to version 4.7.0 2015-10-21 09:04:17 +01:00
Arfon Smith
bf705cbaf2 Grammars update 2015-10-21 09:02:56 +01:00
Arfon Smith
fe827896e0 Merge pull request #2681 from miek/kicad-brd-extension
Add .brd extension for KiCad
2015-10-21 08:55:05 +01:00
Arfon Smith
317219e479 Merge branch 'master' into licensee-6 2015-10-21 08:51:10 +01:00
Arfon Smith
64e7df7596 Merge pull request #2694 from github/memory_blob
Memory blob
2015-10-21 08:49:42 +01:00
Brandon Keepers
33dc865c30 run script/licensor 2015-10-20 17:45:45 -04:00
Brandon Keepers
0d469e2966 Add licensor 2015-10-20 17:44:31 -04:00
Arfon Smith
b3ff84872b Merge branch 'master' into memory_blob 2015-10-20 19:24:43 +01:00
Arfon Smith
5d176a781c Fixing the build :-\ 2015-10-20 19:24:04 +01:00
Arfon Smith
e0c97f97ba Merge branch 'master' into memory_blob 2015-10-20 12:36:26 +01:00
Arfon Smith
83f358976e Fixing up some old MemoryBlob references 2015-10-20 12:33:43 +01:00
Arfon Smith
9ee6153891 Merge pull request #2676 from lucky/master
Support for files generated by Racc.
2015-10-19 12:05:12 +01:00
Arfon Smith
825e640061 Merge pull request #2684 from jeffkreeftmeijer/eex
Add EEx (Embedded Elixir)
2015-10-19 12:02:18 +01:00
Arfon Smith
e5ae213839 Merge pull request #2689 from edendramis/master
Add FreeMarker syntax highlighting
2015-10-19 12:00:38 +01:00
Arfon Smith
74e034c689 Merge pull request #2686 from pchaigno/metal
Support for Metal language
2015-10-19 11:49:36 +01:00
Evangelia Dendramis
a55a60a161 removing group and search term 2015-10-16 18:19:53 -07:00
Brandon Keepers
9d865ec018 license of factor grammar is now detected properly 2015-10-16 15:16:04 -04:00
Brandon Keepers
8b01e3dead Upgrade to licensee 6.0.0b1 2015-10-16 15:15:34 -04:00
edendramis
9e3cc01715 adding FreeMarker to grammars.yml 2015-10-16 09:54:17 -07:00
edendramis
0f204767a9 updating examples 2015-10-15 14:48:20 -07:00
edendramis
11e3251efd adding samples 2015-10-15 14:43:02 -07:00
edendramis
1f1416a5f7 adding freemarker grammar 2015-10-15 14:15:27 -07:00
edendramis
b3786f3825 Merge remote-tracking branch 'upstream/master' 2015-10-15 14:07:13 -07:00
Paul Chaignon
09c2eee91e Support for Metal language 2015-10-13 07:57:58 +02:00
Arfon Smith
dc78b14902 Merge pull request #2683 from hipikat/patch-1
Correct typo ("Any information you [c]an add")
2015-10-12 10:09:17 +01:00
Arfon Smith
500ce0959a Merge branch 'master' into memory_blob 2015-10-12 09:49:22 +01:00
Adam Wright
aa0c9e3572 Correct typo ("Any information you [c]an add") 2015-10-12 14:40:18 +08:00
Mike Walters
e6de75d48a Add .brd extension for KiCad 2015-10-11 23:50:29 +01:00
Arfon Smith
a5ad0a34f8 Merge pull request #2675 from fbonzon/master
Add .phps extension for PHP
2015-10-11 21:32:17 +01:00
Arfon Smith
6e609cc4e3 Merge pull request #2680 from k2b6s9j/patch-1
The Crystal Grammar repository has moved.
2015-10-11 21:31:55 +01:00
Kepler Sticka-Jones
27727a927f The Crystal Grammar repository has moved.
And I'm kinda thinking about changing my GitHub name...
2015-10-10 23:49:07 -06:00
Jared Kuolt
5ff580df0a Support for files generated by Racc.
This changeset includes a sample racc file from [this auto-generated
file](44e9bf0440/lib/rjson/parser.rb)
(MIT-licensed).

[Racc](https://github.com/tenderlove/racc) Racc is an LALR(1) parser
generator. It is written in Ruby itself, and generates ruby programs.
2015-10-09 16:20:59 -07:00
Jeff Kreeftmeijer
b34acac722 Add EEx (Embedded Elixir)
EEx is embedded Elixir: http://elixir-lang.org/docs/v1.0/eex/. Here's
some in-the-wild usage on Github: https://github.com/search?p=100&q=extension%3Aeex+NOT+nothack&ref=searchresults&type=Code&utf8=✓

This uses the "html_elixir" Ace mode, which was added in this pull
request on the Ace project: https://github.com/ajaxorg/ace/pull/2696
2015-10-10 00:20:38 +02:00
François B
37840856ed Add .phps extension for PHP
.phps stands for "PHP Source"

Useful to show examples of PHP code. A properly-configured server will
output a .phps file as is, with color-formated source code instead of
the HTML that would normally be generated.

Usage in GitHub:
https://github.com/search?utf8=%E2%9C%93&q=extension%3Aphps+NOT+nothack&
type=Code

Example taken from:
https://github.com/PHPMailer/PHPMailer/blob/master/examples/mail.phps
2015-10-09 14:43:22 +02:00
Brandon Keepers
acfad4371f Mention alphabetical order in contributing docs
Closes #2649
2015-10-07 19:41:37 -04:00
Arfon Smith
ae42cc0307 Merge pull request #2672 from github/cut-release-v4.6.4
Cut release v4.6.4
2015-10-05 11:15:35 +01:00
Arfon Smith
d06860df37 Bumping version to v4.6.4 2015-10-05 09:45:32 +01:00
Arfon Smith
7d5d162f6b Updating FSharp grammars to match 2015-10-05 09:45:05 +01:00
Arfon Smith
d39a75b68b Grammar updates 2015-10-05 09:41:56 +01:00
Arfon Smith
d72f7311f6 Merge pull request #2648 from jaredpetersen/master
Added .pck PLSQL file extension
2015-10-05 09:23:56 +01:00
Arfon Smith
3f81b7c179 Merge pull request #2640 from wizawu/master
Add new extension .tsx for TypeScript
2015-10-05 09:21:46 +01:00
Arfon Smith
33d1255a5a Merge pull request #2671 from pchaigno/change-stata-grammar-repo
Change Stata grammar repo
2015-10-05 09:15:15 +01:00
Paul Chaignon
0ebea6a0ff Use pschumm/Stata.tmbundle 2015-10-04 20:45:33 +02:00
Paul Chaignon
c28da3a4a9 Remove statatmbundle/Stata.tmbundle grammar 2015-10-04 20:42:29 +02:00
Julian Squires
538f479b60 Add sample Ur/Web files
Taken from tokenrove/parsur so I don't have to worry about license
hassles.  (You may relicense these samples as necessary.)

It would be nice to have an example of the embedded SQL syntax in a
sample.
2015-10-03 08:28:44 -04:00
Julian Squires
88cc73fa49 Add language definition for Ur/Web
I have omitted the related .urp extension because these are small
files (projects) in a different syntax.
2015-10-03 08:28:44 -04:00
wizawu
d6d368a65d Replace the sample file for .tsx extension
The sample file is from https://github.com/Microsoft/TypeScript/blob/master/tests/cases/conformance/jsx/tsxAttributeResolution9.tsx
2015-10-03 11:01:22 +08:00
wizawu
c5be9cc3e9 Add .tsx extension for XML
The sample file is from https://github.com/nyxcharon/tiled/blob/master/src/examples/water.tsx
2015-10-02 19:50:10 +08:00
E
c462c2bd31 add FreeMarker to languages.yml 2015-10-01 13:59:52 -07:00
wizawu
3426165621 Add a TypeScript sample with .tsx extension 2015-09-30 13:45:38 +08:00
Vicent Marti
98b99e38bb Merge pull request #2654 from github/vmg/git-linguist-fixes
Small fixes for git-linguist
2015-09-28 11:12:49 +02:00
Vicent Marti
d8e3bec499 Bump version 2015-09-28 01:45:49 -07:00
Vicent Marti
7c759d4d29 git-linguist: Do not write cache if repo is gone 2015-09-28 01:45:49 -07:00
Vicent Marti
41d438b47e repository: Do not attempt to scan large repos 2015-09-28 01:45:49 -07:00
Vicent Marti
41911d6921 git-linguist: Properly handle $GIT_DIR from git 2015-09-28 01:45:49 -07:00
Arfon Smith
dca18d77cb Merge pull request #2656 from iblech/better-test-description
Clarified that only nonprimary extensions should be sorted
2015-09-27 20:34:30 +01:00
Ingo Blechschmidt
040af5dad2 Clarify that only nonprimary extensions should be sorted 2015-09-25 19:23:06 +02:00
Ingo Blechschmidt
01bb6c37ab Detect Pickle data dumps (.p, .pkl, .pickle) 2015-09-25 19:06:50 +02:00
Jared Petersen
c624d68628 Added .pck PLSQL file extension 2015-09-24 07:59:06 -07:00
Arfon Smith
4867c49bd9 Merge pull request #2642 from github/license-in-gemspec
Include LICENSE in gem
2015-09-23 09:19:18 +01:00
Brandon Keepers
a354eddf4b Update github-linguist.gemspec 2015-09-22 16:33:08 -04:00
Vicent Marti
9b78c533a5 Merge pull request #2641 from github/js-syntax-fix
github-linguist-grammars 4.6.2
2015-09-21 21:56:33 +02:00
Mislav Marohnić
090ea576b9 github-linguist-grammars 4.6.2 2015-09-21 21:23:40 +02:00
Mislav Marohnić
6a2d33a4b3 Bump language-javascript for syntax highlighting fix
This is primarily to pull
https://github.com/atom/language-javascript/pull/227

Full changelog:
c5c381e...7b14bbb (diff-46d5c1ca71eaebb92619d6c7abc9388d)
2015-09-21 19:04:30 +02:00
wizawu
b54a9c7412 Add new extension .tsx for TypeScript
TypeScript 1.6 has introduced a new .tsx file extension.
2015-09-21 13:48:30 +08:00
Vicent Marti
2c62da7834 Merge pull request #2636 from github/vmg/git-linguist-oid
git-linguist: Delay loading @commit_oid
2015-09-16 16:48:12 +02:00
Vicent Marti
0145a0adb2 git-linguist: Delay loading @commit_oid 2015-09-16 05:50:35 -07:00
Vicent Marti
473282d64c Merge pull request #2630 from github/vmg/memory
4.6.0: Reduce memory pressure
2015-09-15 11:19:45 +02:00
Vicent Marti
c2c068e9db Bump version to 4.6.0 2015-09-14 08:43:10 -07:00
Vicent Marti
13d1f662d1 Add the git-linguist helper 2015-09-14 08:42:51 -07:00
Arfon Smith
bdd57f58a0 Merge pull request #2625 from github/handlebars-group
Adding Handlebars to the HTML group
2015-09-09 09:18:11 +01:00
Arfon Smith
b1bcabd6e6 Adding Handlebars to the HTML group 2015-09-08 12:25:05 +01:00
Arfon Smith
e128c3fa82 Merge pull request #2622 from miksen/patch-1
Language bar clarification in README.md
2015-09-08 12:08:42 +01:00
Arfon Smith
efac9fe750 Merge pull request #2624 from pchaigno/jsx-grammar
New JSX language under JavaScript group
2015-09-08 11:01:44 +01:00
Arfon Smith
2b8545a8fa Merge pull request #2567 from pcantrell/objc-import-statement
#import "*.h" detection for Objective-C
2015-09-08 10:53:32 +01:00
Vicent Marti
b275b5d728 Soften memory pressure 2015-09-07 22:03:29 +02:00
Paul Chaignon
1f46cfafa7 New JSX language under JavaScript group
A specific grammar is needed to highlight .jsx files
Thus, there are now in a distinct language but still in the JavaScript group
2015-09-05 13:31:17 +02:00
miksen
b1dcdf3418 Language bar clarification in README.md
Clarified what the percentages in the Language bar are based on.
2015-09-04 11:49:10 +02:00
Paul Cantrell
4bfd65deb8 #import "*.h" detection for Objective-C 2015-09-03 22:10:27 -05:00
Paul Chaignon
213cf322f5 Merge branch 'master' into blob_in_memory 2015-09-04 00:55:39 +02:00
Arfon Smith
61102812a0 Merge pull request #2619 from github/linguist-generated
Adding support for generated overrides
2015-09-03 15:02:16 +01:00
Arfon Smith
580cfce7fb Adding support for generated overrides 2015-09-03 14:39:27 +01:00
Arfon Smith
f1383d7a45 Merge pull request #2616 from scttnlsn/patch-1
Ignore spec fixtures
2015-09-02 18:35:07 +01:00
Scott Nelson
e4ce5bfe39 Ignore spec fixtures 2015-09-02 12:52:25 -04:00
ismail-arilik
4d2b38497d Remove color attributes of 'type: data's. 2015-09-02 18:53:29 +03:00
ismail-arilik
fc5ae1cfbc Revert colors of some languages.
Revert colors of some languages which have 'type: data' attribute.
2015-09-02 17:53:58 +03:00
ismail-arilik
7e76d1cc6b Update Pascal color to fix the closeness issue. 2015-09-02 17:01:38 +03:00
ismail-arilik
cf834e8a21 Update some colors to fix closeness. 2015-09-02 16:23:33 +03:00
ismail-arilik
ee61466042 Update some colors to fix closeness. 2015-09-02 15:58:46 +03:00
ismail-arilik
35884d482c Update some colors to fix closeness. 2015-09-02 15:38:41 +03:00
ismail-arilik
802de8112c Update some colors to fix closeness. 2015-09-02 14:39:19 +03:00
ismail-arilik
9a76cfc85f Update some colors to fix closeness.
I have used syntactic color values with respect to the table below:

A | B C | D | E | F G | H | I | J K | L M | N O | P Q | R S | T U | V W | X | Y Z
0     1     2   3     4     5   6   7      8        9      A      B     C       D    E     F

For example for Gradle the color should be 4B0283, for Cuda the color should be 1C201C(for six-letter CudaCu) and for reStructuredText the color should be B3BCBC(for six-letter reStru).
2015-09-02 14:16:12 +03:00
ismail-arilik
dc41dd888d Update Cuda color to fix closeness. 2015-09-02 13:31:51 +03:00
Arfon Smith
6ed64f25a2 Merge pull request #2607 from Alhadis/master
Add .geojson/.topojson as JSON extensions / Fix NCL colour
2015-09-02 10:13:31 +01:00
ismail-arilik
827ad80311 Update colors to fix collision.
Colors basically incremented.
2015-09-02 10:16:37 +03:00
ismail-arilik
9e3d8ac4e9 Update Batchfile color. 2015-09-02 09:58:14 +03:00
Alhadis
114a331106 Add ".topojson" as a JSON extension 2015-09-02 07:04:51 +10:00
Arfon Smith
9aa24a216a Merge pull request #2612 from github/cut-release-v4.5.15
Cut release v4.5.15
2015-09-01 21:04:40 +01:00
ismail-arilik
1b327e29ba Add colors for some languages.
These are effected languages and the reason behind the proposed colors:

- Ant Build System: The color of logo (http://ant.apache.org/images/project-logo.gif).
- AppleScript: AppleScript editor logo (https://en.wikipedia.org/wiki/AppleScript#/media/File:AppleScript_Editor_Logo.png).
- Batchfile: Batch file icon in Windows (https://en.wikipedia.org/wiki/Batch_file#/media/File:Batch_file_icon_in_Windows_Vista.png).
- Bison: A color taken from a bison (https://en.wikipedia.org/wiki/Bison#/media/File:Americanbison.jpg).
- Cucumber: Official logo color (https://cucumber.io/images/cucumber-logo.svg).
- Cuda: Nvidia(creator of CUDA) logo color (http://www.nvidia.com/content/includes/redesign2010/images/redesign10/nvidia_logo.png).
- Gradle: Official Gradle logo color (https://gradle.org/wp-content/uploads/2015/03/GradleLogoReg.png).
- Hack: Hack logo color (http://hacklang.org/wp-content/themes/hack/hack.png).
- Haml: Haml logo color (http://haml.info/images/haml.png).
- LLVM: Eye color of the dragon logo of LLVM (http://llvm.org/img/DragonMedium.png).
- Less: Less logo color (http://lesscss.org/public/img/logo.png).
- Markdown: The Daring Fireball logo color (http://daringfireball.net/graphics/logos/).
- Maven POM: The maven logo color (https://en.wikipedia.org/wiki/Apache_Maven#/media/File:Maven_logo.svg).
- Nginx: The nginx logo color (http://nginx.org/nginx.png).
- NumPy: The NumPy logo color (http://www.numpy.org/_static/numpy_logo.png).
- RDoc: I couldn'd find any logo, so have used the color of the name of RDoc in the official site (http://docs.seattlerb.org/rdoc/).
- SCSS: The Sass logo color (http://sass-lang.com/assets/img/logos/logo-b6e1ef6e.svg).
- Sass: The Sass logo color (http://sass-lang.com/assets/img/logos/logo-b6e1ef6e.svg).
- XML: A random color.
- XSLT: A random color.
- YAML: The color of the name of YAML in the official site (http://yaml.org/).
- Yacc: A random color.
- reStructuredText: The official logo color (http://docutils.sourceforge.net/rst.png).
2015-09-01 21:51:48 +03:00
Arfon Smith
13702451ab Bumping to v4.5.15 2015-09-01 19:13:02 +01:00
Arfon Smith
f0242f6f97 Updating grammars 2015-09-01 19:12:27 +01:00
Arfon Smith
9775820398 Merge pull request #2591 from jtbandes/master
Vendored definitions for Xcode-related files
2015-09-01 18:53:08 +01:00
Matěj Týč
26a35ea43d added aclocal to the generated files list 2015-09-01 17:51:18 +02:00
Matěj Týč
81ebef2e29 Added autoconf output, removed configure.ac 2015-09-01 17:49:01 +02:00
Arfon Smith
7daf26bcd0 Merge pull request #2604 from larsbrinkhoff/alphabetise-heuristics
Alphabetise heuristics.
2015-09-01 15:25:49 +01:00
Arfon Smith
231f705098 Merge pull request #2606 from thejameskyle/jsproj
Add .jsproj extension
2015-09-01 15:23:53 +01:00
Arfon Smith
893ab8fd8d Merge pull request #2610 from ismail-arilik/patch-1
Add color for the PL/SQL language.
2015-09-01 15:20:49 +01:00
ismail-arilik
5afdd2c533 Add color for the PL/SQL language.
I have added color to the PL/SQL language: #dad8d8. I take this color from a window background which evokes the interface of the language.
2015-09-01 14:23:59 +03:00
Lars Brinkhoff
e4f5c0066a Add checks to keep heuristics alphabetised. 2015-09-01 08:21:34 +02:00
Alhadis
a167f852dd Alphabetise JSON extensions 2015-09-01 07:33:07 +10:00
Alhadis
b428bce126 Quote NCL language's colour value
Without double-quotes, the hex colour is interpreted as a YAML comment.

Originally added in 2d39258.
2015-09-01 07:24:17 +10:00
Alhadis
e62d0e19a5 Add ".geojson" as a JSON extension 2015-09-01 07:12:18 +10:00
James Kyle
9b8bf9068f Move jsproj example to xml directory 2015-08-31 11:35:01 -07:00
James Kyle
6e05edc350 Add .jsproj extension 2015-08-31 10:26:29 -07:00
Lars Brinkhoff
dd8eaf2893 Alphabetise heuristics. 2015-08-31 08:53:51 +02:00
Matěj Týč
1068cfb4b5 Removed stray M4 attribute 2015-08-30 15:25:42 +02:00
Matěj Týč
73b1737dc7 Removed a typo 2015-08-30 15:09:45 +02:00
Matěj Týč
1d86f40fcd Added m4sugar language, moved samples to right locations. 2015-08-30 15:03:55 +02:00
Michael Fellinger
ecc750f445 Merge branch 'master' of https://github.com/github/linguist into origin/patch-1
* 'master' of https://github.com/github/linguist:
  Switch to Apache License.
  also add help for unapproved licenses
  Update X10 grammar license.
  add some help text to license test
  Fix typo in Obj-C heuristic keyword
  Add the X10 language (http://x10-lang.org/).
  Sublime Text workspace files as vendored
  Make Slick regexp more general
  Tests for new vendored files
  Test for new CodeMirror regexp
  New JS vendored files
  Fix CodeMirror regex for vendored files
  added *.lslp to samples/LSL folder
  added *.lslp as LSL(Linden Scripting Language)

Conflicts:
	.gitmodules
2015-08-28 14:08:31 -04:00
Michael Fellinger
cf5268a7d4 add Pony language 2015-08-28 14:04:10 -04:00
Matěj Týč
59fb481138 Added pure m4 example 2015-08-27 15:40:10 +02:00
Matěj Týč
16e22b3b77 Added M4 samples 2015-08-27 15:37:32 +02:00
Ben Balter
e24efad5ff Merge pull request #2594 from github/license-help
Add some additional help text to license test
2015-08-26 14:55:37 -04:00
Arfon Smith
58a34cdb7d Merge pull request #2589 from mandel/master
Add the X10 language.
2015-08-26 19:36:54 +01:00
Louis Mandel
b1c6b330e9 Switch to Apache License. 2015-08-26 14:26:30 -04:00
Ben Balter
7c3e265033 also add help for unapproved licenses 2015-08-26 12:31:29 -04:00
Louis Mandel
13695a716c Update X10 grammar license. 2015-08-26 09:46:02 -04:00
Ben Balter
c9e43804d6 add some help text to license test 2015-08-26 09:26:04 -04:00
Arfon Smith
1535e3553e Merge pull request #2580 from LeonaMorro/master
add *.lslp as an additional extension for LSL (LindenScriptingLanguage)
2015-08-26 14:09:48 +01:00
Arfon Smith
0ac05bbbeb Merge pull request #2582 from pchaigno/vendor-libraries
Vendored JS files
2015-08-26 14:02:57 +01:00
Arfon Smith
d3f979d640 Merge pull request #2592 from jtbandes/typo
Fix typo in Obj-C heuristic keyword
2015-08-26 12:52:05 +01:00
Jacob Bandes-Storch
0e9ded45dc Fix typo in Obj-C heuristic keyword
`synchronised` → `synchronized`
2015-08-26 00:34:00 -07:00
Jacob Bandes-Storch
a2ca886510 Vendored definitions for Xcode-related files 2015-08-25 23:42:20 -07:00
Matěj Týč
aa701c6766 Update languages.yml 2015-08-25 01:09:42 +02:00
Louis Mandel
25a1af3775 Add the X10 language (http://x10-lang.org/). 2015-08-24 13:26:43 -04:00
Paul Chaignon
0d8e0a2970 Sublime Text workspace files as vendored 2015-08-24 12:32:26 +02:00
Paul Chaignon
c0fff6c8a8 Make Slick regexp more general 2015-08-21 12:30:01 +02:00
Paul Chaignon
e6b4428614 Tests for new vendored files 2015-08-21 12:24:04 +02:00
Paul Chaignon
4e6e69833d Test for new CodeMirror regexp 2015-08-21 12:15:17 +02:00
Paul Chaignon
1d9faff4c6 New JS vendored files 2015-08-21 12:13:42 +02:00
Paul Chaignon
7025cbe760 Fix CodeMirror regex for vendored files 2015-08-21 12:12:52 +02:00
LeonaMorro
e922b7c2ca added *.lslp to samples/LSL folder 2015-08-21 11:44:23 +02:00
LeonaMorro
96518d2d0f added *.lslp as LSL(Linden Scripting Language) 2015-08-21 11:17:12 +02:00
Arfon Smith
1241b20ba1 Merge pull request #2578 from blakeembrey/correct-raml-type
Make RAML a markup language
2015-08-20 20:56:21 +01:00
Ben Balter
f03f5c1628 Merge pull request #2568 from github/licensee
Use Licensee to classify submodule licenses
2015-08-20 15:42:50 -04:00
Ben Balter
cb550a3662 remove some random submodules 2015-08-20 15:30:51 -04:00
Ben Balter
d1f90d61c5 Merge branch 'master' into licensee 2015-08-20 15:25:15 -04:00
Blake Embrey
16e65fe189 Make RAML a markup language
RAML was originally merged as a data language, but this seems like an incorrect definition. I changed it to be markup instead, which will also result in RAML appearing in repo statistics.
2015-08-20 10:07:44 -07:00
Ben Balter
62a0faa729 let us 2015-08-20 12:23:52 -04:00
Ben Balter
fbb3ab2292 batch license test output 2015-08-20 11:38:31 -04:00
Arfon Smith
b3b75e5ef8 Merge pull request #2574 from github/perl-t
Adding Perl/Perl6 heuristic for '.t'
2015-08-20 10:29:52 +01:00
Arfon Smith
8b36210db5 Merge pull request #2573 from a0viedo/patch-1
relativize link in readme
2015-08-20 10:25:02 +01:00
Arfon Smith
a74f3b3e46 Adding Perl/Perl6 heuristic for '.t' 2015-08-20 10:16:52 +01:00
Alejandro Oviedo
e214a52de5 relativize link in readme
...so it could link properly in other branches and forks.
2015-08-19 19:15:05 -03:00
Arfon Smith
0624a9395c Merge pull request #2571 from pchaigno/prolog-grammar
New grammars for Prolog and ECLiPSe
2015-08-19 21:44:13 +01:00
Arfon Smith
b2e7f7ffa6 Merge pull request #2570 from pchaigno/typescript-grammar
New grammar for Typescript
2015-08-19 21:41:15 +01:00
Arfon Smith
b312b39a10 Merge pull request #2572 from pchaigno/rmarkdown-tmscope
TextMate scope for RMarkdown
2015-08-19 21:38:42 +01:00
Paul Chaignon
80e2d112b2 tm_scope for RMarkdown 2015-08-19 22:07:23 +02:00
Paul Chaignon
519b169df0 New grammar for Typescript from Sublime Text package 2015-08-19 21:30:24 +02:00
Paul Chaignon
5c2cfbc334 Remove Typescript grammar 2015-08-19 21:27:40 +02:00
Paul Chaignon
7d91e4959a Dissociate ECLiPSe from Prolog
ECLiPSe syntax is slightly different from Prolog syntax
ECLiPSe is in the Prolog group so it will only be highlighted differently
2015-08-19 20:56:14 +02:00
Paul Chaignon
0c5aa2a7eb Merge branch 'master' into prolog-grammar 2015-08-19 20:46:15 +02:00
Paul Chaignon
0d7a264981 Update submodule for Prolog grammar 2015-08-19 20:43:16 +02:00
Arfon Smith
52ff2d2e74 Merge pull request #2557 from pchaigno/mozilla-public-license
Recognize the Mozilla Public License for grammars
2015-08-19 19:21:33 +01:00
Ben Balter
8a7ceaa845 bump licensee to support ruby 1.9.3 2015-08-19 13:22:31 -04:00
Ben Balter
fd9ce2d1cf use licensee to classify submodule licenses 2015-08-19 12:54:21 -04:00
Paul Chaignon
2c2b37bec3 Reorganize tests
Rename test_memory_blob.rb to test_blob.rb for consistence with last commit
2015-08-19 18:07:42 +02:00
Paul Chaignon
c777f2d388 Merge branch 'master' into blob_in_memory 2015-08-19 18:02:31 +02:00
Paul Chaignon
eca10056a8 Rename MemoryBlob to Blob 2015-08-19 17:29:35 +02:00
Arfon Smith
c7bab11ebe Merge pull request #2566 from github/cut-release-v4.5.14
v4.5.14 version bump
2015-08-19 10:36:52 +01:00
Arfon Smith
6995fc28b6 v4.5.14 version bump 2015-08-19 07:01:07 +01:00
Arfon Smith
102f14d0e9 Grammars update 2015-08-19 06:59:39 +01:00
Arfon Smith
aac168402b Merge pull request #2565 from pchaigno/aspectj-grammar
Grammar for AspectJ
2015-08-19 06:49:16 +01:00
Paul Chaignon
152d49513f Grammar for AspectJ from Sublime Text package 2015-08-19 00:11:34 +02:00
Arfon Smith
d5564c808d Merge pull request #2560 from larsbrinkhoff/sexp
Add .sexp to Common Lisp.
2015-08-18 21:15:46 +01:00
Lars Brinkhoff
82410e07b2 Add .sexp to Common Lisp.
config.sexp by Jeremie Dimino; Apache License 2.0.
rss.sexp by Dan Lentz; LGPL 2.1.
2015-08-18 12:45:47 +02:00
Arfon Smith
94d90b30b5 Merge pull request #2561 from pchaigno/labview-xml
Highlight LabVIEW files as XML
2015-08-18 12:25:38 +02:00
Paul Chaignon
06997f0da2 Fix scope of grammar for LabVIEW 2015-08-14 14:17:32 +02:00
Paul Chaignon
55aafa416d Highlight LabVIEW files as XML 2015-08-14 13:56:28 +02:00
Paul Chaignon
6226a46988 Recognize the Mozilla Public License for grammars 2015-08-13 17:35:01 +02:00
Paul Chaignon
8d216f0c43 Grammar for Prolog from Sublime Text package
MPLv2 License is currently unrecognized
2015-08-13 17:15:04 +02:00
Paul Chaignon
7f5bb25542 Remove grammar for Prolog from TextMate bundle 2015-08-13 16:56:21 +02:00
Arfon Smith
5fcdf6adc2 Merge pull request #2555 from larsbrinkhoff/zone
Add .arpa to DNS Zone.
2015-08-13 10:18:51 +01:00
Lars Brinkhoff
6a565a849b Add .arpa to DNS Zone.
sample.arpa by Freeswitch project; Mozilla Public License 1.1.
2015-08-13 07:38:17 +02:00
Arfon Smith
66fc67e34c Merge pull request #2554 from github/mcandre-master
DNS Zone files
2015-08-12 18:54:04 +01:00
Arfon Smith
7cf140940e Fixing up the build 2015-08-12 17:20:29 +01:00
Arfon Smith
60e90bab23 Removing un-used Bind bundle 2015-08-12 17:06:39 +01:00
Arfon Smith
4f58258186 Removing erroneous submodule 2015-08-12 17:05:57 +01:00
Arfon Smith
03e2904ebf Merge branch 'master' of https://github.com/mcandre/linguist into mcandre-master 2015-08-12 15:15:28 +01:00
Andrew Pennebaker
bea90b256e use st2-zonefile (MIT licensed) instead of Bind.tmbundle (unlicensed) 2015-08-11 14:01:45 -05:00
Arfon Smith
8eb37ba956 Merge pull request #2541 from github/reworking-documentation-paths
Reworking documentation paths
2015-08-11 09:44:19 +01:00
Arfon Smith
8d20c1fb59 More inclusive documentation matches for License and Readme files 2015-08-11 09:39:41 +01:00
Arfon Smith
9a1abf0c49 Merge branch 'master' into reworking-documentation-paths 2015-08-11 09:10:08 +01:00
Arfon Smith
5aae7a4000 Merge pull request #2552 from github/cut-release-v4.5.13
Bumping version to v4.5.13
2015-08-11 07:50:53 +01:00
Arfon Smith
d9509a1750 Bumping version to v4.5.13 2015-08-11 07:01:05 +01:00
Arfon Smith
978c448fb8 Merge pull request #2551 from github/name-checkin
Catching one more edge case
2015-08-11 06:53:25 +01:00
Arfon Smith
997c0fca10 Catching one more edge case 2015-08-11 06:48:54 +01:00
Arfon Smith
3ae6e68492 Merge pull request #2549 from github/name-checkin
Don't blow up if empty string/nil passed to alias methods
2015-08-10 22:17:07 +01:00
Arfon Smith
851c93a1f7 Don't blow up if empty string/nil passed to alias methods 2015-08-10 22:07:28 +01:00
Arfon Smith
a5f7355e16 Merge pull request #2547 from github/grammars
Grammar updates
2015-08-10 15:10:20 +01:00
Arfon Smith
18ffdbaa65 Grammar updates 2015-08-10 15:07:27 +01:00
Arfon Smith
c089222bc6 Merge pull request #2545 from pchaigno/yaml-tmlanguage
YAML extensions for TextMate and Sublime Text grammars
2015-08-10 09:54:20 +01:00
Arfon Smith
37f9535d27 Merge pull request #2546 from ammaraskar/master
Make regex for vim modeline more lenient
2015-08-10 09:53:46 +01:00
Ammar Askar
4650368bc2 Make regex for vim modeline more lenient
This change allows the filetype/language to be retrieved from more complex vim modelines. The current regex strictly allows a set line which contains only the filetype/ft parameter and nothing else
2015-08-10 00:42:14 -05:00
Paul Chaignon
88b14ed455 .syntax extension for YAML 2015-08-09 14:13:48 +02:00
Paul Chaignon
54a2a47bc0 YAML-tmLanguage extension for YAML 2015-08-09 14:11:01 +02:00
Arfon Smith
ffcc970140 Merge pull request #2542 from github/brewfile
Highlight Brewfile as Ruby
2015-08-07 22:26:55 +01:00
Joshua Peek
7a811e39e0 Add sample Brewfile 2015-08-07 14:01:08 -07:00
Joshua Peek
11f158cbb3 Highlight Brewfile as Ruby 2015-08-07 11:12:30 -07:00
Arfon Smith
5d5550c48b Moving vendored definitions to documentation 2015-08-07 10:42:31 +01:00
Arfon Smith
fd570d906a Adding examples path to documentation.yml 2015-08-07 10:35:18 +01:00
Arfon Smith
deab0662f9 Merge pull request #2447 from Ryman/rustup
Split on comma in language name if no match is found
2015-08-07 10:28:21 +01:00
Arfon Smith
7238f50a6b Merge pull request #2539 from rji/puppet-lang-updates
Updates for the Puppet language
2015-08-07 10:25:32 +01:00
Arfon Smith
499fcd1f3f Merge pull request #2540 from pchaigno/makefile.inc
Filename Makefile.inc for Makefile
2015-08-06 09:33:55 +01:00
Paul Chaignon
dc0ddc82d6 Filename Makefile.inc for Makefile 2015-08-06 10:08:30 +02:00
Arfon Smith
436fc34cb9 Merge pull request #2538 from BerkeleyTrue/patch-1
Add codemirror's demo directory
2015-08-06 09:01:01 +01:00
Roger Ignazio
f072cd96e3 Add hiera_include() sample for the Puppet language
Prior to this commit, some Puppet files were being incorrectly
identified as Pascal when they contained only the following content:

  hiera_include('classes')

This commit adds a hiera_include() sample to for the Puppet language to
correct this behavior.
2015-08-05 14:02:09 -07:00
Roger Ignazio
3441a001c7 Modify Puppet color based on style guide
Prior to this commit, the Puppet language was colored to #332A77. The
Puppet Labs style guide (https://puppetlabs.com/styleguide/brand)
specifies Puppet Dark Purple to be #302B6D. Alternately, Puppet Purple,
a lighter variant, may be used: #7C6AAB.

Keeping with the dark purple theme, this commit modifies the Puppet
language to use Puppet Dark Purple, hex #302B6D.
2015-08-05 14:00:08 -07:00
Berkeley Martinez
bc747844ea Add codemirror's demo directory
This accounts for about ~150 html files throwing off the statistics of one of my projects
2015-08-05 12:22:21 -07:00
Arfon Smith
a887f58bcc Merge pull request #2537 from imsys/xbase-extra
#2504 - xBase aliases and extension .prw
2015-08-05 14:06:24 +01:00
Arthur Helfstein Fragoso
f42afef6e0 order - .prw should come after .ch
1) Failure:
TestPedantic#test_extensions_are_sorted
[/home/arthur/Projects/linguist/test/test_pedantic.rb:15]:
.prw should come after .ch
2015-08-05 05:58:02 -03:00
Arthur Helfstein Fragoso
18eaf22cb9 Added xBase/AdvPL sample file 2015-08-05 05:19:41 -03:00
Arthur Helfstein Fragoso
d94f427e12 xBase: Add aliases and extension .prw
xBase: Add aliases:
* advpl
* clipper
* foxpro

And the extension .prw
2015-08-05 05:06:11 -03:00
Arfon Smith
b94eb42db6 Merge pull request #2536 from github/slim-grammar
Adding Slim tm_scope
2015-08-04 22:04:25 +01:00
Arfon Smith
d2297f5516 Adding Slim tm_scope 2015-08-04 21:56:11 +01:00
Arfon Smith
ef6f58b828 Merge pull request #2535 from pchaigno/heuristics-case-insensitive
Case-insensitive extension match for heuristic rules
2015-08-04 21:35:54 +01:00
Paul Chaignon
eb0bf16cce Case-insensitive extension match for heuristic rules 2015-08-04 17:28:52 +02:00
Arfon Smith
ca51415540 Merge pull request #2534 from github/cut-release-v4.5.11
Bumping version to v4.5.11
2015-08-04 14:05:10 +01:00
Arfon Smith
8ae32e1d47 Bumping version to v4.5.11 2015-08-04 13:29:52 +01:00
Arfon Smith
0a6165c4d9 Updating csharp scopes 2015-08-04 13:27:21 +01:00
Arfon Smith
cf8521a629 Grammar updates 2015-08-04 13:18:27 +01:00
Arfon Smith
b11c7f3dc0 Merge pull request #2513 from yyx990803/master
add syntax highlight for *.vue component files
2015-08-04 12:47:12 +01:00
Arfon Smith
01151aad5c Merge pull request #2533 from github/rrebol
Adding back R/Rebol heuristics
2015-08-04 12:45:44 +01:00
Arfon Smith
6b283068a9 Adding back R/Rebol heuristics 2015-08-04 12:20:15 +01:00
Arfon Smith
ccd7d4d89d Merge pull request #2532 from github/heuristic-fixes
Fixing up some new heuristics
2015-08-04 12:11:17 +01:00
Arfon Smith
208ec3906f Fixing up some new heuristics 2015-08-04 12:06:41 +01:00
Arfon Smith
84d4fccb4d Merge pull request #2441 from pchaigno/associate-heuristic-with-extension
Associate heuristic rules with file extensions
2015-08-04 12:00:47 +01:00
Arfon Smith
8d8ea959ee Merge pull request #2527 from radeksimko/hcl-as-ruby
Parse HCL as Ruby, not JavaScript
2015-07-30 14:42:46 +01:00
Radek Simko
1c73db499f Parse HCL as Ruby, not JavaScript 2015-07-30 11:31:06 +01:00
Arfon Smith
16a4b4947f Merge pull request #2526 from github/cut-releasev4.5.10
Bumping to v4.5.10
2015-07-29 15:21:31 +01:00
Arfon Smith
4b2abb2064 Bumping to v4.5.10 2015-07-29 14:50:11 +01:00
Arfon Smith
c581b6a5a7 Merge pull request #2525 from github/grammars-update
Grammars update
2015-07-29 14:37:08 +01:00
Arfon Smith
4c66582f87 Grammars update 2015-07-29 14:27:35 +01:00
Arfon Smith
11388a5355 Merge pull request #1899 from sethvargo/patch-1
Add HCL to languages.yml
2015-07-29 14:14:38 +01:00
Arfon Smith
24ca98b1a3 Merge pull request #2524 from github/more-encompassing-number-skips
More encompassing number skips
2015-07-29 14:07:04 +01:00
Arfon Smith
90a293727d Merge branch 'master' into more-encompassing-number-skips 2015-07-29 13:54:51 +01:00
Arfon Smith
e869f6c173 Merge pull request #2438 from edm00se/master
add support for XPages
2015-07-25 17:52:01 +01:00
Evan You
5b187d1f20 update vue-syntax-highlight version 2015-07-24 23:40:43 -04:00
Evan You
7b5d1c075d add syntax highlight for *.vue component files 2015-07-21 18:51:55 -04:00
Arfon Smith
07173d2238 Merge pull request #2515 from github/xbase-ch
xBase .ch
2015-07-21 15:26:45 +01:00
Arfon Smith
6b747f7d65 Adding Charity and heuristic for xBase .ch files 2015-07-21 14:59:47 +01:00
Arfon Smith
aef19d72f9 Merge branch 'master' into xbase-ch 2015-07-21 13:55:59 +01:00
Arfon Smith
e1a661bffc Merge pull request #2506 from hdgarrood/master
Use a different grammar for PureScript
2015-07-21 13:37:05 +01:00
Arfon Smith
560f9b15d7 Merge pull request #2510 from joelparkerhenderson/master
Add documentation categorization for CHANGELOG et. al.
2015-07-20 16:30:57 +01:00
Paul Chaignon
452fc59d4f Merge branch 'master' into associate-heuristic-with-extension 2015-07-20 13:08:13 +02:00
ziggi
ed4bbe97d1 Back to uppercase name 2015-07-20 12:07:27 +03:00
ziggi
f05c437221 Update submodule 2015-07-20 10:05:11 +03:00
Joel Parker Henderson
682cc2d82d Add documentation categorization for CHANGELOG et. al. 2015-07-19 19:36:12 -06:00
Harry Garrood
29197736c7 Use a different grammar for PureScript 2015-07-19 09:18:09 +01:00
ziggi
483488a2fa Add .inc extension for Pawn 2015-07-18 03:55:51 +03:00
ziggi
b36c4f2428 TextMate for Pawn 2015-07-18 03:27:07 +03:00
Arfon Smith
e1dbd68713 Merge branch 'master' of github.com:github/linguist 2015-07-16 14:43:21 -07:00
Arfon Smith
0ecb865797 Merge branch 'rpavlick-master' 2015-07-16 14:40:52 -07:00
Arfon Smith
1ced06483e Merge branch 'master' of https://github.com/rpavlick/linguist into rpavlick-master 2015-07-16 14:40:21 -07:00
Garen Torikian
861cee33d5 Merge pull request #2502 from vszakats/patch-1
CONTRIBUTING.md: minor URL cleanups
2015-07-15 15:40:51 -07:00
Viktor Szakats
6b882438b0 CONTRIBUTING.md: minor URL cleanups
use `https://` and `.svg`, follow a redirect.
2015-07-15 13:39:27 +02:00
Arfon Smith
c570646c2d Merge pull request #2500 from github/cut-release-v4.5.9
Cut release v4.5.9
2015-07-14 16:22:23 -07:00
Arfon Smith
75f72578ad Bumping version to v4.5.9 2015-07-14 08:59:32 -07:00
Arfon Smith
4dc566e13f Updating OpenEdge-ABL grammars 2015-07-14 08:58:59 -07:00
Arfon Smith
bcfdbe3616 Grammars update 2015-07-14 08:56:44 -07:00
Arfon Smith
314b7f134d Merge pull request #2499 from vszakats/xgramm
add grammar for xbase and harbour languages
2015-07-14 08:48:24 -07:00
Eric McCormick
87eb4577ea trying this again 2015-07-13 21:31:02 -05:00
Eric McCormick
7563bf43e9 Revert "removed samples"
This reverts commit ce8cfed7ff.
2015-07-13 21:28:36 -05:00
Eric McCormick
ce8cfed7ff removed samples 2015-07-13 21:22:54 -05:00
Eric McCormick
8742de9a88 pulling .xsp, .form, .view from PR
Per comment in [PR 2438](https://github.com/github/linguist/pull/2438#issuecomment-120588670), pulling all but .xsp-config and .xsp.metadata for uniqueness and non-overlapping assignment based on file extension. This should be set / overridden in the `.gitattributes` file, [as demonstrated here](https://github.com/edm00se/AnAppOfIceAndFire/blob/master/.gitattributes), to assign the XPages language to the project files.
2015-07-13 21:11:06 -05:00
Arfon Smith
9c0af2ea5b Merge pull request #2488 from github/code-of-conduct
Add code of conduct to contributing guidelines
2015-07-13 15:14:20 -07:00
Viktor Szakats
4c81c0d904 add grammar for xbase and harbour languages 2015-07-13 15:28:42 +02:00
Viktor Szakats
4dcdb0c79c xBase: add .ch extension + sample 2015-07-13 10:32:08 +02:00
Paul Chaignon
5a646384f6 FileBlob extends MemoryBlob 2015-07-12 20:56:51 +02:00
Paul Chaignon
8917f1a91a MemoryBlob class: wrapper around the content of a file
Makes it possible to detect the language of a snippet of code
without having an actual file on disk
Will allow github-markup to use Linguist without restricting its API
2015-07-12 20:28:42 +02:00
Arfon Smith
d459f7289e Merge pull request #2493 from miek/patch-1
Add .kicad_pcb extension for KiCad PCB design files
2015-07-12 13:44:17 +01:00
Arfon Smith
d2c4104d30 Merge pull request #2494 from k2b6s9j/crystal-grammar
Use a Crystal grammar over the Ruby grammar for Crystal files.
2015-07-12 13:42:53 +01:00
Kepler Sticka-Jones
89fabd9a89 Use a Crystal grammar over the Ruby grammar for Crystal files.
The Crystal does have several little differences which distinguish it from Ruby. Thus it needs it's own grammar.
2015-07-11 09:24:22 -07:00
Mike Walters
3f7ce832ab Add .kicad_pcb extension for KiCad PCB design files 2015-07-11 16:34:05 +01:00
Arfon Smith
3fdc904b18 Merge pull request #2487 from thorade/issue2486_Modelica
more samples for Modelica language,
2015-07-11 07:59:48 +01:00
Arfon Smith
cf471af677 Merge pull request #2483 from github/cut-release-v4.5.8
v4.5.8 release
2015-07-10 22:57:07 +01:00
rpavlick
2d392581e2 adding NCL language 2015-07-09 07:17:01 -07:00
Arfon Smith
79a428ab8d Merge pull request #2180 from pchaigno/inc-extension
.inc file extension
2015-07-08 19:25:50 +01:00
Brandon Keepers
7ed1b9b0b1 Add code of conduct to contributing guidelines 2015-07-08 14:10:59 -04:00
thorade
58fd8a5d87 more samples for Modelica language,
see issue #2486
2015-07-07 12:40:37 +02:00
Paul Chaignon
9f8c15ed6c Merge branch 'master' into inc-extension 2015-07-05 14:45:35 +02:00
Paul Chaignon
b94eda18ab New .inc Pascal samples 2015-07-05 12:48:22 +02:00
Paul Chaignon
849eb28b01 New .inc SourcePawn samples 2015-07-05 12:48:12 +02:00
Paul Chaignon
b0073d461c New .inc C++ samples 2015-07-05 12:47:57 +02:00
Paul Chaignon
25d160e850 Merge branch 'master' into associate-heuristic-with-extension 2015-07-04 23:03:32 +02:00
Paul Chaignon
e688c865bc Merge branch 'master' into associate-heuristic-with-extension 2015-07-04 22:48:06 +02:00
Arfon Smith
21e97cc65c Merge pull request #2170 from pchaigno/mod-extension
.mod extension
2015-07-04 20:57:40 +01:00
Paul Chaignon
06c1033952 Fix error from merge conflicts 2015-07-04 18:04:19 +02:00
Paul Chaignon
8c54f68040 Fix conflicts from merging master into 'mod-extension' 2015-07-04 18:01:56 +02:00
Arfon Smith
4c1f5c490f Merge pull request #2484 from pchaigno/fix-g-code-samples
Remove incorrect G-code samples
2015-07-04 16:58:42 +01:00
Arfon Smith
117735ffb9 Merge pull request #2179 from pchaigno/symlinks
Ignore symbolic links
2015-07-04 16:57:43 +01:00
Paul Chaignon
f98e6bdac7 Use proper format for symlinks, submodules and trees 2015-07-04 17:14:30 +02:00
Paul Chaignon
19d76306d3 Remove incorrect samples 2015-07-04 12:33:41 +02:00
Arfon Smith
a63a609ce1 v4.5.8 release 2015-07-04 10:36:45 +01:00
Arfon Smith
95fce2024d Merge pull request #2482 from github/grammar-updates
Grammar updates
2015-07-04 07:02:29 +01:00
Arfon Smith
f3b65015f4 Grammar updates 2015-07-04 06:55:51 +01:00
Arfon Smith
5431298b0d Merge pull request #2481 from github/1823-local
Isabelle ROOT support (updated PR)
2015-07-04 06:19:02 +01:00
Arfon Smith
8f651bca03 Adding PHP sample file for completeness 2015-07-04 06:01:06 +01:00
Arfon Smith
6c45e5ec19 Merge branch 'master' into 1823-local 2015-07-04 05:46:23 +01:00
Arfon Smith
95d394642c Merge pull request #2478 from mattn/perl-test-more
Append Test::More into strict.t
2015-07-04 05:32:30 +01:00
mattn
6a185a3d3a remove some text contents from test.pl since it affect to heuristic search. 2015-07-04 02:29:01 +09:00
Arfon Smith
6ae353706d Merge pull request #2479 from SRI-CSL/master
SMT-LIB language support
2015-07-01 14:10:28 -05:00
Ian A. Mason
77bc72be14 Added an ace mode, and put the SMT entry in the correct place, maybe. 2015-07-01 11:22:04 -07:00
Bruno Dutertre
0585c880de Example smt2 files 2015-07-01 10:38:17 -07:00
mattn
da5189e7fb Append Test::More into strict.t. Because, most of tap scripts on Perl5 are detected as Perl6. 2015-07-01 16:23:38 +09:00
Ian A. Mason
5f456d8b22 Some part way through the adding a language checklist. 2015-06-30 15:29:02 -07:00
Vicent Marti
a351cdd486 Merge pull request #2477 from github/vmg/release-4.5.7
Rrelease 4.5.7
2015-06-30 14:58:18 +02:00
Arfon Smith
6e71663fd6 Merge pull request #2463 from pchaigno/doc-add-extension
Instructions to add a new extension to a language
2015-06-29 21:18:47 -05:00
Arfon Smith
0b2e43cdee Merge pull request #2457 from drewcrawford/master
Adding some more vendered expressions
2015-06-29 21:16:08 -05:00
Paul Chaignon
9cbd280f79 New .inc SourcePawn sample 2015-06-28 16:05:47 +02:00
Paul Chaignon
947be9db0f New .inc Pascal sample 2015-06-28 15:54:25 +02:00
Paul Chaignon
dd55f929d4 New .inc HTML sample 2015-06-28 15:27:59 +02:00
Paul Chaignon
8b5399d568 New C++ .inc sample 2015-06-28 14:33:54 +02:00
Paul Chaignon
1b8b0c6229 New .inc Assembly samples 2015-06-28 13:24:42 +02:00
Vicent Marti
ee3081fb4c Bump to 4.5.7 2015-06-26 03:34:18 -07:00
Vicent Marti
119770a038 Update grammars 2015-06-26 03:33:37 -07:00
Vicent Marti
9d61487403 gemspec: Loosen up the restriction on Rugged betas 2015-06-26 03:11:31 -07:00
Paul Chaignon
56dec47561 Merge branch 'master' into inc 2015-06-21 14:20:53 +02:00
Paul Chaignon
3e793ab5b7 Precision on requirements to add a language 2015-06-21 10:07:18 +02:00
Garen Torikian
f6b50a67f9 Change Haxe and Ragel colors to pass tests 2015-06-20 09:55:33 -07:00
Zalim Bashorov
cd47798d13 try to fix conflicts 2015-06-20 09:49:51 -07:00
Zalim Bashorov
3b54df2cde Change color for Kotlin based on color in logo
IMHO it's more suitable.
2015-06-20 09:49:51 -07:00
Paul Chaignon
8bf1defdc1 Merge branch 'master' into associate-heuristic-with-extension
Conflicts:
	lib/linguist/heuristics.rb
2015-06-18 21:54:59 +02:00
Drew Crawford
8845b266de Adding some more vendered expressions
* `Vendor/`, the capitalized path
* Crashlytics, a common iOS framework
* Fabric, a common iOS framework
2015-06-17 21:25:54 -05:00
Arfon Smith
4757da73f0 Merge pull request #2456 from github/cut-release-v4.5.6
Cut release v4.5.6
2015-06-17 09:45:38 -05:00
Arfon Smith
468fd425fc Bumping to v4.5.6 2015-06-17 09:03:29 -05:00
Arfon Smith
5604d658b2 Bringing dart scopes up to date 2015-06-17 08:59:27 -05:00
Arfon Smith
37222d5622 Updating grammars 2015-06-17 08:54:56 -05:00
Arfon Smith
ec38b54023 Merge pull request #2449 from larsbrinkhoff/picolisp
Add PicoLisp language
2015-06-16 09:10:21 -05:00
Lars Brinkhoff
260e90401d Add samples for .l.
array.l by NANRI southly; MIT license.
simul.l by Alexander Burger; MIT license.
2015-06-16 06:51:58 +02:00
Lars Brinkhoff
8c66f0a5da Heuristic for PicoLisp. 2015-06-16 06:51:58 +02:00
Lars Brinkhoff
78efc2d0de Add PicoLisp language. 2015-06-16 06:51:57 +02:00
Arfon Smith
656c1e6ba6 Merge branch 'rneatherway-move-fsharp-grammar' 2015-06-15 16:09:19 -05:00
Arfon Smith
65e932016b Merge branch 'move-fsharp-grammar' of https://github.com/rneatherway/linguist into rneatherway-move-fsharp-grammar 2015-06-15 16:08:07 -05:00
Arfon Smith
fc602b1d42 Merge pull request #2383 from larsbrinkhoff/troff
More file extensions for Groff
2015-06-15 15:40:45 -05:00
Lars Brinkhoff
0e882900d7 Samples for .ms.
hello.ms by FSF; GPL license.
fsinterface.ms by the NetBSD project; BSD license.
2015-06-15 07:18:43 +02:00
Lars Brinkhoff
28103ee25b Add .ms to GAS. 2015-06-15 07:18:43 +02:00
Lars Brinkhoff
0a0d2ddb1a Heuristics for Groff and Nemerle. 2015-06-15 07:18:43 +02:00
Lars Brinkhoff
3bf4cb721e Add .n Groff sample.
From the Tcl/Tk project; BSD-like license.
2015-06-15 07:18:43 +02:00
Lars Brinkhoff
ba1ab64b56 More Groff file extensions. 2015-06-15 07:18:43 +02:00
Paul Chaignon
786d1e4cfc Instructions to add a new extension to a language 2015-06-12 21:22:55 +02:00
Arfon Smith
eb82e022ba Merge pull request #2443 from wcandillon/patch-4
Improved XQuery and JSONiq support
2015-06-12 11:35:53 -05:00
William Candillon
753bfd1dc5 ⬆️ 2015-06-11 19:07:19 +02:00
Kevin Butler
bc8d65e7d3 Add 1.0 rust sample and add file with extern crate usage 2015-06-10 17:58:36 +01:00
Kevin Butler
3180c5d554 Allow delimiting by comma in the language name 2015-06-10 15:37:31 +01:00
Robin Neatherway
6b11655db8 Switch to using atom-fsharp language definition
The previous definition used at fsharpbinding is no longer maintained.
That repository has been split into separate parts for each editor. Atom
now has the most complete compatible grammar.
2015-06-09 18:07:51 +01:00
William Candillon
d1ae098c08 ⬆️ 2015-06-08 15:22:32 +02:00
William Candillon
e1a8b5db1d 🆕 XQuery & JSONiq support based on the Atom language-jsoniq package 2015-06-08 14:50:28 +02:00
William Candillon
302cfea295 Update languages.yml 2015-06-08 14:32:07 +02:00
Paul Chaignon
be122ca1a5 Fix test for Perl heuristic
Improve heuristic rule for Perl6
Separate heuristic rules for .pl (with Prolog) and .pm (without Prolog)
2015-06-06 19:55:04 +02:00
Paul Chaignon
b05f6f0018 Test for the new heuristic definitions 2015-06-06 18:49:36 +02:00
Paul Chaignon
e811021806 Fix tests to use the correct extension in heuristic rules
Extand a few tests where only one file was tested for a language
2015-06-06 18:27:59 +02:00
Paul Chaignon
656f4f440d Several extensions can be associated to a heuristic rule 2015-06-06 17:44:02 +02:00
Paul Chaignon
7fb62de4d7 Associate each heuristic rule to a file extension 2015-06-06 15:37:41 +02:00
Garen Torikian
0946fecd82 Merge pull request #2439 from alexweber/patch-1
fix anchor link to vim & emacs modelines section
2015-06-05 09:43:21 -07:00
Eric McCormick
26a5325dc3 undoing color
apparently a bad idea, Travis CI didn't like it
2015-06-05 11:04:34 -05:00
Alex Weber
9afdcddfc9 fix anchor link to vim & emacs modelines section
regression introduced in 5382c1b795
2015-06-05 12:53:15 -03:00
Eric McCormick
4881e0aa51 added color to languages.yml 2015-06-05 10:36:40 -05:00
Eric McCormick
743f7c76de resorted entry in languages.yml to be consistent with other blocks 2015-06-05 06:19:02 -05:00
Eric McCormick
f8ef01f557 updated tm_scope to none in languages.yml
It looks like it helps to read the comments at the top of the file, who knew!
2015-06-05 06:13:36 -05:00
Eric McCormick
402fa5c2cd added navbar.xsp, xsp-config, xsp.metadata for completeness of file extensions and corrected xsp.metadata extension in languages.yml 2015-06-04 22:51:55 -05:00
Eric McCormick
5ac1e847a5 samples added for XPages design elements (.xsp) and affiliated NSF-based elements (.form, .view)
- demoServerRESTconsumption, src: https://gist.github.com/edm00se/15249dba8ff3fea38312, license: Creative Commons 3.0
- house.form, houses.view, house.xsp, src: https://github.com/edm00se/AnAppOfIceAndFire, license: Creative Commons 3.0
- UnpMainxsp, src: https://github.com/teamstudio/xcontrols-domino/blob/master/sampler-app/XPages/UnpMain.xsp, license: Apache v2.0
- xLogin.xsp, src: http://openntf.org/XSnippets.nsf/snippet.xsp?id=xpages-form-login-with-session-variable, license: Apache 2.0
2015-06-04 22:09:49 -05:00
Eric McCormick
0737a21e38 XPages added as programming language
XPages design element extensions and NSF-based design elements (Form, View) extensions added (all readable when marked up using XML settings for ACE); .jss (Domino SSJS) already aliased under JavaScript
2015-06-04 21:37:58 -05:00
Arfon Smith
4d162f88bd Merge pull request #2432 from jakepetroules/qbs
.qbs extension for QML.
2015-06-04 11:45:16 -05:00
Jake Petroules
2806987f2f .qbs extension for QML. 2015-06-02 00:46:56 -07:00
Arfon Smith
f380aa2e5e Merge pull request #2426 from tamird/generated-go-bindata
Detect Go files generated by go-bindata
2015-05-31 15:53:49 +02:00
Arfon Smith
a2ce1972ec Merge pull request #2429 from larsbrinkhoff/kbuild
Make filename: Kbuild
2015-05-31 15:51:51 +02:00
Arfon Smith
aa8cf7e6bb Merge pull request #2431 from pchaigno/al-perl
New .al extension for Perl
2015-05-31 15:49:53 +02:00
Paul Chaignon
ec61a6974f .al extension for Perl 2015-05-30 15:07:56 +02:00
Lars Brinkhoff
21e249bd2c Add makefile sample.
Kbuild by Sam Ravnborg; GPL 2 license.
2015-05-29 09:22:26 +02:00
Lars Brinkhoff
8e550f7093 'Kbuild' is a common makefile name. 2015-05-29 07:18:31 +02:00
Arfon Smith
53e53880bd Merge pull request #2419 from evgenyneu/master
Treat Carthage path as vendored
2015-05-28 13:33:47 -05:00
Arfon Smith
671b5788ed Merge pull request #2413 from yegortimoschenko/jruby-executable
Add JRuby executable example, fixes #2412
2015-05-28 10:27:53 -05:00
Arfon Smith
76d10cd85c Merge pull request #2422 from CalebFenton/master
Add Smali language
2015-05-28 10:17:48 -05:00
Arfon Smith
42c155d667 Merge pull request #2425 from larsbrinkhoff/fix-rust
Fix Rust heuristic.
2015-05-28 10:16:24 -05:00
Tamir Duberstein
d17222ec91 Detect Go files generated by go-bindata 2015-05-28 11:03:36 -04:00
Tamir Duberstein
a1ea55d006 Trim whitespace 2015-05-28 11:03:36 -04:00
Tamir Duberstein
f32b7bb978 Fix duplicate key warning 2015-05-28 11:03:36 -04:00
Lars Brinkhoff
38aa7bae3f Fix Rust heuristic. 2015-05-28 07:10:25 +02:00
Caleb Fenton
0021b9532b Update Smali submodule 2015-05-27 11:19:29 -07:00
Caleb Fenton
788fac7c43 Add Smali language 2015-05-27 10:37:17 -07:00
Arfon Smith
71934152e4 Merge pull request #2378 from Mailaender/patch-1
Added support for .mdpolicy XML files
2015-05-27 08:41:22 -05:00
Matthias Mailänder
e20d6fc04a add .mdpolicy XML files 2015-05-23 21:32:17 +02:00
Evgenii Neumerzhitckii
a1e8fc4f97 Treat Carthage path as vendored 2015-05-23 21:54:25 +10:00
Yegor Timoschenko
9dc8a10e2a Use real-world samples for JRuby and Rubinius executables
https://github.com/shoes/shoes4/blob/master/shoes-swt/bin/shoes-swt
https://github.com/txus/rexpl/blob/master/bin/rexpl
2015-05-23 05:36:26 +00:00
Yegor Timoschenko
43a2da46f9 Add jruby and rbx interpreters for Ruby 2015-05-21 19:35:45 +00:00
Yegor Timoschenko
f95ca13073 Add JRuby executable example, fixes #2412 2015-05-21 18:56:38 +00:00
Arfon Smith
b92b3af602 Merge pull request #2390 from larsbrinkhoff/lex-yacc
Add Lex and Yacc languages
2015-05-21 12:47:08 -05:00
Arfon Smith
83b76cde34 Merge pull request #2203 from pchaigno/vhost-nginx
.vhost as a Nginx extension
2015-05-21 11:34:45 -05:00
Arfon Smith
5ff0d488d2 Merge pull request #2392 from vighnesh1987/apache-thrift
Add Apache thrift support to generated? check
2015-05-20 12:43:55 -05:00
Arfon Smith
f89adf6e53 Merge pull request #2410 from SimenB/iml
Display IntelliJ configurations files as XML
2015-05-20 12:34:14 -05:00
Simen Bekkhus
efd34d8cb0 Display IntelliJ configurations files as XML
Fixes #2409
2015-05-20 14:18:01 +02:00
Lars Brinkhoff
3defb60fd7 Add .l samples.
zend_ini_scanner.l by Zend Technologies; New BSD license.
common.l by Toshihiro MATSUI, Electrotechnical Laboratory; New BSD license.
create_view.l by PostgreSQL Global Development Group; MIT license.
2015-05-20 08:16:26 +02:00
Lars Brinkhoff
869c9d2fdd Add .l to Groff. 2015-05-20 08:16:26 +02:00
Lars Brinkhoff
912e465193 Add .l to Common Lisp. 2015-05-20 08:16:26 +02:00
Lars Brinkhoff
e7c1419390 Add Yacc language. 2015-05-20 08:16:26 +02:00
Lars Brinkhoff
b19cd037b7 Add Lex language. 2015-05-20 08:16:26 +02:00
Arfon Smith
42f7bc2160 Merge pull request #2407 from github/welcome-back-handlebars
Adding back Handlebars grammar
2015-05-19 15:44:38 -05:00
Arfon Smith
542a0d79fd Adding back Handlebars grammar 2015-05-19 13:27:37 -05:00
Arfon Smith
4b9b09f7bf Merge pull request #2405 from github/fix-handlebars-grammar
Fix Handlebars grammar
2015-05-19 10:46:21 -05:00
Adam Roben
57429f3194 Don't warn if a package contains multiple copies of a grammar
This is pretty common (e.g., if the package contains the grammar in both
XML and JSON).
2015-05-19 09:27:13 -04:00
Adam Roben
9bdf890fd8 Fix nil NoMethodError when converting a duplicated grammar
We were sticking a nil value into the grammars Array when we encountered
a duplicate scope. Now we strip out nils before returning the Array.
2015-05-19 09:27:13 -04:00
Arfon Smith
9240f30f28 Merge pull request #2401 from github/cut-release-v4.5.5
Cut release v4.5.5
2015-05-18 16:15:40 -05:00
Arfon Smith
6062d3b25c Temporarily removing Handlebars highlighting 2015-05-18 14:41:36 -05:00
Arfon Smith
3878afa2e0 Bumping to v4.5.5 2015-05-15 10:56:36 -05:00
Arfon Smith
fa8998c6b6 Fixing up grammars 2015-05-15 10:55:50 -05:00
Arfon Smith
99dcd501aa Grammars update 2015-05-15 10:50:05 -05:00
Vighnesh Rege
ed23c6ef75 Fixed broken file reference 2015-05-13 23:22:24 -07:00
Vighnesh Rege
90b59876d0 Added extension restrictions 2015-05-13 23:20:51 -07:00
Arfon Smith
da7d019df3 Merge pull request #2388 from mephaust/add-unity3d
Add Unity3D Asset and Metadata files
2015-05-13 16:02:30 -05:00
Paul Handly
4fc0c90cff Add Unity3D Asset samples 2015-05-13 15:59:11 -04:00
Arfon Smith
4ecb6425d2 Merge pull request #2373 from pchaigno/remove-unused-grammars
Remove unused grammars/submodules
2015-05-13 09:50:32 -05:00
Arfon Smith
6dfab80df7 Merge pull request #2394 from github/vim-modeline-fix
Improving Vim modeline regex
2015-05-13 09:03:43 -05:00
Arfon Smith
1ebf1e77e5 Merge pull request #2387 from aivus/patch-1
Change PHP group to HTML for TWIG
2015-05-13 09:03:35 -05:00
Arfon Smith
0c810cc016 Merge pull request #2393 from KrauseFx/patch-1
Added fastlane configuration files
2015-05-13 08:45:23 -05:00
Arfon Smith
7e32b45aa8 Removing whitespace matching 2015-05-13 08:31:45 -05:00
Felix Krause
4c1a84716a Merge branch 'master' into patch-1 2015-05-13 11:03:13 +01:00
Felix Krause
fd4111cdbe Added Example Ruby Files 2015-05-13 11:02:26 +01:00
Arfon Smith
2fac182a90 Improving Vim modeline regex 2015-05-12 16:49:14 -05:00
Vighnesh Rege
6d2aa601cd Added tests 2015-05-12 12:53:59 -07:00
Felix Krause
f87c3c4996 Added fastlane configuration files
[fastlane](https://fastlane.tools) is an established Continuous Delivery solution for iOS/Mac projects. The configuration files are similar to a `Podfile`, also Ruby based. 

Some examples:
- https://github.com/wikimedia/apps-ios-wikipedia/blob/master/fastlane/Fastfile
- https://github.com/wikimedia/apps-ios-wikipedia/blob/master/fastlane/Deliverfile
- https://github.com/artsy/eidolon/blob/master/fastlane/Fastfile
- https://github.com/fastlane/examples/blob/master/MindNode/Fastfile

The configuration files added with this pull request: `Fastfile`, `Deliverfile` and `Snapfile` 👍
2015-05-12 20:29:24 +01:00
Vighnesh Rege
1811465abb Add Apache thrift support to generated? check 2015-05-12 12:25:06 -07:00
Paul Handly
7631db2183 Treat Unity3D metadata as an asset 2015-05-10 18:19:34 -04:00
Paul Handly
da5bc18d64 Add Unity3D Metadata files as generated 2015-05-10 18:19:33 -04:00
Paul Chaignon
0c2aeae00d .inc extension for PHP, Pascal, Assembly, SQL, C++, HTML and SourcePawn 2015-05-10 20:36:41 +02:00
Paul Handly
f2af2156fa Add language for Unity3D Asset files 2015-05-09 14:15:59 -04:00
Arfon Smith
5bf8cf50ae Merge pull request #2386 from larsbrinkhoff/modeline
Vim and Emacs modelines are two alternatives
2015-05-06 15:55:36 -05:00
Ilya Antipenko
dc22b0f869 Change PHP group to HTML for TWIG 2015-05-06 20:41:37 +03:00
Lars Brinkhoff
5382c1b795 Make it more clear that Vim and Emacs modelines are two alternatives. 2015-05-06 07:46:42 +02:00
Arfon Smith
dbe851726e Merge pull request #2368 from m-click/geography-markup-language
Add languages.yml entry and sample files for OGC Geography Markup Language (#2366)
2015-05-05 08:18:37 -05:00
Arfon Smith
3720e49618 Merge pull request #2372 from pchaigno/use-original-ada-grammar
Use original Ada grammar
2015-05-05 08:17:38 -05:00
Paul Chaignon
a4f187efd2 Merge branch 'master' into vhost-nginx 2015-05-04 21:58:22 +02:00
Paul Chaignon
b6ee02f313 Merge branch 'master' into mod-extension 2015-05-04 21:44:23 +02:00
Paul Chaignon
380a51e4a4 Merge branch 'master' into use-original-ada-grammar 2015-05-04 21:35:40 +02:00
Arfon Smith
459b1034a7 Merge pull request #2363 from danielgtaylor/master
Add support for API Blueprint
2015-05-04 09:47:11 -05:00
Arfon Smith
c2f567770c Merge pull request #2375 from mbdoud/master
Add HyPhy as language to Linguist
2015-05-04 08:17:33 -05:00
Andrew Pennebaker
03369b8a6c use https url for travis support 2015-05-03 12:51:52 -05:00
Volker Grabsch
c94c908d5d Add languages.yml entry and sample files for OGC Geography Markup Language (#2366) 2015-05-03 19:15:54 +02:00
Mike Doud
585d74ecc9 add better HyPhy samples 2015-05-02 13:24:43 -07:00
Arfon Smith
d8422e63f6 Merge pull request #2374 from pchaigno/travis-submodules-ssh
Handle SSH links to submodules in Travis
2015-05-02 06:38:28 -05:00
Paul Chaignon
ca12a99970 Handle SSH links to submodules 2015-05-01 21:03:02 +02:00
Mike Doud
1fdcafb1ae Update languages.yml 2015-05-01 11:28:11 -07:00
Andrew Pennebaker
3b2ddb1a18 classify DNS zone as a data format 2015-05-01 11:25:16 -05:00
Paul Chaignon
2eede37248 Remove unused grammars/submodules 2015-05-01 17:28:34 +02:00
Paul Chaignon
6489f7009d Use original repository for Ada grammar 2015-05-01 16:42:37 +02:00
Paul Chaignon
bdfe2aa6e4 Remove grammar for Ada 2015-05-01 16:39:48 +02:00
Mike Doud
007de4691b removing incorrect samples 2015-04-30 16:07:19 -07:00
Mike Doud
141e495447 Merge branch 'master' of https://github.com/mbdoud/linguist 2015-04-30 15:38:12 -07:00
Mike Doud
5e68714ae5 add HyPhy examples 2015-04-30 15:37:59 -07:00
Mike Doud
4ae6455e0e Update languages.yml 2015-04-30 15:25:04 -07:00
Mike Doud
f393ea307d Add 'HyPhy Batch Language' 2015-04-30 15:14:53 -07:00
Andrew Pennebaker
1e20b12241 zone: add ace_mode 2015-04-30 15:40:44 -05:00
Andrew Pennebaker
81c41df15c zone: add tm_scope 2015-04-30 15:39:32 -05:00
Andrew Pennebaker
8b736189e0 better name for DNS zone 2015-04-30 15:34:43 -05:00
Andrew Pennebaker
188d2367df add sample zone file 2015-04-30 15:25:52 -05:00
Andrew Pennebaker
5aeac500da list zone in grammars.yml 2015-04-30 15:24:46 -05:00
Andrew Pennebaker
5730ab28ab list zone in languages.yml 2015-04-30 15:23:31 -05:00
Andrew Pennebaker
1c56b03a28 highlight DNS zone (BIND) files 2015-04-30 15:14:26 -05:00
Daniel G. Taylor
828fc7a19b Add support for API Blueprint
This adds a grammar and samples for [API Blueprint][] based on the
[Sublime Text plugin][] from Apiary. The [Atom language][] is also based
on the Sublime plugin.

API Blueprint is now used in over [3,600 repositories][] on GitHub and has
[several][Aglio] [open source][Dredd] [tools][Drakov] available.

Here's an [example using Lightshow][Lightshow] to highlight a small API.

[3,600 repositories]: https://github.com/search?utf8=%E2%9C%93&q=FORMAT+1A+extension%3Aapib+extension%3Amd&type=Code&ref=advsearch&l=
[Aglio]: https://github.com/danielgtaylor/aglio
[API Blueprint]: https://apiblueprint.org/
[Drakov]: https://www.npmjs.com/package/drakov
[Atom language]: https://github.com/danielgtaylor/atom-language-api-blueprint
[Dredd]: https://github.com/apiaryio/dredd
[Lightshow]: https://github-lightshow.herokuapp.com/?utf8=%E2%9C%93&scope=from-url&grammar_url=https%3A%2F%2Fgithub.com%2Fapiaryio%2Fapi-blueprint-sublime-plugin%2Fblob%2Fmaster%2FAPIBlueprint.tmLanguage&grammar_text=&code_source=from-url&code_url=https%3A%2F%2Fraw.githubusercontent.com%2Fapiaryio%2Fapi-blueprint%2Fmaster%2Fexamples%2F12.%2520Advanced%2520Action.md&code=
[Sublime Text plugin]: https://github.com/apiaryio/api-blueprint-sublime-plugin
2015-04-28 22:21:30 -07:00
Paul Chaignon
fc1f8083ad Heuristic rules for XML and Modula-2 2015-04-25 23:36:15 +02:00
Paul Chaignon
af5e799a45 Merge branch 'master' into mod-extension 2015-04-22 21:14:24 +02:00
Arfon Smith
accf734a74 Merge pull request #2346 from larsbrinkhoff/public-key
Add support for SSH2 and OpenSSH public keys
2015-04-21 08:22:05 -05:00
Arfon Smith
6bd86ad46b Merge pull request #2330 from larsbrinkhoff/link-script
Add 'Linker Script' language
2015-04-21 08:19:53 -05:00
Lars Brinkhoff
d7207f3399 Linker Script samples.
vmlinux.lds by Martin Mares; license GPL v2.
link.ld by Anthony Zbierajewski; license GPL v2.
ld.script by Wu Zhangjink; license GPL v2.
2015-04-21 10:11:40 +02:00
Lars Brinkhoff
e018b4322e Improve .asc heuristic for Public Key. 2015-04-21 10:10:27 +02:00
Lars Brinkhoff
415c7d32a2 More .asc samples for Public Key.
sshkey1.asc by Joseph Galbraith; Sleepycat license (GPL compatible).
2015-04-21 10:10:27 +02:00
Lars Brinkhoff
164caa2755 Add 'Linker Script' language. 2015-04-21 07:17:08 +02:00
Arfon Smith
ec2f0cb82a Merge pull request #2335 from DavidJFelix/patch-1
Change Salt to programming per #2307
2015-04-20 16:57:15 -05:00
David J. Felix
604918b6ad Add python-logo grey color to SaltStack config 2015-04-20 12:29:09 -04:00
David J. Felix
eb7e72a4a9 Change Salt to programming per #2307
- Remove group
2015-04-19 18:24:27 +00:00
Paul Chaignon
e073e91d62 Detect GFortran module files as generated 2015-04-19 16:56:38 +02:00
Paul Chaignon
da9bda0e27 Detect KiCAD module files as generated 2015-04-19 16:19:52 +02:00
Paul Chaignon
0e996e4bb7 Grammar for Modula-2 from Sublime Text package 2015-04-19 12:41:41 +02:00
Paul Chaignon
63fbbd6e0a .mod file extension for AMPL, Linux Kernel Module, Modula-2 and XML 2015-04-19 12:39:21 +02:00
Brandon Keepers
1ac694f149 Merge pull request #2340 from github/remove-script-ext
Remove .script! hack
2015-04-19 08:58:07 +12:00
Brandon Keepers
924fddf698 Move Linguist::Language.detect to Linguist.detect 2015-04-17 14:56:08 +12:00
Brandon Keepers
ef49fe417f fix samples after renaming script 2015-04-17 14:37:40 +12:00
Brandon Keepers
d28828b7d7 Merge pull request #2334 from thomasvandoren/update-chapel-grammar
Update submodule for Chapel grammar.
2015-04-17 14:20:16 +12:00
Brandon Keepers
8a42f76f03 Remove .script! hack 2015-04-17 14:09:05 +12:00
Brandon Keepers
745ce14d47 Merge pull request #2333 from 3flex/2318-add-puppet-samples
Add additional Puppet sample
2015-04-17 13:57:07 +12:00
Arfon Smith
dc41ca23c6 Merge pull request #2339 from ampl/nl
Improve NL/NewLisp disambiguation heuristic
2015-04-16 17:42:08 -05:00
vitaut
9da42fba5b Improve NL/NewLisp disambiguation heuristic
NL files start with either 'b' or 'g' followed by an unsigned integer.
2015-04-16 15:19:22 -07:00
Ted Nyman
fac4633337 Move .odd file to the right directory 2015-04-15 18:37:36 -07:00
Thomas Van Doren
3ab0de831f Update Chapel samples. 2015-04-15 07:43:25 -07:00
Thomas Van Doren
599d146118 Use chapel-lang/chapel-tmbundle for Chapel grammar. 2015-04-15 07:43:25 -07:00
Matthew Haughton
5cdbb2b113 Add additional Puppet samples 2015-04-14 23:18:45 -04:00
Arfon Smith
611584a414 Merge pull request #2322 from larsbrinkhoff/lisp
Make Common Lisp heuristic case insensitive.
2015-04-13 08:49:37 -05:00
Lars Brinkhoff
33478b2d23 Make Common Lisp heuristic case insensitive. 2015-04-11 19:58:02 +02:00
Lars Brinkhoff
46ca8e93c2 New upper-case sample for Common Lisp. 2015-04-11 19:24:01 +02:00
Arfon Smith
da58febc3e Merge pull request #2328 from github/specflow
Specflow
2015-04-10 20:16:05 -05:00
Arfon Smith
7ca2384e03 Test for Specflow feature 2015-04-10 20:11:11 -05:00
Arfon Smith
6b2bb52dcd Merge branch 'master' into specflow 2015-04-10 20:07:43 -05:00
Arfon Smith
000a42ef3d Merge pull request #2326 from github/dcl
Add DCL and MMS
2015-04-10 15:54:04 -05:00
Arfon Smith
03e40718ff Bringing languages.yml keys up to date 2015-04-10 15:47:37 -05:00
Arfon Smith
4386fb7f28 Merge branch 'master' into dcl 2015-04-10 15:41:04 -05:00
Arfon Smith
0db4d05671 Merge pull request #2325 from github/clarion
Adding support for Clarion
2015-04-10 15:32:46 -05:00
Arfon Smith
d113e98915 Grammar update 2015-04-10 15:27:02 -05:00
Arfon Smith
e9acecf71f Colour update 2015-04-10 15:15:03 -05:00
Arfon Smith
76b84decfe Removing .inc from Clarion 2015-04-10 15:09:00 -05:00
Arfon Smith
80148ae4e4 Merge branch 'master' into clarion 2015-04-10 15:06:33 -05:00
Arfon Smith
4af679c27f Merge pull request #2324 from pchaigno/batch-group
Remove Batch from Shell group
2015-04-10 14:29:10 -05:00
Arfon Smith
ba86d9fff0 Merge pull request #2266 from Dorian/patch-1
Add .ruby to the list of ruby file extensions
2015-04-10 14:15:42 -05:00
Paul Chaignon
3a07410569 Remove test for group of Batch 2015-04-10 20:59:10 +02:00
Brandon Keepers
b43828db9b Merge pull request #2323 from lsf37/jflex-lang
Add JFlex grammars (language & syntax highlighting)
2015-04-10 14:57:03 -04:00
Gerwin Klein
8251588088 choose more distinct color for JFlex 2015-04-10 21:16:32 +10:00
Gerwin Klein
22ff4898a5 add textmate grammar for JFlex 2015-04-10 19:25:24 +10:00
Gerwin Klein
9c4c6d908a add language recognition for JFlex grammars
JFlex is a lexical analyzer generator for Java, see also
http://jflex.de or https://github.com/jflex-de/jflex
2015-04-10 19:17:58 +10:00
Paul Chaignon
3f9d98974c Remove Batch from Shell group 2015-04-08 21:39:10 +02:00
Arfon Smith
98a23c6a53 Merge pull request #2314 from larsbrinkhoff/ocaml
Tighten up OCaml heuristic
2015-04-07 07:56:16 -05:00
Lars Brinkhoff
3086326d12 Tighten up OCaml heuristic: only match at start of line. 2015-04-07 08:54:39 +02:00
Arfon Smith
ac4594e3b1 Merge pull request #2298 from github/add-proximity-test
Add proximity test for colors
2015-04-06 13:15:32 -05:00
Arfon Smith
47dcca839e Merge pull request #2312 from larsbrinkhoff/for
New sample for Formatted.
2015-04-06 13:15:04 -05:00
Arfon Smith
572078a708 Merge pull request #2306 from powerman/limbo
add Limbo: language, samples
2015-04-06 13:14:32 -05:00
Lars Brinkhoff
0442f4bd06 One more sample for Formatted.
By Sean Carroll; license GPLv2.
2015-04-06 20:06:15 +02:00
Arfon Smith
2861a8f19c Fixing up colours to match languages.yml 2015-04-06 12:41:49 -05:00
Arfon Smith
1d0028fd53 Merge pull request #2311 from pchaigno/saltstack-samples
New samples for SaltStack
2015-04-06 12:36:19 -05:00
Alex Efros
c3288543af add heuristic for Limbo 2015-04-06 20:17:52 +03:00
Garen Torikian
3c96f9eb53 Bump threshold to 0.05 2015-04-06 09:44:10 -07:00
Garen Torikian
6bd8d3a3b7 Some slight test improvements 2015-04-06 09:43:36 -07:00
Garen Torikian
63e017fbaa Rename to TestColorProximity 2015-04-06 08:32:23 -07:00
Paul Chaignon
f993b7358b New samples for SaltStack 2015-04-06 14:58:20 +02:00
Arfon Smith
4239d5453c Merge pull request #2309 from pchaigno/sch-kicad
KiCad language with .sch extension
2015-04-05 19:37:08 -05:00
Arfon Smith
b0e6f17612 Merge pull request #2308 from pchaigno/contribution-guideline-update
Update guideline on syntax highlighting fixes
2015-04-05 10:56:19 -05:00
Alex Efros
c97c10623b add .b Brainfuck sample 2015-04-05 18:08:20 +03:00
Paul Chaignon
d566ccd0be Update guideline on syntax highlighting fixes 2015-04-05 16:55:27 +02:00
Paul Chaignon
8b4daefbde KiCad language with .sch extension 2015-04-05 16:45:35 +02:00
Alex Efros
bbea29be55 add Limbo to test_languages 2015-04-05 03:03:45 +03:00
Alex Efros
f016867e1a Limbo: fix tm_scope 2015-04-05 02:56:36 +03:00
Alex Efros
35f2699eb3 add Limbo: language, samples 2015-04-05 02:34:02 +03:00
Garen Torikian
3ad66da2bf Adjust existing colors to pass tests
A lot of these were taken from official websites. For obscurer
languages, I just changed a few digits of the hex value.
2015-04-03 18:46:45 -07:00
Garen Torikian
004f9b4710 Use new color-proximity gem for better visual matching 2015-04-03 18:25:13 -07:00
Arfon Smith
3e06b95f98 Merge pull request #2304 from github/clarify-docs
Explaining gitattributes behavior.
2015-04-03 15:02:23 -04:00
Arfon Smith
8591dffcae Explaining gitattributes behavior. 2015-04-03 14:53:38 -04:00
Garen Torikian
3d69c047f0 Merge branch 'master' into add-proximity-test 2015-04-02 17:32:00 -07:00
Arfon Smith
78a1183c26 Merge pull request #2301 from dpiddy/erlang-rebar
Add rebar-related files as erlang.
2015-04-02 19:09:38 -04:00
Arfon Smith
58ea517b32 Merge pull request #2296 from phase/master
Add colors to semi-popular languages
2015-04-02 19:06:30 -04:00
Dan Peterson
0722b6855b Add rebar-related files as erlang. 2015-04-02 15:41:24 -03:00
Arfon Smith
a6a745d99d Merge pull request #2299 from github/shebang-fixing
Fixing up shebang detection to match new tokenizer behaviour
2015-04-02 14:14:29 -04:00
Arfon Smith
7394e9400b Adding explicit test for new shebang parsing 2015-04-02 14:00:03 -04:00
Garen Torikian
15f0366e12 Adjust color schemes slightly
- Make Perl6 a distinct blue (using Camelia’s wing as an aide)
- VCL is part of the Perl group
- Brighten Slim a bit so it does not conflict with Ada
2015-04-02 08:25:19 -07:00
Garen Torikian
07e3d9d3b3 Improve error output 2015-04-02 08:24:04 -07:00
Arfon Smith
55eaf03afb Merge pull request #2300 from github/build-boot
Adding in a Makefile.boot filename for .boot detection
2015-04-01 20:41:27 -05:00
Arfon Smith
7a6849b3ac Adding in a Makefile.boot filename for .boot detection 2015-04-01 20:33:13 -05:00
Arfon Smith
fa5496eef4 Fixing up shebang detection to match new tokenizer behaviour 2015-04-01 20:23:16 -05:00
Arfon Smith
893bd7e204 Merge pull request #1604 from geoff-codes/#!--"
Comment styles; don't choke on `#!/usr/bin/env foo=bar`
2015-04-01 15:18:40 -05:00
Garen Torikian
8a54ce57a5 Drop threshold back down to a passing 10 2015-04-01 10:15:10 -07:00
Garen Torikian
3851b7c016 Add test for detecting color proximity 2015-04-01 10:14:52 -07:00
phase
3dbcfa8af8 Add color for ABAP 2015-03-31 20:05:42 -07:00
phase
9936a30879 Add color for Crystal 2015-03-31 20:02:52 -07:00
phase
59e935b05d Add color for Brainfuck 2015-03-31 20:00:53 -07:00
phase
53f93f68db Add color to Makefile 2015-03-31 19:55:25 -07:00
phase
66f9bd1ab4 Add color to Kotlin 2015-03-31 19:53:36 -07:00
Dorian Marié
bde843b67f Add .ruby to the list of ruby file extensions
Can be found in Rails partial, eg `.html.ruby`
2015-03-24 18:59:53 +01:00
Paul Chaignon
17f75e64ba .vhost as an Apache extension 2015-03-06 21:19:28 +01:00
Paul Chaignon
0157b9eb37 .vhost as a Nginx extension 2015-03-06 07:38:54 +01:00
Paul Chaignon
730be65514 Ignore symlinks in repository statistics 2015-02-28 16:08:16 +01:00
Stefan Johnson
885b5aab41 Changed tokenizer number literals to be more encompassing
Number literals now skips hexadecimal, and C style literals.
2015-02-20 14:08:39 +11:00
Brahn Partridge
ef22eee4d9 updating submodule to latest with license 2015-02-17 13:18:19 +01:00
Brahn Partridge
b609f24bbc added ace_mode 2015-02-17 13:09:00 +01:00
Brahn Partridge
83b03df98b Merge branch 'master' of https://github.com/github/linguist
Conflicts:
	grammars.yml
2015-02-17 12:56:19 +01:00
Maximo Dominguez
56c3b8c3fe Added generated rule for SpecFlow's *.feature.cs
More info about specFlow here http://www.specflow.org/
2015-01-18 19:31:47 -04:00
Adam Roben
23e55e92ca Mention grammar licenses in LICENSE 2015-01-08 09:19:18 -05:00
Adam Roben
0cfdbfb91c Merge github-linguist-grammars into github-linguist
Now that all our grammars are licensed (or grandfathered in), we can
distribute them as part of the standard github-linguist gem. This makes
it easier for projects to get up and running with Linguist.
2015-01-07 14:47:26 -05:00
Gerwin Klein
f18ae4f99f add support for Isabelle ROOT file syntax 2014-12-27 10:13:02 +11:00
Seth Vargo
5217f19faa Alphabetize order 2014-12-18 17:53:53 -05:00
Seth Vargo
296d170ba9 Add sample for HCL 2014-12-18 17:52:30 -05:00
Seth Vargo
a97fd74399 Add HCL to languages.yml
More information on HCL: https://github.com/hashicorp/hcl
2014-12-18 17:46:26 -05:00
Brahn Partridge
43ee45d9b6 Merge branch 'master' of https://github.com/github/linguist
Conflicts:
	grammars.yml
2014-11-27 13:47:56 +01:00
Brahn Partridge
02db72515f removed less common extensions and better examples 2014-11-27 13:41:21 +01:00
Brahn Partridge
af9b5f0e98 remove sample that is no longer used 2014-11-26 15:11:23 +01:00
Brahn Partridge
a145bd92f7 remove tpl extension to avoid conflict with smarty language 2014-11-26 15:07:28 +01:00
Brahn Partridge
20204cd9fc fix test_pedantic failure 2014-11-26 15:01:25 +01:00
Brahn Partridge
3445e55744 additional samples and fixed extensions list 2014-11-26 14:51:47 +01:00
Brahn Partridge
036b9c4094 Hello world sample 2014-11-24 11:32:53 +01:00
Brahn Partridge
ce928d8b64 Add support for the Clarion language 2014-11-24 11:30:25 +01:00
Geoff Nixon
edadca9085 Add comment styles, don't choke on #!/usr/bin/env foo=bar... 2014-11-02 03:07:21 -08:00
Tomas Morstein
08290ac49e remove very rarely used .dcl extension for now
...to avoid collision with Clean language as well
as the .dcl extension can be seen only in some special
cases -- especially in context of DCL emulation tools
for non-OpenVMS systems (probably to avoid potential
confusion with MS-DOS .com files).
2014-10-04 22:46:32 +02:00
Tomas Morstein
42944660bd no need to group DCL and MMS/MMK 2014-10-04 22:02:27 +02:00
Tomas Morstein
ae5e1c5a85 DCL & MMS lexers are not supported, use Text only 2014-10-04 21:43:20 +02:00
Tomas Morstein
f4f5ccb3f5 add MMS/MMK samples 2014-10-04 20:43:39 +02:00
Tomas Morstein
ab3f44cb6e add DECset Module Management System support 2014-10-04 20:38:46 +02:00
Tomas Morstein
d7757033ab DCL examples 2014-10-04 20:33:28 +02:00
Tomas Morstein
8bb9241e6e add DIGITAL Command Language (DCL) 2014-10-04 19:08:57 +02:00
857 changed files with 132584 additions and 57627 deletions

258
.gitmodules vendored
View File

@@ -7,9 +7,6 @@
[submodule "vendor/grammars/sublime-cirru"] [submodule "vendor/grammars/sublime-cirru"]
path = vendor/grammars/sublime-cirru path = vendor/grammars/sublime-cirru
url = https://github.com/Cirru/sublime-cirru url = https://github.com/Cirru/sublime-cirru
[submodule "vendor/grammars/Sublime-Logos"]
path = vendor/grammars/Sublime-Logos
url = https://github.com/Cykey/Sublime-Logos
[submodule "vendor/grammars/SublimeBrainfuck"] [submodule "vendor/grammars/SublimeBrainfuck"]
path = vendor/grammars/SublimeBrainfuck path = vendor/grammars/SublimeBrainfuck
url = https://github.com/Drako/SublimeBrainfuck url = https://github.com/Drako/SublimeBrainfuck
@@ -25,18 +22,9 @@
[submodule "vendor/grammars/Sublime-REBOL"] [submodule "vendor/grammars/Sublime-REBOL"]
path = vendor/grammars/Sublime-REBOL path = vendor/grammars/Sublime-REBOL
url = https://github.com/Oldes/Sublime-REBOL url = https://github.com/Oldes/Sublime-REBOL
[submodule "vendor/grammars/Sublime-Inform"]
path = vendor/grammars/Sublime-Inform
url = https://github.com/PogiNate/Sublime-Inform
[submodule "vendor/grammars/autoitv3-tmbundle"]
path = vendor/grammars/autoitv3-tmbundle
url = https://github.com/Red-Nova-Technologies/autoitv3-tmbundle
[submodule "vendor/grammars/Sublime-VimL"] [submodule "vendor/grammars/Sublime-VimL"]
path = vendor/grammars/Sublime-VimL path = vendor/grammars/Sublime-VimL
url = https://github.com/SalGnt/Sublime-VimL url = https://github.com/SalGnt/Sublime-VimL
[submodule "vendor/grammars/boo-sublime"]
path = vendor/grammars/boo-sublime
url = https://github.com/Shammah/boo-sublime
[submodule "vendor/grammars/ColdFusion"] [submodule "vendor/grammars/ColdFusion"]
path = vendor/grammars/ColdFusion path = vendor/grammars/ColdFusion
url = https://github.com/SublimeText/ColdFusion url = https://github.com/SublimeText/ColdFusion
@@ -85,18 +73,18 @@
[submodule "vendor/grammars/language-shellscript"] [submodule "vendor/grammars/language-shellscript"]
path = vendor/grammars/language-shellscript path = vendor/grammars/language-shellscript
url = https://github.com/atom/language-shellscript url = https://github.com/atom/language-shellscript
[submodule "vendor/grammars/language-supercollider"]
path = vendor/grammars/language-supercollider
url = https://github.com/supercollider/language-supercollider
[submodule "vendor/grammars/language-yaml"] [submodule "vendor/grammars/language-yaml"]
path = vendor/grammars/language-yaml path = vendor/grammars/language-yaml
url = https://github.com/atom/language-yaml url = https://github.com/atom/language-yaml
[submodule "vendor/grammars/sublime-sourcepawn"]
path = vendor/grammars/sublime-sourcepawn
url = https://github.com/austinwagner/sublime-sourcepawn
[submodule "vendor/grammars/Sublime-Lasso"] [submodule "vendor/grammars/Sublime-Lasso"]
path = vendor/grammars/Sublime-Lasso path = vendor/grammars/Sublime-Lasso
url = https://github.com/bfad/Sublime-Lasso url = https://github.com/bfad/Sublime-Lasso
[submodule "vendor/grammars/chapel-tmbundle"] [submodule "vendor/grammars/chapel-tmbundle"]
path = vendor/grammars/chapel-tmbundle path = vendor/grammars/chapel-tmbundle
url = https://github.com/bholt/chapel-tmbundle url = https://github.com/chapel-lang/chapel-tmbundle
[submodule "vendor/grammars/sublime-nginx"] [submodule "vendor/grammars/sublime-nginx"]
path = vendor/grammars/sublime-nginx path = vendor/grammars/sublime-nginx
url = https://github.com/brandonwamboldt/sublime-nginx url = https://github.com/brandonwamboldt/sublime-nginx
@@ -109,18 +97,12 @@
[submodule "vendor/grammars/sublime-MuPAD"] [submodule "vendor/grammars/sublime-MuPAD"]
path = vendor/grammars/sublime-MuPAD path = vendor/grammars/sublime-MuPAD
url = https://github.com/ccreutzig/sublime-MuPAD url = https://github.com/ccreutzig/sublime-MuPAD
[submodule "vendor/grammars/nesC.tmbundle"]
path = vendor/grammars/nesC.tmbundle
url = https://github.com/cdwilson/nesC.tmbundle
[submodule "vendor/grammars/haxe-sublime-bundle"] [submodule "vendor/grammars/haxe-sublime-bundle"]
path = vendor/grammars/haxe-sublime-bundle path = vendor/grammars/haxe-sublime-bundle
url = https://github.com/clemos/haxe-sublime-bundle url = https://github.com/clemos/haxe-sublime-bundle
[submodule "vendor/grammars/cucumber-tmbundle"] [submodule "vendor/grammars/cucumber-tmbundle"]
path = vendor/grammars/cucumber-tmbundle path = vendor/grammars/cucumber-tmbundle
url = https://github.com/cucumber/cucumber-tmbundle url = https://github.com/cucumber/cucumber-tmbundle
[submodule "vendor/grammars/Handlebars"]
path = vendor/grammars/Handlebars
url = https://github.com/daaain/Handlebars
[submodule "vendor/grammars/powershell"] [submodule "vendor/grammars/powershell"]
path = vendor/grammars/powershell path = vendor/grammars/powershell
url = https://github.com/SublimeText/PowerShell url = https://github.com/SublimeText/PowerShell
@@ -136,12 +118,6 @@
[submodule "vendor/grammars/fancy-tmbundle"] [submodule "vendor/grammars/fancy-tmbundle"]
path = vendor/grammars/fancy-tmbundle path = vendor/grammars/fancy-tmbundle
url = https://github.com/fancy-lang/fancy-tmbundle url = https://github.com/fancy-lang/fancy-tmbundle
[submodule "vendor/grammars/fsharpbinding"]
path = vendor/grammars/fsharpbinding
url = https://github.com/fsharp/fsharpbinding
[submodule "vendor/grammars/monkey.tmbundle"]
path = vendor/grammars/monkey.tmbundle
url = https://github.com/gingerbeardman/monkey.tmbundle
[submodule "vendor/grammars/dart-sublime-bundle"] [submodule "vendor/grammars/dart-sublime-bundle"]
path = vendor/grammars/dart-sublime-bundle path = vendor/grammars/dart-sublime-bundle
url = https://github.com/guillermooo/dart-sublime-bundle url = https://github.com/guillermooo/dart-sublime-bundle
@@ -169,27 +145,15 @@
[submodule "vendor/grammars/Textmate-Gosu-Bundle"] [submodule "vendor/grammars/Textmate-Gosu-Bundle"]
path = vendor/grammars/Textmate-Gosu-Bundle path = vendor/grammars/Textmate-Gosu-Bundle
url = https://github.com/jpcamara/Textmate-Gosu-Bundle url = https://github.com/jpcamara/Textmate-Gosu-Bundle
[submodule "vendor/grammars/jquery-tmbundle"]
path = vendor/grammars/jquery-tmbundle
url = https://github.com/kswedberg/jquery-tmbundle
[submodule "vendor/grammars/fish-tmbundle"] [submodule "vendor/grammars/fish-tmbundle"]
path = vendor/grammars/fish-tmbundle path = vendor/grammars/fish-tmbundle
url = https://github.com/l15n/fish-tmbundle url = https://github.com/l15n/fish-tmbundle
[submodule "vendor/grammars/sublime-idris"]
path = vendor/grammars/sublime-idris
url = https://github.com/laughedelic/sublime-idris
[submodule "vendor/grammars/sublime-better-typescript"]
path = vendor/grammars/sublime-better-typescript
url = https://github.com/lavrton/sublime-better-typescript
[submodule "vendor/grammars/moonscript-tmbundle"] [submodule "vendor/grammars/moonscript-tmbundle"]
path = vendor/grammars/moonscript-tmbundle path = vendor/grammars/moonscript-tmbundle
url = https://github.com/leafo/moonscript-tmbundle url = https://github.com/leafo/moonscript-tmbundle
[submodule "vendor/grammars/Isabelle.tmbundle"] [submodule "vendor/grammars/Isabelle.tmbundle"]
path = vendor/grammars/Isabelle.tmbundle path = vendor/grammars/Isabelle.tmbundle
url = https://github.com/lsf37/Isabelle.tmbundle url = https://github.com/lsf37/Isabelle.tmbundle
[submodule "vendor/grammars/x86-assembly-textmate-bundle"]
path = vendor/grammars/x86-assembly-textmate-bundle
url = https://github.com/lunixbochs/x86-assembly-textmate-bundle
[submodule "vendor/grammars/Alloy.tmbundle"] [submodule "vendor/grammars/Alloy.tmbundle"]
path = vendor/grammars/Alloy.tmbundle path = vendor/grammars/Alloy.tmbundle
url = https://github.com/macekond/Alloy.tmbundle url = https://github.com/macekond/Alloy.tmbundle
@@ -220,9 +184,6 @@
[submodule "vendor/grammars/Julia.tmbundle"] [submodule "vendor/grammars/Julia.tmbundle"]
path = vendor/grammars/Julia.tmbundle path = vendor/grammars/Julia.tmbundle
url = https://github.com/nanoant/Julia.tmbundle url = https://github.com/nanoant/Julia.tmbundle
[submodule "vendor/grammars/assembly.tmbundle"]
path = vendor/grammars/assembly.tmbundle
url = https://github.com/nanoant/assembly.tmbundle
[submodule "vendor/grammars/ooc.tmbundle"] [submodule "vendor/grammars/ooc.tmbundle"]
path = vendor/grammars/ooc.tmbundle path = vendor/grammars/ooc.tmbundle
url = https://github.com/nilium/ooc.tmbundle url = https://github.com/nilium/ooc.tmbundle
@@ -232,9 +193,6 @@
[submodule "vendor/grammars/sublime-tea"] [submodule "vendor/grammars/sublime-tea"]
path = vendor/grammars/sublime-tea path = vendor/grammars/sublime-tea
url = https://github.com/pferruggiaro/sublime-tea url = https://github.com/pferruggiaro/sublime-tea
[submodule "vendor/grammars/puppet-textmate-bundle"]
path = vendor/grammars/puppet-textmate-bundle
url = https://github.com/puppet-textmate-bundle/puppet-textmate-bundle
[submodule "vendor/grammars/abap.tmbundle"] [submodule "vendor/grammars/abap.tmbundle"]
path = vendor/grammars/abap.tmbundle path = vendor/grammars/abap.tmbundle
url = https://github.com/pvl/abap.tmbundle url = https://github.com/pvl/abap.tmbundle
@@ -265,9 +223,6 @@
[submodule "vendor/grammars/SublimeXtend"] [submodule "vendor/grammars/SublimeXtend"]
path = vendor/grammars/SublimeXtend path = vendor/grammars/SublimeXtend
url = https://github.com/staltz/SublimeXtend url = https://github.com/staltz/SublimeXtend
[submodule "vendor/grammars/Stata.tmbundle"]
path = vendor/grammars/Stata.tmbundle
url = https://github.com/statatmbundle/Stata.tmbundle
[submodule "vendor/grammars/Vala-TMBundle"] [submodule "vendor/grammars/Vala-TMBundle"]
path = vendor/grammars/Vala-TMBundle path = vendor/grammars/Vala-TMBundle
url = https://github.com/technosophos/Vala-TMBundle url = https://github.com/technosophos/Vala-TMBundle
@@ -346,9 +301,6 @@
[submodule "vendor/grammars/java.tmbundle"] [submodule "vendor/grammars/java.tmbundle"]
path = vendor/grammars/java.tmbundle path = vendor/grammars/java.tmbundle
url = https://github.com/textmate/java.tmbundle url = https://github.com/textmate/java.tmbundle
[submodule "vendor/grammars/javadoc.tmbundle"]
path = vendor/grammars/javadoc.tmbundle
url = https://github.com/textmate/javadoc.tmbundle
[submodule "vendor/grammars/javascript-objective-j.tmbundle"] [submodule "vendor/grammars/javascript-objective-j.tmbundle"]
path = vendor/grammars/javascript-objective-j.tmbundle path = vendor/grammars/javascript-objective-j.tmbundle
url = https://github.com/textmate/javascript-objective-j.tmbundle url = https://github.com/textmate/javascript-objective-j.tmbundle
@@ -358,9 +310,6 @@
[submodule "vendor/grammars/latex.tmbundle"] [submodule "vendor/grammars/latex.tmbundle"]
path = vendor/grammars/latex.tmbundle path = vendor/grammars/latex.tmbundle
url = https://github.com/textmate/latex.tmbundle url = https://github.com/textmate/latex.tmbundle
[submodule "vendor/grammars/less.tmbundle"]
path = vendor/grammars/less.tmbundle
url = https://github.com/textmate/less.tmbundle
[submodule "vendor/grammars/lilypond.tmbundle"] [submodule "vendor/grammars/lilypond.tmbundle"]
path = vendor/grammars/lilypond.tmbundle path = vendor/grammars/lilypond.tmbundle
url = https://github.com/textmate/lilypond.tmbundle url = https://github.com/textmate/lilypond.tmbundle
@@ -409,9 +358,6 @@
[submodule "vendor/grammars/processing.tmbundle"] [submodule "vendor/grammars/processing.tmbundle"]
path = vendor/grammars/processing.tmbundle path = vendor/grammars/processing.tmbundle
url = https://github.com/textmate/processing.tmbundle url = https://github.com/textmate/processing.tmbundle
[submodule "vendor/grammars/prolog.tmbundle"]
path = vendor/grammars/prolog.tmbundle
url = https://github.com/textmate/prolog.tmbundle
[submodule "vendor/grammars/python-django.tmbundle"] [submodule "vendor/grammars/python-django.tmbundle"]
path = vendor/grammars/python-django.tmbundle path = vendor/grammars/python-django.tmbundle
url = https://github.com/textmate/python-django.tmbundle url = https://github.com/textmate/python-django.tmbundle
@@ -424,9 +370,6 @@
[submodule "vendor/grammars/ruby-haml.tmbundle"] [submodule "vendor/grammars/ruby-haml.tmbundle"]
path = vendor/grammars/ruby-haml.tmbundle path = vendor/grammars/ruby-haml.tmbundle
url = https://github.com/textmate/ruby-haml.tmbundle url = https://github.com/textmate/ruby-haml.tmbundle
[submodule "vendor/grammars/ruby-on-rails-tmbundle"]
path = vendor/grammars/ruby-on-rails-tmbundle
url = https://github.com/textmate/ruby-on-rails-tmbundle
[submodule "vendor/grammars/scheme.tmbundle"] [submodule "vendor/grammars/scheme.tmbundle"]
path = vendor/grammars/scheme.tmbundle path = vendor/grammars/scheme.tmbundle
url = https://github.com/textmate/scheme.tmbundle url = https://github.com/textmate/scheme.tmbundle
@@ -445,15 +388,6 @@
[submodule "vendor/grammars/tcl.tmbundle"] [submodule "vendor/grammars/tcl.tmbundle"]
path = vendor/grammars/tcl.tmbundle path = vendor/grammars/tcl.tmbundle
url = https://github.com/textmate/tcl.tmbundle url = https://github.com/textmate/tcl.tmbundle
[submodule "vendor/grammars/text.tmbundle"]
path = vendor/grammars/text.tmbundle
url = https://github.com/textmate/text.tmbundle
[submodule "vendor/grammars/textile.tmbundle"]
path = vendor/grammars/textile.tmbundle
url = https://github.com/textmate/textile.tmbundle
[submodule "vendor/grammars/textmate.tmbundle"]
path = vendor/grammars/textmate.tmbundle
url = https://github.com/textmate/textmate.tmbundle
[submodule "vendor/grammars/thrift.tmbundle"] [submodule "vendor/grammars/thrift.tmbundle"]
path = vendor/grammars/thrift.tmbundle path = vendor/grammars/thrift.tmbundle
url = https://github.com/textmate/thrift.tmbundle url = https://github.com/textmate/thrift.tmbundle
@@ -484,13 +418,6 @@
[submodule "vendor/grammars/llvm.tmbundle"] [submodule "vendor/grammars/llvm.tmbundle"]
path = vendor/grammars/llvm.tmbundle path = vendor/grammars/llvm.tmbundle
url = https://github.com/whitequark/llvm.tmbundle url = https://github.com/whitequark/llvm.tmbundle
[submodule "vendor/grammars/sublime-nix"]
path = vendor/grammars/sublime-nix
url = https://github.com/wmertens/sublime-nix
[submodule "vendor/grammars/ada.tmbundle"]
path = vendor/grammars/ada.tmbundle
url = https://github.com/aroben/ada.tmbundle
branch = better-with-highlighting
[submodule "vendor/grammars/oz-tmbundle"] [submodule "vendor/grammars/oz-tmbundle"]
path = vendor/grammars/oz-tmbundle path = vendor/grammars/oz-tmbundle
url = https://github.com/eregon/oz-tmbundle url = https://github.com/eregon/oz-tmbundle
@@ -549,24 +476,12 @@
[submodule "vendor/grammars/liquid.tmbundle"] [submodule "vendor/grammars/liquid.tmbundle"]
path = vendor/grammars/liquid.tmbundle path = vendor/grammars/liquid.tmbundle
url = https://github.com/bastilian/validcode-textmate-bundles url = https://github.com/bastilian/validcode-textmate-bundles
[submodule "vendor/grammars/ats.sublime"]
path = vendor/grammars/ats.sublime
url = https://github.com/steinwaywhw/ats-mode-sublimetext
[submodule "vendor/grammars/Modelica"] [submodule "vendor/grammars/Modelica"]
path = vendor/grammars/Modelica path = vendor/grammars/Modelica
url = https://github.com/BorisChumichev/modelicaSublimeTextPackage url = https://github.com/BorisChumichev/modelicaSublimeTextPackage
[submodule "vendor/grammars/sublime-apl"] [submodule "vendor/grammars/sublime-apl"]
path = vendor/grammars/sublime-apl path = vendor/grammars/sublime-apl
url = https://github.com/StoneCypher/sublime-apl url = https://github.com/StoneCypher/sublime-apl
[submodule "vendor/grammars/CLIPS-sublime"]
path = vendor/grammars/CLIPS-sublime
url = https://github.com/psicomante/CLIPS-sublime
[submodule "vendor/grammars/Creole"]
path = vendor/grammars/Creole
url = https://github.com/Siddley/Creole
[submodule "vendor/grammars/GDScript-sublime"]
path = vendor/grammars/GDScript-sublime
url = https://github.com/beefsack/GDScript-sublime
[submodule "vendor/grammars/sublime-golo"] [submodule "vendor/grammars/sublime-golo"]
path = vendor/grammars/sublime-golo path = vendor/grammars/sublime-golo
url = https://github.com/TypeUnsafe/sublime-golo url = https://github.com/TypeUnsafe/sublime-golo
@@ -579,9 +494,6 @@
[submodule "vendor/grammars/G-Code"] [submodule "vendor/grammars/G-Code"]
path = vendor/grammars/G-Code path = vendor/grammars/G-Code
url = https://github.com/robotmaster/sublime-text-syntax-highlighting url = https://github.com/robotmaster/sublime-text-syntax-highlighting
[submodule "vendor/grammars/grace-tmbundle"]
path = vendor/grammars/grace-tmbundle
url = https://github.com/zmthy/grace-tmbundle
[submodule "vendor/grammars/sublime-text-ox"] [submodule "vendor/grammars/sublime-text-ox"]
path = vendor/grammars/sublime-text-ox path = vendor/grammars/sublime-text-ox
url = https://github.com/andreashetland/sublime-text-ox url = https://github.com/andreashetland/sublime-text-ox
@@ -591,9 +503,6 @@
[submodule "vendor/grammars/ec.tmbundle"] [submodule "vendor/grammars/ec.tmbundle"]
path = vendor/grammars/ec.tmbundle path = vendor/grammars/ec.tmbundle
url = https://github.com/ecere/ec.tmbundle url = https://github.com/ecere/ec.tmbundle
[submodule "vendor/grammars/InnoSetup"]
path = vendor/grammars/InnoSetup
url = https://github.com/idleberg/InnoSetup-Sublime-Text
[submodule "vendor/grammars/gap-tmbundle"] [submodule "vendor/grammars/gap-tmbundle"]
path = vendor/grammars/gap-tmbundle path = vendor/grammars/gap-tmbundle
url = https://github.com/dhowden/gap-tmbundle url = https://github.com/dhowden/gap-tmbundle
@@ -612,9 +521,9 @@
[submodule "vendor/grammars/mediawiki.tmbundle"] [submodule "vendor/grammars/mediawiki.tmbundle"]
path = vendor/grammars/mediawiki.tmbundle path = vendor/grammars/mediawiki.tmbundle
url = https://github.com/textmate/mediawiki.tmbundle url = https://github.com/textmate/mediawiki.tmbundle
[submodule "vendor/grammars/oracle.tmbundle"] [submodule "vendor/grammars/SublimeClarion"]
path = vendor/grammars/oracle.tmbundle path = vendor/grammars/SublimeClarion
url = https://github.com/mulander/oracle.tmbundle.git url = https://github.com/fushnisoft/SublimeClarion
[submodule "vendor/grammars/BrightScript.tmbundle"] [submodule "vendor/grammars/BrightScript.tmbundle"]
path = vendor/grammars/BrightScript.tmbundle path = vendor/grammars/BrightScript.tmbundle
url = https://github.com/cmink/BrightScript.tmbundle url = https://github.com/cmink/BrightScript.tmbundle
@@ -624,18 +533,12 @@
[submodule "vendor/grammars/asciidoc.tmbundle"] [submodule "vendor/grammars/asciidoc.tmbundle"]
path = vendor/grammars/asciidoc.tmbundle path = vendor/grammars/asciidoc.tmbundle
url = https://github.com/zuckschwerdt/asciidoc.tmbundle url = https://github.com/zuckschwerdt/asciidoc.tmbundle
[submodule "vendor/grammars/sublime-text-pig-latin"]
path = vendor/grammars/sublime-text-pig-latin
url = https://github.com/goblindegook/sublime-text-pig-latin
[submodule "vendor/grammars/Lean.tmbundle"] [submodule "vendor/grammars/Lean.tmbundle"]
path = vendor/grammars/Lean.tmbundle path = vendor/grammars/Lean.tmbundle
url = https://github.com/leanprover/Lean.tmbundle url = https://github.com/leanprover/Lean.tmbundle
[submodule "vendor/grammars/ampl"] [submodule "vendor/grammars/ampl"]
path = vendor/grammars/ampl path = vendor/grammars/ampl
url = https://github.com/ampl/sublime-ampl url = https://github.com/ampl/sublime-ampl
[submodule "vendor/grammars/openscad.tmbundle"]
path = vendor/grammars/openscad.tmbundle
url = https://github.com/tbuser/openscad.tmbundle
[submodule "vendor/grammars/sublime-varnish"] [submodule "vendor/grammars/sublime-varnish"]
path = vendor/grammars/sublime-varnish path = vendor/grammars/sublime-varnish
url = https://github.com/brandonwamboldt/sublime-varnish url = https://github.com/brandonwamboldt/sublime-varnish
@@ -651,3 +554,150 @@
[submodule "vendor/grammars/Sublime-Red"] [submodule "vendor/grammars/Sublime-Red"]
path = vendor/grammars/Sublime-Red path = vendor/grammars/Sublime-Red
url = https://github.com/Oldes/Sublime-Red url = https://github.com/Oldes/Sublime-Red
[submodule "vendor/grammars/jflex.tmbundle"]
path = vendor/grammars/jflex.tmbundle
url = https://github.com/jflex-de/jflex.tmbundle.git
[submodule "vendor/grammars/Sublime-Modula-2"]
path = vendor/grammars/Sublime-Modula-2
url = https://github.com/harogaston/Sublime-Modula-2
[submodule "vendor/grammars/ada.tmbundle"]
path = vendor/grammars/ada.tmbundle
url = https://github.com/textmate/ada.tmbundle
[submodule "vendor/grammars/api-blueprint-sublime-plugin"]
path = vendor/grammars/api-blueprint-sublime-plugin
url = https://github.com/apiaryio/api-blueprint-sublime-plugin
[submodule "vendor/grammars/Handlebars"]
path = vendor/grammars/Handlebars
url = https://github.com/daaain/Handlebars
[submodule "vendor/grammars/smali-sublime"]
path = vendor/grammars/smali-sublime
url = https://github.com/ShaneWilton/sublime-smali
[submodule "vendor/grammars/language-jsoniq"]
path = vendor/grammars/language-jsoniq
url = http://github.com/wcandillon/language-jsoniq
[submodule "vendor/grammars/atom-fsharp"]
path = vendor/grammars/atom-fsharp
url = https://github.com/fsprojects/atom-fsharp
[submodule "vendor/grammars/SMT.tmbundle"]
path = vendor/grammars/SMT.tmbundle
url = https://github.com/SRI-CSL/SMT.tmbundle.git
[submodule "vendor/grammars/language-crystal"]
path = vendor/grammars/language-crystal
url = https://github.com/atom-crystal/language-crystal
[submodule "vendor/grammars/language-xbase"]
path = vendor/grammars/language-xbase
url = https://github.com/hernad/atom-language-harbour
[submodule "vendor/grammars/language-ncl"]
path = vendor/grammars/language-ncl
url = https://github.com/rpavlick/language-ncl.git
[submodule "vendor/grammars/pawn-sublime-language"]
path = vendor/grammars/pawn-sublime-language
url = https://github.com/Southclaw/pawn-sublime-language.git
[submodule "vendor/grammars/atom-language-purescript"]
path = vendor/grammars/atom-language-purescript
url = https://github.com/purescript-contrib/atom-language-purescript
[submodule "vendor/grammars/vue-syntax-highlight"]
path = vendor/grammars/vue-syntax-highlight
url = https://github.com/vuejs/vue-syntax-highlight
[submodule "vendor/grammars/st2-zonefile"]
path = vendor/grammars/st2-zonefile
url = https://github.com/sixty4k/st2-zonefile
[submodule "vendor/grammars/sublimeprolog"]
path = vendor/grammars/sublimeprolog
url = https://github.com/alnkpa/sublimeprolog
[submodule "vendor/grammars/sublime-aspectj"]
path = vendor/grammars/sublime-aspectj
url = https://github.com/pchaigno/sublime-aspectj
[submodule "vendor/grammars/sublime-typescript"]
path = vendor/grammars/sublime-typescript
url = https://github.com/Microsoft/TypeScript-Sublime-Plugin
[submodule "vendor/grammars/sublime-pony"]
path = vendor/grammars/sublime-pony
url = https://github.com/CausalityLtd/sublime-pony
[submodule "vendor/grammars/X10"]
path = vendor/grammars/X10
url = https://github.com/x10-lang/x10-highlighting
[submodule "vendor/grammars/language-babel"]
path = vendor/grammars/language-babel
url = https://github.com/gandm/language-babel
[submodule "vendor/grammars/UrWeb-Language-Definition"]
path = vendor/grammars/UrWeb-Language-Definition
url = https://github.com/gwalborn/UrWeb-Language-Definition.git
[submodule "vendor/grammars/Stata.tmbundle"]
path = vendor/grammars/Stata.tmbundle
url = https://github.com/pschumm/Stata.tmbundle
[submodule "vendor/grammars/FreeMarker.tmbundle"]
path = vendor/grammars/FreeMarker.tmbundle
url = https://github.com/freemarker/FreeMarker.tmbundle
[submodule "vendor/grammars/MagicPython"]
path = vendor/grammars/MagicPython
url = https://github.com/MagicStack/MagicPython
[submodule "vendor/grammars/language-click"]
path = vendor/grammars/language-click
url = https://github.com/stenverbois/language-click.git
[submodule "vendor/grammars/language-maxscript"]
path = vendor/grammars/language-maxscript
url = https://github.com/Alhadis/language-maxscript
[submodule "vendor/grammars/language-renpy"]
path = vendor/grammars/language-renpy
url = https://github.com/williamd1k0/language-renpy.git
[submodule "vendor/grammars/language-inform7"]
path = vendor/grammars/language-inform7
url = https://github.com/erkyrath/language-inform7
[submodule "vendor/grammars/atom-language-stan"]
path = vendor/grammars/atom-language-stan
url = https://github.com/jrnold/atom-language-stan
[submodule "vendor/grammars/language-yang"]
path = vendor/grammars/language-yang
url = https://github.com/DzonyKalafut/language-yang.git
[submodule "vendor/grammars/perl6fe"]
path = vendor/grammars/perl6fe
url = https://github.com/MadcapJake/language-perl6fe.git
[submodule "vendor/grammars/language-less"]
path = vendor/grammars/language-less
url = https://github.com/atom/language-less.git
[submodule "vendor/grammars/language-povray"]
path = vendor/grammars/language-povray
url = https://github.com/c-lipka/language-povray
[submodule "vendor/grammars/sublime-terra"]
path = vendor/grammars/sublime-terra
url = https://github.com/pyk/sublime-terra
[submodule "vendor/grammars/SublimePuppet"]
path = vendor/grammars/SublimePuppet
url = https://github.com/russCloak/SublimePuppet
[submodule "vendor/grammars/sublimeassembly"]
path = vendor/grammars/sublimeassembly
url = https://github.com/Nessphoro/sublimeassembly
[submodule "vendor/grammars/monkey"]
path = vendor/grammars/monkey
url = https://github.com/gingerbeardman/monkey.tmbundle
[submodule "vendor/grammars/assembly"]
path = vendor/grammars/assembly
url = https://github.com/nanoant/assembly.tmbundle
[submodule "vendor/grammars/boo"]
path = vendor/grammars/boo
url = https://github.com/Shammah/boo-sublime
[submodule "vendor/grammars/logos"]
path = vendor/grammars/logos
url = https://github.com/Cykey/Sublime-Logos
[submodule "vendor/grammars/pig-latin"]
path = vendor/grammars/pig-latin
url = https://github.com/goblindegook/sublime-text-pig-latin
[submodule "vendor/grammars/sourcepawn"]
path = vendor/grammars/sourcepawn
url = https://github.com/austinwagner/sublime-sourcepawn
[submodule "vendor/grammars/gdscript"]
path = vendor/grammars/gdscript
url = https://github.com/beefsack/GDScript-sublime
[submodule "vendor/grammars/nesC"]
path = vendor/grammars/nesC
url = https://github.com/cdwilson/nesC.tmbundle
[submodule "vendor/grammars/ats"]
path = vendor/grammars/ats
url = https://github.com/steinwaywhw/ats-mode-sublimetext
[submodule "vendor/grammars/grace"]
path = vendor/grammars/grace
url = https://github.com/zmthy/grace-tmbundle
[submodule "vendor/grammars/nix"]
path = vendor/grammars/nix
url = https://github.com/wmertens/sublime-nix

View File

@@ -1,6 +1,12 @@
language: ruby
sudo: false
addons:
apt:
packages:
- libicu-dev
- libicu48
before_install: script/travis/before_install before_install: script/travis/before_install
rvm: rvm:
- 1.9.3
- 2.0.0 - 2.0.0
- 2.1 - 2.1
- 2.2 - 2.2

View File

@@ -1,10 +1,31 @@
# Contributing # Contributing
Hi there! We're thrilled that you'd like to contribute to this project. Your help is essential for keeping it great. The majority of contributions won't need to touch any Ruby code at all. [code-of-conduct]: http://todogroup.org/opencodeofconduct/#Linguist/opensource@github.com
Hi there! We're thrilled that you'd like to contribute to this project. Your help is essential for keeping it great. This project adheres to the [Open Code of Conduct][code-of-conduct]. By participating, you are expected to uphold this code.
The majority of contributions won't need to touch any Ruby code at all.
## Adding an extension to a language
We try only to add new extensions once they have some usage on GitHub. In most cases we prefer that extensions be in use in hundreds of repositories before supporting them in Linguist.
To add support for a new extension:
0. Add your extension to the language entry in [`languages.yml`][languages], keeping the extensions in alphabetical order.
0. Add at least one sample for your extension to the [samples directory][samples] in the correct subdirectory.
0. Open a pull request, linking to a [GitHub search result](https://github.com/search?utf8=%E2%9C%93&q=extension%3Aboot+NOT+nothack&type=Code&ref=searchresults) showing in-the-wild usage.
In addition, if this extension is already listed in [`languages.yml`][languages] then sometimes a few more steps will need to be taken:
0. Make sure that example `.yourextension` files are present in the [samples directory][samples] for each language that uses `.yourextension`.
0. Test the performance of the Bayesian classifier with a relatively large number (1000s) of sample `.yourextension` files. (ping @arfon or @bkeepers to help with this) to ensure we're not misclassifying files.
0. If the Bayesian classifier does a bad job with the sample `.yourextension` files then a [heuristic](https://github.com/github/linguist/blob/master/lib/linguist/heuristics.rb) may need to be written to help.
## Adding a language ## Adding a language
We try only to add languages once they have some usage on GitHub. In most cases we prefer that languages be in use in hundreds of repositories before supporting them in Linguist. We try only to add languages once they have some usage on GitHub. In most cases we prefer that each new file extension be in use in hundreds of repositories before supporting them in Linguist.
To add support for a new language: To add support for a new language:
@@ -23,21 +44,23 @@ In addition, if your new language defines an extension that's already listed in
Remember, the goal here is to try and avoid false positives! Remember, the goal here is to try and avoid false positives!
## Fixing a misclassified language ## Fixing a misclassified language
Most languages are detected by their file extension defined in [languages.yml][languages]. For disambiguating between files with common extensions, linguist applies some [heuristics](/lib/linguist/heuristics.rb) and a [statistical classifier](lib/linguist/classifier.rb). This process can help differentiate between, for example, `.h` files which could be either C, C++, or Obj-C. Most languages are detected by their file extension defined in [languages.yml][languages]. For disambiguating between files with common extensions, linguist applies some [heuristics](/lib/linguist/heuristics.rb) and a [statistical classifier](lib/linguist/classifier.rb). This process can help differentiate between, for example, `.h` files which could be either C, C++, or Obj-C.
Misclassifications can often be solved by either adding a new filename or extension for the language or adding more [samples][samples] to make the classifier smarter. Misclassifications can often be solved by either adding a new filename or extension for the language or adding more [samples][samples] to make the classifier smarter.
## Fixing syntax highlighting ## Fixing syntax highlighting
Syntax highlighting in GitHub is performed using TextMate-compatible grammars. These are the same grammars that TextMate, Sublime Text and Atom use. Every language in [languages.yml][languages] is mapped to its corresponding TM `scope`. This scope will be used when picking up a grammar for highlighting. Syntax highlighting in GitHub is performed using TextMate-compatible grammars. These are the same grammars that TextMate, Sublime Text and Atom use. Every language in [languages.yml][languages] is mapped to its corresponding TM `scope`. This scope will be used when picking up a grammar for highlighting.
Assuming your code is being detected as the right language, in most cases this is due to a bug in the language grammar rather than a bug in Linguist. [`grammars.yml`][grammars] lists all the grammars we use for syntax highlighting on github.com. Find the one corresponding to your code's programming language and submit a bug report upstream. If you can, try to reproduce the highlighting problem in the text editor that the grammar is designed for (TextMate, Sublime Text, or Atom) and include that information in your bug report. Assuming your code is being detected as the right language, in most cases this is due to a bug in the language grammar rather than a bug in Linguist. [`grammars.yml`][grammars] lists all the grammars we use for syntax highlighting on github.com. Find the one corresponding to your code's programming language and submit a bug report upstream. If you can, try to reproduce the highlighting problem in the text editor that the grammar is designed for (TextMate, Sublime Text, or Atom) and include that information in your bug report.
You can also try to fix the bug yourself and submit a Pull Request. [TextMate's documentation](http://manual.macromates.com/en/language_grammars) offers a good introduction on how to work with TextMate-compatible grammars. You can test grammars using [Lightshow](https://github-lightshow.herokuapp.com). You can also try to fix the bug yourself and submit a Pull Request. [TextMate's documentation](https://manual.macromates.com/en/language_grammars) offers a good introduction on how to work with TextMate-compatible grammars. You can test grammars using [Lightshow](https://github-lightshow.herokuapp.com).
Once the bug has been fixed upstream, please let us know and we'll pick it up for GitHub. Once the bug has been fixed upstream, we'll pick it up for GitHub in the next release of Linguist.
## Testing ## Testing
@@ -51,9 +74,10 @@ To run the tests:
bundle exec rake test bundle exec rake test
Sometimes getting the tests running can be too much work, especially if you don't have much Ruby experience. It's okay: be lazy and let our build bot [Travis](http://travis-ci.org/#!/github/linguist) run the tests for you. Just open a pull request and the bot will start cranking away. Sometimes getting the tests running can be too much work, especially if you don't have much Ruby experience. It's okay: be lazy and let our build bot [Travis](https://travis-ci.org/#!/github/linguist) run the tests for you. Just open a pull request and the bot will start cranking away.
Here's our current build status: [![Build Status](https://api.travis-ci.org/github/linguist.svg?branch=master)](https://travis-ci.org/github/linguist)
Here's our current build status: [![Build Status](https://secure.travis-ci.org/github/linguist.png?branch=master)](http://travis-ci.org/github/linguist)
## Releasing ## Releasing

View File

@@ -1,4 +1,3 @@
source 'https://rubygems.org' source 'https://rubygems.org'
gemspec :name => "github-linguist" gemspec :name => "github-linguist"
gemspec :name => "github-linguist-grammars"
gem 'byebug' if RUBY_VERSION >= '2.0' gem 'byebug' if RUBY_VERSION >= '2.0'

View File

@@ -1,4 +1,4 @@
Copyright (c) 2011-2015 GitHub, Inc. Copyright (c) 2011-2016 GitHub, Inc.
Permission is hereby granted, free of charge, to any person Permission is hereby granted, free of charge, to any person
obtaining a copy of this software and associated documentation obtaining a copy of this software and associated documentation

View File

@@ -13,11 +13,11 @@ See [Troubleshooting](#troubleshooting) and [`CONTRIBUTING.md`](/CONTRIBUTING.md
![language stats bar](https://cloud.githubusercontent.com/assets/173/5562290/48e24654-8ddf-11e4-8fe7-735b0ce3a0d3.png) ![language stats bar](https://cloud.githubusercontent.com/assets/173/5562290/48e24654-8ddf-11e4-8fe7-735b0ce3a0d3.png)
The Language stats bar is built by aggregating the languages of each file in that repository. If it is reporting a language that you don't expect: The Language stats bar displays languages percentages for the files in the repository. The percentages are calculated based on the bytes of code for each language as reported by the [List Languages](https://developer.github.com/v3/repos/#list-languages) API. If the bar is reporting a language that you don't expect:
0. Click on the name of the language in the stats bar to see a list of the files that are identified as that language. 0. Click on the name of the language in the stats bar to see a list of the files that are identified as that language.
0. If you see files that you didn't write, consider moving the files into one of the [paths for vendored code](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml), or use the [manual overrides](#overrides) feature to ignore them. 0. If you see files that you didn't write, consider moving the files into one of the [paths for vendored code](/lib/linguist/vendor.yml), or use the [manual overrides](#overrides) feature to ignore them.
0. If the files are being misclassified, search for [open issues][issues] to see if anyone else has already reported the issue. Any information you an add, especially links to public repositories, is helpful. 0. If the files are being misclassified, search for [open issues][issues] to see if anyone else has already reported the issue. Any information you can add, especially links to public repositories, is helpful.
0. If there are no reported issues of this misclassification, [open an issue][new-issue] and include a link to the repository or a sample of the code that is being misclassified. 0. If there are no reported issues of this misclassification, [open an issue][new-issue] and include a link to the repository or a sample of the code that is being misclassified.
## Overrides ## Overrides
@@ -26,14 +26,14 @@ Linguist supports a number of different custom overrides strategies for language
### Using gitattributes ### Using gitattributes
Add a `.gitattributes` file to your project and use standard git-style path matchers for the files you want to override to set `linguist-documentation`, `linguist-language`, and `linguist-vendored`. `.gitattributes` will be used to determine language statistics, but will not be used to syntax highlight files. To manually set syntax highlighting, use [Vim or Emacs modelines](#using-emacs-and-vim-modelines). Add a `.gitattributes` file to your project and use standard git-style path matchers for the files you want to override to set `linguist-documentation`, `linguist-language`, and `linguist-vendored`. `.gitattributes` will be used to determine language statistics, but will not be used to syntax highlight files. To manually set syntax highlighting, use [Vim or Emacs modelines](#using-emacs-or-vim-modelines).
``` ```
$ cat .gitattributes $ cat .gitattributes
*.rb linguist-language=Java *.rb linguist-language=Java
``` ```
Checking code you didn't write, such as JavaScript libraries, into your git repo is a common practice, but this often inflates your project's language stats and may even cause your project to be labeled as another language. By default, Linguist treats all of the paths defined in [lib/linguist/vendor.yml](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml) as vendored and therefore doesn't include them in the language statistics for a repository. Vendored files are also hidden by default in diffs on github.com. Checking code you didn't write, such as JavaScript libraries, into your git repo is a common practice, but this often inflates your project's language stats and may even cause your project to be labeled as another language. By default, Linguist treats all of the paths defined in [lib/linguist/vendor.yml](https://github.com/github/linguist/blob/master/lib/linguist/vendor.yml) as vendored and therefore doesn't include them in the language statistics for a repository.
Use the `linguist-vendored` attribute to vendor or un-vendor paths. Use the `linguist-vendored` attribute to vendor or un-vendor paths.
@@ -53,16 +53,21 @@ project-docs/* linguist-documentation
docs/formatter.rb linguist-documentation=false docs/formatter.rb linguist-documentation=false
``` ```
### Using Emacs and Vim modelines ### Using Emacs or Vim modelines
Alternatively, you can use Vim and Emacs style modelines to set the language for a single file. Modelines can be placed anywhere within a file and are respected when determining how to syntax-highlight a file on GitHub.com Alternatively, you can use Vim or Emacs style modelines to set the language for a single file. Modelines can be placed anywhere within a file and are respected when determining how to syntax-highlight a file on GitHub.com
##### Vim
``` ```
Vim # Some examples of various styles:
vim: syntax=java
vim: set syntax=ruby:
vim: set filetype=prolog: vim: set filetype=prolog:
vim: set ft=cpp: vim: set ft=cpp:
```
Emacs ##### Emacs
```
-*- mode: php;-*- -*- mode: php;-*-
``` ```
@@ -109,4 +114,9 @@ lib/linguist.rb
Please check out our [contributing guidelines](CONTRIBUTING.md). Please check out our [contributing guidelines](CONTRIBUTING.md).
## ## License
The language grammars included in this gem are covered by their repositories'
respective licenses. `grammars.yml` specifies the repository for each grammar.
All other files are covered by the MIT license, see `LICENSE`.

View File

@@ -40,18 +40,14 @@ task :samples do
end end
task :build_gem => :samples do task :build_gem => :samples do
rm_rf "grammars"
sh "script/convert-grammars"
languages = YAML.load_file("lib/linguist/languages.yml") languages = YAML.load_file("lib/linguist/languages.yml")
File.write("lib/linguist/languages.json", Yajl.dump(languages)) File.write("lib/linguist/languages.json", Yajl.dump(languages))
`gem build github-linguist.gemspec` `gem build github-linguist.gemspec`
File.delete("lib/linguist/languages.json") File.delete("lib/linguist/languages.json")
end end
task :build_grammars_gem do
rm_rf "grammars"
sh "script/convert-grammars"
sh "gem", "build", "github-linguist-grammars.gemspec"
end
namespace :benchmark do namespace :benchmark do
benchmark_path = "benchmark/results" benchmark_path = "benchmark/results"
@@ -62,7 +58,7 @@ namespace :benchmark do
corpus = File.expand_path(ENV["CORPUS"] || "samples") corpus = File.expand_path(ENV["CORPUS"] || "samples")
require 'linguist/language' require 'linguist'
results = Hash.new results = Hash.new
Dir.glob("#{corpus}/**/*").each do |file| Dir.glob("#{corpus}/**/*").each do |file|

138
bin/git-linguist Executable file
View File

@@ -0,0 +1,138 @@
#!/usr/bin/env ruby
require 'linguist'
require 'rugged'
require 'optparse'
require 'json'
require 'tmpdir'
require 'zlib'
class GitLinguist
def initialize(path, commit_oid, incremental = true)
@repo_path = path
@commit_oid = commit_oid
@incremental = incremental
end
def linguist
if @commit_oid.nil?
raise "git-linguist must be called with a specific commit OID to perform language computation"
end
repo = Linguist::Repository.new(rugged, @commit_oid)
if @incremental && stats = load_language_stats
old_commit_oid, old_stats = stats
# A cache with NULL oid means that we want to froze
# these language stats in place and stop computing
# them (for performance reasons)
return old_stats if old_commit_oid == NULL_OID
repo.load_existing_stats(old_commit_oid, old_stats)
end
result = yield repo
save_language_stats(@commit_oid, repo.cache)
result
end
def load_language_stats
version, oid, stats = load_cache
if version == LANGUAGE_STATS_CACHE_VERSION && oid && stats
[oid, stats]
end
end
def save_language_stats(oid, stats)
cache = [LANGUAGE_STATS_CACHE_VERSION, oid, stats]
write_cache(cache)
end
def clear_language_stats
File.unlink(cache_file)
rescue Errno::ENOENT
end
def disable_language_stats
save_language_stats(NULL_OID, {})
end
protected
NULL_OID = ("0" * 40).freeze
LANGUAGE_STATS_CACHE = 'language-stats.cache'
LANGUAGE_STATS_CACHE_VERSION = "v3:#{Linguist::VERSION}"
def rugged
@rugged ||= Rugged::Repository.bare(@repo_path)
end
def cache_file
File.join(@repo_path, LANGUAGE_STATS_CACHE)
end
def write_cache(object)
return unless File.directory? @repo_path
begin
tmp_path = Dir::Tmpname.make_tmpname(cache_file, nil)
File.open(tmp_path, "wb") do |f|
marshal = Marshal.dump(object)
f.write(Zlib::Deflate.deflate(marshal))
end
File.rename(tmp_path, cache_file)
rescue => e
(File.unlink(tmp_path) rescue nil)
raise e
end
end
def load_cache
marshal = File.open(cache_file, "rb") { |f| Zlib::Inflate.inflate(f.read) }
Marshal.load(marshal)
rescue SystemCallError, ::Zlib::DataError, ::Zlib::BufError, TypeError
nil
end
end
def git_linguist(args)
incremental = true
commit = nil
parser = OptionParser.new do |opts|
opts.banner = "Usage: git-linguist [OPTIONS] stats|breakdown|dump-cache|clear|disable"
opts.on("-f", "--force", "Force a full rescan") { incremental = false }
opts.on("--commit=COMMIT", "Commit to index") { |v| commit = v}
end
parser.parse!(args)
git_dir = `git rev-parse --git-dir`.strip
raise "git-linguist must be ran in a Git repository (#{Dir.pwd})" unless $?.success?
wrapper = GitLinguist.new(git_dir, commit, incremental)
case args.pop
when "stats"
wrapper.linguist do |linguist|
puts JSON.dump(linguist.languages)
end
when "breakdown"
wrapper.linguist do |linguist|
puts JSON.dump(linguist.breakdown_by_file)
end
when "dump-cache"
puts JSON.dump(wrapper.load_language_stats)
when "clear"
wrapper.clear_language_stats
when "disable"
wrapper.disable_language_stats
else
$stderr.print(parser.help)
exit 1
end
end
git_linguist(ARGV)

View File

@@ -1,14 +0,0 @@
require File.expand_path('../lib/linguist/version', __FILE__)
Gem::Specification.new do |s|
s.name = 'github-linguist-grammars'
s.version = Linguist::VERSION
s.summary = "Language grammars for use with github-linguist"
s.authors = "GitHub"
s.homepage = "https://github.com/github/linguist"
s.files = ['lib/linguist/grammars.rb'] + Dir['grammars/*']
s.add_development_dependency 'plist', '~>3.1'
end

View File

@@ -10,17 +10,21 @@ Gem::Specification.new do |s|
s.homepage = "https://github.com/github/linguist" s.homepage = "https://github.com/github/linguist"
s.license = "MIT" s.license = "MIT"
s.files = Dir['lib/**/*'] - ['lib/linguist/grammars.rb'] s.files = Dir['lib/**/*'] + Dir['grammars/*'] + ['LICENSE']
s.executables << 'linguist' s.executables = ['linguist', 'git-linguist']
s.add_dependency 'charlock_holmes', '~> 0.7.3' s.add_dependency 'charlock_holmes', '~> 0.7.3'
s.add_dependency 'escape_utils', '~> 1.1.0' s.add_dependency 'escape_utils', '~> 1.1.0'
s.add_dependency 'mime-types', '>= 1.19' s.add_dependency 'mime-types', '>= 1.19'
s.add_dependency 'rugged', '~> 0.23.0b1' s.add_dependency 'rugged', '>= 0.23.0b'
s.add_development_dependency 'minitest', '>= 5.0' s.add_development_dependency 'minitest', '>= 5.0'
s.add_development_dependency 'mocha' s.add_development_dependency 'mocha'
s.add_development_dependency 'plist', '~>3.1'
s.add_development_dependency 'pry' s.add_development_dependency 'pry'
s.add_development_dependency 'rake' s.add_development_dependency 'rake'
s.add_development_dependency 'yajl-ruby' s.add_development_dependency 'yajl-ruby'
s.add_development_dependency 'color-proximity', '~> 0.2.1'
s.add_development_dependency 'licensed'
end end

180
grammars.yml Normal file → Executable file
View File

@@ -29,33 +29,27 @@ vendor/grammars/AutoHotkey/:
vendor/grammars/BrightScript.tmbundle/: vendor/grammars/BrightScript.tmbundle/:
- source.brightauthorproject - source.brightauthorproject
- source.brightscript - source.brightscript
vendor/grammars/CLIPS-sublime:
- source.clips
vendor/grammars/ColdFusion: vendor/grammars/ColdFusion:
- source.cfscript - source.cfscript
- source.cfscript.cfc - source.cfscript.cfc
- text.cfml.basic - text.cfml.basic
- text.html.cfm - text.html.cfm
vendor/grammars/Creole:
- text.html.creole
vendor/grammars/Docker.tmbundle: vendor/grammars/Docker.tmbundle:
- source.dockerfile - source.dockerfile
vendor/grammars/Elm.tmLanguage: vendor/grammars/Elm.tmLanguage:
- source.elm - source.elm
vendor/grammars/FreeMarker.tmbundle:
- text.html.ftl
vendor/grammars/G-Code/: vendor/grammars/G-Code/:
- source.LS - source.LS
- source.MCPOST - source.MCPOST
- source.MOD - source.MOD
- source.apt - source.apt
- source.gcode - source.gcode
vendor/grammars/GDScript-sublime/:
- source.gdscript
vendor/grammars/Handlebars: vendor/grammars/Handlebars:
- text.html.handlebars - text.html.handlebars
vendor/grammars/IDL-Syntax: vendor/grammars/IDL-Syntax:
- source.webidl - source.webidl
vendor/grammars/InnoSetup/:
- source.inno
vendor/grammars/Isabelle.tmbundle: vendor/grammars/Isabelle.tmbundle:
- source.isabelle.root - source.isabelle.root
- source.isabelle.theory - source.isabelle.theory
@@ -67,6 +61,9 @@ vendor/grammars/Lean.tmbundle:
- source.lean - source.lean
vendor/grammars/LiveScript.tmbundle: vendor/grammars/LiveScript.tmbundle:
- source.livescript - source.livescript
vendor/grammars/MagicPython:
- source.python
- source.regexp.python
vendor/grammars/Modelica/: vendor/grammars/Modelica/:
- source.modelica - source.modelica
vendor/grammars/NSIS: vendor/grammars/NSIS:
@@ -85,12 +82,14 @@ vendor/grammars/Racket:
- source.racket - source.racket
vendor/grammars/SCSS.tmbundle: vendor/grammars/SCSS.tmbundle:
- source.scss - source.scss
vendor/grammars/SMT.tmbundle:
- source.smt
vendor/grammars/Scalate.tmbundle: vendor/grammars/Scalate.tmbundle:
- source.scaml - source.scaml
- text.html.ssp - text.html.ssp
vendor/grammars/Slash.tmbundle: vendor/grammars/Slash.tmbundle:
- text.html.slash - text.html.slash
vendor/grammars/Stata.tmbundle: vendor/grammars/Stata.tmbundle/:
- source.mata - source.mata
- source.stata - source.stata
vendor/grammars/Stylus/: vendor/grammars/Stylus/:
@@ -99,14 +98,12 @@ vendor/grammars/Sublime-Coq:
- source.coq - source.coq
vendor/grammars/Sublime-HTTP: vendor/grammars/Sublime-HTTP:
- source.httpspec - source.httpspec
vendor/grammars/Sublime-Inform:
- source.Inform7
vendor/grammars/Sublime-Lasso: vendor/grammars/Sublime-Lasso:
- file.lasso - file.lasso
vendor/grammars/Sublime-Logos:
- source.logos
vendor/grammars/Sublime-Loom: vendor/grammars/Sublime-Loom:
- source.loomscript - source.loomscript
vendor/grammars/Sublime-Modula-2/:
- source.modula2
vendor/grammars/Sublime-Nit: vendor/grammars/Sublime-Nit:
- source.nit - source.nit
vendor/grammars/Sublime-QML: vendor/grammars/Sublime-QML:
@@ -119,24 +116,31 @@ vendor/grammars/Sublime-SQF-Language:
- source.sqf - source.sqf
vendor/grammars/Sublime-Text-2-OpenEdge-ABL: vendor/grammars/Sublime-Text-2-OpenEdge-ABL:
- source.abl - source.abl
- text.html.abl
vendor/grammars/Sublime-VimL: vendor/grammars/Sublime-VimL:
- source.viml - source.viml
vendor/grammars/SublimeBrainfuck: vendor/grammars/SublimeBrainfuck:
- source.bf - source.bf
vendor/grammars/SublimeClarion/:
- source.clarion
vendor/grammars/SublimePapyrus/: vendor/grammars/SublimePapyrus/:
- source.compiled-papyrus - source.papyrus.skyrim
- source.papyrus vendor/grammars/SublimePuppet/:
- source.papyrus-assembly - source.puppet
vendor/grammars/SublimeXtend: vendor/grammars/SublimeXtend:
- source.xtend - source.xtend
vendor/grammars/TXL/: vendor/grammars/TXL/:
- source.txl - source.txl
vendor/grammars/Textmate-Gosu-Bundle: vendor/grammars/Textmate-Gosu-Bundle:
- source.gosu.2 - source.gosu.2
vendor/grammars/UrWeb-Language-Definition:
- source.ur
vendor/grammars/VBDotNetSyntax: vendor/grammars/VBDotNetSyntax:
- source.vbnet - source.vbnet
vendor/grammars/Vala-TMBundle: vendor/grammars/Vala-TMBundle:
- source.vala - source.vala
vendor/grammars/X10:
- source.x10
vendor/grammars/abap.tmbundle: vendor/grammars/abap.tmbundle:
- source.abap - source.abap
vendor/grammars/actionscript3-tmbundle: vendor/grammars/actionscript3-tmbundle:
@@ -154,6 +158,9 @@ vendor/grammars/antlr.tmbundle:
vendor/grammars/apache.tmbundle: vendor/grammars/apache.tmbundle:
- source.apache-config - source.apache-config
- source.apache-config.mod_perl - source.apache-config.mod_perl
vendor/grammars/api-blueprint-sublime-plugin/:
- text.html.markdown.source.gfm.apib
- text.html.markdown.source.gfm.mson
vendor/grammars/applescript.tmbundle: vendor/grammars/applescript.tmbundle:
- source.applescript - source.applescript
vendor/grammars/asciidoc.tmbundle/: vendor/grammars/asciidoc.tmbundle/:
@@ -161,21 +168,28 @@ vendor/grammars/asciidoc.tmbundle/:
vendor/grammars/asp.tmbundle: vendor/grammars/asp.tmbundle:
- source.asp - source.asp
- text.html.asp - text.html.asp
vendor/grammars/assembly.tmbundle: vendor/grammars/assembly/:
- objdump.x86asm - objdump.x86asm
- source.x86asm - source.x86asm
vendor/grammars/atom-fsharp/:
- source.fsharp
- source.fsharp.fsi
- source.fsharp.fsl
- source.fsharp.fsx
vendor/grammars/atom-language-purescript/:
- source.purescript
vendor/grammars/atom-language-stan/:
- source.stan
vendor/grammars/atom-salt: vendor/grammars/atom-salt:
- source.python.salt - source.python.salt
- source.yaml.salt - source.yaml.salt
vendor/grammars/ats.sublime: vendor/grammars/ats:
- source.ats - source.ats
vendor/grammars/autoitv3-tmbundle:
- source.autoit.3
vendor/grammars/awk-sublime: vendor/grammars/awk-sublime:
- source.awk - source.awk
vendor/grammars/bison.tmbundle: vendor/grammars/bison.tmbundle:
- source.bison - source.bison
vendor/grammars/boo-sublime: vendor/grammars/boo/:
- source.boo - source.boo
vendor/grammars/bro-sublime: vendor/grammars/bro-sublime:
- source.bro - source.bro
@@ -210,6 +224,7 @@ vendor/grammars/d.tmbundle:
vendor/grammars/dart-sublime-bundle: vendor/grammars/dart-sublime-bundle:
- source.dart - source.dart
- source.pubspec - source.pubspec
- text.dart-analysis-output
- text.dart-doccomments - text.dart-doccomments
vendor/grammars/desktop.tmbundle: vendor/grammars/desktop.tmbundle:
- source.desktop - source.desktop
@@ -242,17 +257,17 @@ vendor/grammars/fish-tmbundle:
vendor/grammars/fortran.tmbundle: vendor/grammars/fortran.tmbundle:
- source.fortran - source.fortran
- source.fortran.modern - source.fortran.modern
vendor/grammars/fsharpbinding:
- source.fsharp
vendor/grammars/gap-tmbundle/: vendor/grammars/gap-tmbundle/:
- source.gap - source.gap
vendor/grammars/gdscript/:
- source.gdscript
vendor/grammars/gettext.tmbundle: vendor/grammars/gettext.tmbundle:
- source.po - source.po
vendor/grammars/gnuplot-tmbundle: vendor/grammars/gnuplot-tmbundle:
- source.gnuplot - source.gnuplot
vendor/grammars/go-tmbundle: vendor/grammars/go-tmbundle:
- source.go - source.go
vendor/grammars/grace-tmbundle/: vendor/grammars/grace:
- source.grace - source.grace
vendor/grammars/gradle.tmbundle: vendor/grammars/gradle.tmbundle:
- source.groovy.gradle - source.groovy.gradle
@@ -282,8 +297,8 @@ vendor/grammars/io.tmbundle:
vendor/grammars/ioke-outdated: vendor/grammars/ioke-outdated:
- source.ioke - source.ioke
vendor/grammars/jade-tmbundle: vendor/grammars/jade-tmbundle:
- source.jade
- source.pyjade - source.pyjade
- text.jade
vendor/grammars/jasmin-sublime: vendor/grammars/jasmin-sublime:
- source.jasmin - source.jasmin
vendor/grammars/java.tmbundle: vendor/grammars/java.tmbundle:
@@ -291,22 +306,28 @@ vendor/grammars/java.tmbundle:
- source.java-properties - source.java-properties
- text.html.jsp - text.html.jsp
- text.junit-test-report - text.junit-test-report
vendor/grammars/javadoc.tmbundle:
- text.html.javadoc
vendor/grammars/javascript-objective-j.tmbundle: vendor/grammars/javascript-objective-j.tmbundle:
- source.js.objj - source.js.objj
vendor/grammars/jquery-tmbundle: vendor/grammars/jflex.tmbundle:
- source.js.jquery - source.jflex
vendor/grammars/json.tmbundle: vendor/grammars/json.tmbundle:
- source.json - source.json
vendor/grammars/kotlin-sublime-package: vendor/grammars/kotlin-sublime-package:
- source.Kotlin - source.Kotlin
vendor/grammars/language-babel/:
- source.js.jsx
- source.regexp.babel
vendor/grammars/language-click/:
- source.click
vendor/grammars/language-clojure: vendor/grammars/language-clojure:
- source.clojure - source.clojure
vendor/grammars/language-coffee-script: vendor/grammars/language-coffee-script:
- source.coffee - source.coffee
- source.litcoffee - source.litcoffee
vendor/grammars/language-crystal:
- source.crystal
vendor/grammars/language-csharp: vendor/grammars/language-csharp:
- source.cake
- source.cs - source.cs
- source.csx - source.csx
- source.nant-build - source.nant-build
@@ -314,19 +335,39 @@ vendor/grammars/language-gfm:
- source.gfm - source.gfm
vendor/grammars/language-hy: vendor/grammars/language-hy:
- source.hy - source.hy
vendor/grammars/language-inform7:
- source.inform7
vendor/grammars/language-javascript: vendor/grammars/language-javascript:
- source.js - source.js
- source.js.regexp - source.js.regexp
- source.js.regexp.replacement
vendor/grammars/language-jsoniq/:
- source.jq
- source.xq
vendor/grammars/language-less/:
- source.css.less
vendor/grammars/language-maxscript:
- source.maxscript
vendor/grammars/language-ncl:
- source.ncl
vendor/grammars/language-povray:
- source.pov-ray sdl
vendor/grammars/language-python: vendor/grammars/language-python:
- source.python
- source.regexp.python
- text.python.console - text.python.console
- text.python.traceback - text.python.traceback
vendor/grammars/language-renpy:
- source.renpy
vendor/grammars/language-shellscript: vendor/grammars/language-shellscript:
- source.shell - source.shell
- text.shell-session - text.shell-session
vendor/grammars/language-supercollider:
- source.supercollider
vendor/grammars/language-xbase:
- source.harbour
vendor/grammars/language-yaml: vendor/grammars/language-yaml:
- source.yaml - source.yaml
vendor/grammars/language-yang/:
- source.yang
vendor/grammars/latex.tmbundle: vendor/grammars/latex.tmbundle:
- text.bibtex - text.bibtex
- text.log.latex - text.log.latex
@@ -334,8 +375,6 @@ vendor/grammars/latex.tmbundle:
- text.tex.latex - text.tex.latex
- text.tex.latex.beamer - text.tex.latex.beamer
- text.tex.latex.memoir - text.tex.latex.memoir
vendor/grammars/less.tmbundle:
- source.css.less
vendor/grammars/lilypond.tmbundle: vendor/grammars/lilypond.tmbundle:
- source.lilypond - source.lilypond
vendor/grammars/liquid.tmbundle: vendor/grammars/liquid.tmbundle:
@@ -344,6 +383,8 @@ vendor/grammars/lisp.tmbundle:
- source.lisp - source.lisp
vendor/grammars/llvm.tmbundle: vendor/grammars/llvm.tmbundle:
- source.llvm - source.llvm
vendor/grammars/logos:
- source.logos
vendor/grammars/logtalk.tmbundle: vendor/grammars/logtalk.tmbundle:
- source.logtalk - source.logtalk
vendor/grammars/lua.tmbundle: vendor/grammars/lua.tmbundle:
@@ -363,16 +404,18 @@ vendor/grammars/mediawiki.tmbundle/:
- text.html.mediawiki - text.html.mediawiki
vendor/grammars/mercury-tmlanguage: vendor/grammars/mercury-tmlanguage:
- source.mercury - source.mercury
vendor/grammars/monkey.tmbundle: vendor/grammars/monkey/:
- source.monkey - source.monkey
vendor/grammars/moonscript-tmbundle: vendor/grammars/moonscript-tmbundle:
- source.moonscript - source.moonscript
vendor/grammars/nemerle.tmbundle: vendor/grammars/nemerle.tmbundle:
- source.nemerle - source.nemerle
vendor/grammars/nesC.tmbundle: vendor/grammars/nesC:
- source.nesc - source.nesc
vendor/grammars/ninja.tmbundle: vendor/grammars/ninja.tmbundle:
- source.ninja - source.ninja
vendor/grammars/nix:
- source.nix
vendor/grammars/objective-c.tmbundle: vendor/grammars/objective-c.tmbundle:
- source.objc - source.objc
- source.objc++ - source.objc++
@@ -387,21 +430,25 @@ vendor/grammars/ooc.tmbundle:
- source.ooc - source.ooc
vendor/grammars/opa.tmbundle: vendor/grammars/opa.tmbundle:
- source.opa - source.opa
vendor/grammars/openscad.tmbundle/:
- source.scad
vendor/grammars/oracle.tmbundle:
- source.plsql.oracle
vendor/grammars/oz-tmbundle/Syntaxes/Oz.tmLanguage: vendor/grammars/oz-tmbundle/Syntaxes/Oz.tmLanguage:
- source.oz - source.oz
vendor/grammars/pascal.tmbundle: vendor/grammars/pascal.tmbundle:
- source.pascal - source.pascal
vendor/grammars/pawn-sublime-language/:
- source.pawn
vendor/grammars/perl.tmbundle/: vendor/grammars/perl.tmbundle/:
- source.perl - source.perl
- source.perl.6 - source.perl.6
vendor/grammars/perl6fe:
- source.meta-info
- source.perl6fe
- source.regexp.perl6fe
vendor/grammars/php-smarty.tmbundle: vendor/grammars/php-smarty.tmbundle:
- source.smarty - text.html.smarty
vendor/grammars/php.tmbundle: vendor/grammars/php.tmbundle:
- text.html.php - text.html.php
vendor/grammars/pig-latin/:
- source.pig_latin
vendor/grammars/pike-textmate: vendor/grammars/pike-textmate:
- source.pike - source.pike
vendor/grammars/postscript.tmbundle: vendor/grammars/postscript.tmbundle:
@@ -410,12 +457,8 @@ vendor/grammars/powershell:
- source.powershell - source.powershell
vendor/grammars/processing.tmbundle: vendor/grammars/processing.tmbundle:
- source.processing - source.processing
vendor/grammars/prolog.tmbundle:
- source.prolog
vendor/grammars/protobuf-tmbundle: vendor/grammars/protobuf-tmbundle:
- source.protobuf - source.protobuf
vendor/grammars/puppet-textmate-bundle:
- source.puppet
vendor/grammars/python-django.tmbundle: vendor/grammars/python-django.tmbundle:
- source.python.django - source.python.django
- text.html.django - text.html.django
@@ -426,20 +469,14 @@ vendor/grammars/restructuredtext.tmbundle:
- text.restructuredtext - text.restructuredtext
vendor/grammars/ruby-haml.tmbundle: vendor/grammars/ruby-haml.tmbundle:
- text.haml - text.haml
vendor/grammars/ruby-on-rails-tmbundle:
- source.js.erb.rails
- source.ruby.rails
- source.ruby.rails.rjs
- source.sql.ruby
- text.html.erb.rails
vendor/grammars/ruby-slim.tmbundle: vendor/grammars/ruby-slim.tmbundle:
- text.slim - text.slim
vendor/grammars/ruby.tmbundle: vendor/grammars/ruby.tmbundle:
- source.ruby - source.ruby
- text.html.erb - text.html.erb
vendor/grammars/sas.tmbundle: vendor/grammars/sas.tmbundle:
- source.SASLog
- source.sas - source.sas
- source.sas_log
vendor/grammars/sass-textmate-bundle: vendor/grammars/sass-textmate-bundle:
- source.sass - source.sass
vendor/grammars/scala.tmbundle: vendor/grammars/scala.tmbundle:
@@ -449,10 +486,16 @@ vendor/grammars/scheme.tmbundle:
- source.scheme - source.scheme
vendor/grammars/scilab.tmbundle: vendor/grammars/scilab.tmbundle:
- source.scilab - source.scilab
vendor/grammars/smali-sublime/smali.tmLanguage:
- source.smali
vendor/grammars/smalltalk-tmbundle: vendor/grammars/smalltalk-tmbundle:
- source.smalltalk - source.smalltalk
vendor/grammars/sourcepawn/:
- source.sp
vendor/grammars/sql.tmbundle: vendor/grammars/sql.tmbundle:
- source.sql - source.sql
vendor/grammars/st2-zonefile:
- text.zone_file
vendor/grammars/standard-ml.tmbundle: vendor/grammars/standard-ml.tmbundle:
- source.cm - source.cm
- source.ml - source.ml
@@ -460,10 +503,10 @@ vendor/grammars/sublime-MuPAD:
- source.mupad - source.mupad
vendor/grammars/sublime-apl/: vendor/grammars/sublime-apl/:
- source.apl - source.apl
vendor/grammars/sublime-aspectj/:
- source.aspectj
vendor/grammars/sublime-befunge: vendor/grammars/sublime-befunge:
- source.befunge - source.befunge
vendor/grammars/sublime-better-typescript:
- source.ts
vendor/grammars/sublime-bsv: vendor/grammars/sublime-bsv:
- source.bsv - source.bsv
vendor/grammars/sublime-cirru: vendor/grammars/sublime-cirru:
@@ -473,8 +516,6 @@ vendor/grammars/sublime-glsl:
- source.glsl - source.glsl
vendor/grammars/sublime-golo/: vendor/grammars/sublime-golo/:
- source.golo - source.golo
vendor/grammars/sublime-idris:
- source.idris
vendor/grammars/sublime-mask: vendor/grammars/sublime-mask:
- source.mask - source.mask
vendor/grammars/sublime-netlinx: vendor/grammars/sublime-netlinx:
@@ -482,26 +523,27 @@ vendor/grammars/sublime-netlinx:
- source.netlinx.erb - source.netlinx.erb
vendor/grammars/sublime-nginx: vendor/grammars/sublime-nginx:
- source.nginx - source.nginx
vendor/grammars/sublime-nix:
- source.nix
vendor/grammars/sublime-opal/: vendor/grammars/sublime-opal/:
- source.opal - source.opal
- source.opalsysdefs - source.opalsysdefs
vendor/grammars/sublime-pony:
- source.pony
vendor/grammars/sublime-robot-plugin: vendor/grammars/sublime-robot-plugin:
- text.robot - text.robot
vendor/grammars/sublime-rust: vendor/grammars/sublime-rust:
- source.rust - source.rust
vendor/grammars/sublime-sourcepawn:
- source.sp
vendor/grammars/sublime-spintools/: vendor/grammars/sublime-spintools/:
- source.regexp.spin - source.regexp.spin
- source.spin - source.spin
vendor/grammars/sublime-tea: vendor/grammars/sublime-tea:
- source.tea - source.tea
vendor/grammars/sublime-terra:
- source.terra
vendor/grammars/sublime-text-ox/: vendor/grammars/sublime-text-ox/:
- source.ox - source.ox
vendor/grammars/sublime-text-pig-latin/: vendor/grammars/sublime-typescript/:
- source.pig_latin - source.ts
- source.tsx
vendor/grammars/sublime-varnish: vendor/grammars/sublime-varnish:
- source.varnish.vcl - source.varnish.vcl
vendor/grammars/sublime_cobol: vendor/grammars/sublime_cobol:
@@ -512,6 +554,11 @@ vendor/grammars/sublime_cobol:
vendor/grammars/sublime_man_page_support: vendor/grammars/sublime_man_page_support:
- source.man - source.man
- text.groff - text.groff
vendor/grammars/sublimeassembly/:
- source.assembly
vendor/grammars/sublimeprolog/:
- source.prolog
- source.prolog.eclipse
vendor/grammars/sublimetext-cuda-cpp: vendor/grammars/sublimetext-cuda-cpp:
- source.cuda-c++ - source.cuda-c++
vendor/grammars/swift.tmbundle: vendor/grammars/swift.tmbundle:
@@ -519,13 +566,6 @@ vendor/grammars/swift.tmbundle:
vendor/grammars/tcl.tmbundle: vendor/grammars/tcl.tmbundle:
- source.tcl - source.tcl
- text.html.tcl - text.html.tcl
vendor/grammars/text.tmbundle:
- text.plain
vendor/grammars/textile.tmbundle:
- text.html.textile
vendor/grammars/textmate.tmbundle:
- source.regexp.oniguruma
- source.tm-properties
vendor/grammars/thrift.tmbundle: vendor/grammars/thrift.tmbundle:
- source.thrift - source.thrift
vendor/grammars/toml.tmbundle: vendor/grammars/toml.tmbundle:
@@ -535,8 +575,8 @@ vendor/grammars/turtle.tmbundle:
- source.turtle - source.turtle
vendor/grammars/verilog.tmbundle: vendor/grammars/verilog.tmbundle:
- source.verilog - source.verilog
vendor/grammars/x86-assembly-textmate-bundle: vendor/grammars/vue-syntax-highlight:
- source.asm.x86 - text.html.vue
vendor/grammars/xc.tmbundle/: vendor/grammars/xc.tmbundle/:
- source.xc - source.xc
vendor/grammars/xml.tmbundle: vendor/grammars/xml.tmbundle:

View File

@@ -1,5 +1,6 @@
require 'linguist/blob_helper' require 'linguist/blob_helper'
require 'linguist/generated' require 'linguist/generated'
require 'linguist/grammars'
require 'linguist/heuristics' require 'linguist/heuristics'
require 'linguist/language' require 'linguist/language'
require 'linguist/repository' require 'linguist/repository'
@@ -8,13 +9,91 @@ require 'linguist/shebang'
require 'linguist/version' require 'linguist/version'
class << Linguist class << Linguist
# Public: Detects the Language of the blob.
#
# blob - an object that includes the Linguist `BlobHelper` interface;
# see Linguist::LazyBlob and Linguist::FileBlob for examples
#
# Returns Language or nil.
def detect(blob)
# Bail early if the blob is binary or empty.
return nil if blob.likely_binary? || blob.binary? || blob.empty?
Linguist.instrument("linguist.detection", :blob => blob) do
# Call each strategy until one candidate is returned.
languages = []
returning_strategy = nil
STRATEGIES.each do |strategy|
returning_strategy = strategy
candidates = Linguist.instrument("linguist.strategy", :blob => blob, :strategy => strategy, :candidates => languages) do
strategy.call(blob, languages)
end
if candidates.size == 1
languages = candidates
break
elsif candidates.size > 1
# More than one candidate was found, pass them to the next strategy.
languages = candidates
else
# No candidates, try the next strategy
end
end
Linguist.instrument("linguist.detected", :blob => blob, :strategy => returning_strategy, :language => languages.first)
languages.first
end
end
# Internal: The strategies used to detect the language of a file.
#
# A strategy is an object that has a `.call` method that takes two arguments:
#
# blob - An object that quacks like a blob.
# languages - An Array of candidate Language objects that were returned by the
#     previous strategy.
#
# A strategy should return an Array of Language candidates.
#
# Strategies are called in turn until a single Language is returned.
STRATEGIES = [
Linguist::Strategy::Modeline,
Linguist::Shebang,
Linguist::Strategy::Filename,
Linguist::Heuristics,
Linguist::Classifier
]
# Public: Set an instrumenter.
#
# class CustomInstrumenter
# def instrument(name, payload = {})
# warn "Instrumenting #{name}: #{payload[:blob]}"
# end
# end
#
# Linguist.instrumenter = CustomInstrumenter
#
# The instrumenter must conform to the `ActiveSupport::Notifications`
# interface, which defines `#instrument` and accepts:
#
# name - the String name of the event (e.g. "linguist.detected")
# payload - a Hash of the exception context.
attr_accessor :instrumenter attr_accessor :instrumenter
# Internal: Perform instrumentation on a block
#
# Linguist.instrument("linguist.dosomething", :blob => blob) do
# # logic to instrument here.
# end
#
def instrument(*args, &bk) def instrument(*args, &bk)
if instrumenter if instrumenter
instrumenter.instrument(*args, &bk) instrumenter.instrument(*args, &bk)
else elsif block_given?
yield if block_given? yield
end end
end end
end end

73
lib/linguist/blob.rb Normal file
View File

@@ -0,0 +1,73 @@
require 'linguist/blob_helper'
module Linguist
# A Blob is a wrapper around the content of a file to make it quack
# like a Grit::Blob. It provides the basic interface: `name`,
# `data`, `path` and `size`.
class Blob
include BlobHelper
# Public: Initialize a new Blob.
#
# path - A path String (does not necessarily exists on the file system).
# content - Content of the file.
#
# Returns a Blob.
def initialize(path, content)
@path = path
@content = content
end
# Public: Filename
#
# Examples
#
# Blob.new("/path/to/linguist/lib/linguist.rb", "").path
# # => "/path/to/linguist/lib/linguist.rb"
#
# Returns a String
attr_reader :path
# Public: File name
#
# Returns a String
def name
File.basename(@path)
end
# Public: File contents.
#
# Returns a String.
def data
@content
end
# Public: Get byte size
#
# Returns an Integer.
def size
@content.bytesize
end
# Public: Get file extension.
#
# Returns a String.
def extension
extensions.last || ""
end
# Public: Return an array of the file extensions
#
# >> Linguist::Blob.new("app/views/things/index.html.erb").extensions
# => [".html.erb", ".erb"]
#
# Returns an Array
def extensions
_, *segments = name.downcase.split(".")
segments.map.with_index do |segment, index|
"." + segments[index..-1].join(".")
end
end
end
end

View File

@@ -6,7 +6,7 @@ require 'yaml'
module Linguist module Linguist
# DEPRECATED Avoid mixing into Blob classes. Prefer functional interfaces # DEPRECATED Avoid mixing into Blob classes. Prefer functional interfaces
# like `Language.detect` over `Blob#language`. Functions are much easier to # like `Linguist.detect` over `Blob#language`. Functions are much easier to
# cache and compose. # cache and compose.
# #
# Avoid adding additional bloat to this module. # Avoid adding additional bloat to this module.
@@ -325,7 +325,7 @@ module Linguist
# #
# Returns a Language or nil if none is detected # Returns a Language or nil if none is detected
def language def language
@language ||= Language.detect(self) @language ||= Linguist.detect(self)
end end
# Internal: Get the TextMate compatible scope for the blob # Internal: Get the TextMate compatible scope for the blob

View File

@@ -13,11 +13,18 @@
- (^|/)[Dd]ocumentation/ - (^|/)[Dd]ocumentation/
- (^|/)javadoc/ - (^|/)javadoc/
- ^man/ - ^man/
- ^[Ee]xamples/
## Documentation files ## ## Documentation files ##
- (^|/)CHANGE(S|LOG)?(\.|$)
- (^|/)CONTRIBUTING(\.|$) - (^|/)CONTRIBUTING(\.|$)
- (^|/)COPYING(\.|$) - (^|/)COPYING(\.|$)
- (^|/)INSTALL(\.|$) - (^|/)INSTALL(\.|$)
- (^|/)LICEN[CS]E(\.|$) - (^|/)LICEN[CS]E(\.|$)
- (^|/)[Ll]icen[cs]e(\.|$)
- (^|/)README(\.|$) - (^|/)README(\.|$)
- (^|/)[Rr]eadme(\.|$)
# Samples folders
- ^[Ss]amples/

View File

@@ -1,10 +1,11 @@
require 'linguist/blob_helper' require 'linguist/blob_helper'
require 'linguist/blob'
module Linguist module Linguist
# A FileBlob is a wrapper around a File object to make it quack # A FileBlob is a wrapper around a File object to make it quack
# like a Grit::Blob. It provides the basic interface: `name`, # like a Grit::Blob. It provides the basic interface: `name`,
# `data`, `path` and `size`. # `data`, `path` and `size`.
class FileBlob class FileBlob < Blob
include BlobHelper include BlobHelper
# Public: Initialize a new FileBlob from a path # Public: Initialize a new FileBlob from a path
@@ -18,20 +19,6 @@ module Linguist
@path = base_path ? path.sub("#{base_path}/", '') : path @path = base_path ? path.sub("#{base_path}/", '') : path
end end
# Public: Filename
#
# Examples
#
# FileBlob.new("/path/to/linguist/lib/linguist.rb").path
# # => "/path/to/linguist/lib/linguist.rb"
#
# FileBlob.new("/path/to/linguist/lib/linguist.rb",
# "/path/to/linguist").path
# # => "lib/linguist.rb"
#
# Returns a String
attr_reader :path
# Public: Read file permissions # Public: Read file permissions
# #
# Returns a String like '100644' # Returns a String like '100644'
@@ -39,13 +26,6 @@ module Linguist
File.stat(@fullpath).mode.to_s(8) File.stat(@fullpath).mode.to_s(8)
end end
# Public: File name
#
# Returns a String
def name
File.basename(@fullpath)
end
# Public: Read file contents. # Public: Read file contents.
# #
# Returns a String. # Returns a String.
@@ -59,26 +39,5 @@ module Linguist
def size def size
File.size(@fullpath) File.size(@fullpath)
end end
# Public: Get file extension.
#
# Returns a String.
def extension
extensions.last || ""
end
# Public: Return an array of the file extensions
#
# >> Linguist::FileBlob.new("app/views/things/index.html.erb").extensions
# => [".html.erb", ".erb"]
#
# Returns an Array
def extensions
basename, *segments = name.downcase.split(".")
segments.map.with_index do |segment, index|
"." + segments[index..-1].join(".")
end
end
end end
end end

View File

@@ -53,6 +53,7 @@ module Linguist
def generated? def generated?
xcode_file? || xcode_file? ||
generated_net_designer_file? || generated_net_designer_file? ||
generated_net_specflow_feature_file? ||
composer_lock? || composer_lock? ||
node_modules? || node_modules? ||
godeps? || godeps? ||
@@ -64,10 +65,16 @@ module Linguist
generated_net_docfile? || generated_net_docfile? ||
generated_postscript? || generated_postscript? ||
compiled_cython_file? || compiled_cython_file? ||
generated_protocol_buffer_go? || generated_go? ||
generated_protocol_buffer? || generated_protocol_buffer? ||
generated_apache_thrift? ||
generated_jni_header? || generated_jni_header? ||
vcr_cassette? vcr_cassette? ||
generated_module? ||
generated_unity3d_meta? ||
generated_racc? ||
generated_jflex? ||
generated_grammarkit?
end end
# Internal: Is the blob an Xcode file? # Internal: Is the blob an Xcode file?
@@ -179,6 +186,17 @@ module Linguist
name.downcase =~ /\.designer\.cs$/ name.downcase =~ /\.designer\.cs$/
end end
# Internal: Is this a codegen file for Specflow feature file?
#
# Visual Studio's SpecFlow extension generates *.feature.cs files
# from *.feature files, they are not meant to be consumed by humans.
# Let's hide them.
#
# Returns true or false
def generated_net_specflow_feature_file?
name.downcase =~ /\.feature\.cs$/
end
# Internal: Is the blob of JS a parser generated by PEG.js? # Internal: Is the blob of JS a parser generated by PEG.js?
# #
# PEG.js-generated parsers are not meant to be consumed by humans. # PEG.js-generated parsers are not meant to be consumed by humans.
@@ -219,24 +237,38 @@ module Linguist
creator.include?("ImageMagick") creator.include?("ImageMagick")
end end
def generated_protocol_buffer_go? def generated_go?
return false unless extname == '.go' return false unless extname == '.go'
return false unless lines.count > 1 return false unless lines.count > 1
return lines[0].include?("Code generated by protoc-gen-go") return lines[0].include?("Code generated by")
end end
PROTOBUF_EXTENSIONS = ['.py', '.java', '.h', '.cc', '.cpp']
# Internal: Is the blob a C++, Java or Python source file generated by the # Internal: Is the blob a C++, Java or Python source file generated by the
# Protocol Buffer compiler? # Protocol Buffer compiler?
# #
# Returns true of false. # Returns true of false.
def generated_protocol_buffer? def generated_protocol_buffer?
return false unless ['.py', '.java', '.h', '.cc', '.cpp'].include?(extname) return false unless PROTOBUF_EXTENSIONS.include?(extname)
return false unless lines.count > 1 return false unless lines.count > 1
return lines[0].include?("Generated by the protocol buffer compiler. DO NOT EDIT!") return lines[0].include?("Generated by the protocol buffer compiler. DO NOT EDIT!")
end end
APACHE_THRIFT_EXTENSIONS = ['.rb', '.py', '.go', '.js', '.m', '.java', '.h', '.cc', '.cpp']
# Internal: Is the blob generated by Apache Thrift compiler?
#
# Returns true or false
def generated_apache_thrift?
return false unless APACHE_THRIFT_EXTENSIONS.include?(extname)
return false unless lines.count > 1
return lines[0].include?("Autogenerated by Thrift Compiler") || lines[1].include?("Autogenerated by Thrift Compiler")
end
# Internal: Is the blob a C/C++ header generated by the Java JNI tool javah? # Internal: Is the blob a C/C++ header generated by the Java JNI tool javah?
# #
# Returns true of false. # Returns true of false.
@@ -299,5 +331,76 @@ module Linguist
return false unless lines.count > 1 return false unless lines.count > 1
return lines[0].include?("Generated by Cython") return lines[0].include?("Generated by Cython")
end end
# Internal: Is it a KiCAD or GFortran module file?
#
# KiCAD module files contain:
# PCBNEW-LibModule-V1 yyyy-mm-dd h:mm:ss XM
# on the first line.
#
# GFortran module files contain:
# GFORTRAN module version 'x' created from
# on the first line.
#
# Return true of false
def generated_module?
return false unless extname == '.mod'
return false unless lines.count > 1
return lines[0].include?("PCBNEW-LibModule-V") ||
lines[0].include?("GFORTRAN module version '")
end
# Internal: Is this a metadata file from Unity3D?
#
# Unity3D Meta files start with:
# fileFormatVersion: X
# guid: XXXXXXXXXXXXXXX
#
# Return true or false
def generated_unity3d_meta?
return false unless extname == '.meta'
return false unless lines.count > 1
return lines[0].include?("fileFormatVersion: ")
end
# Internal: Is this a Racc-generated file?
#
# A Racc-generated file contains:
# # This file is automatically generated by Racc x.y.z
# on the third line.
#
# Return true or false
def generated_racc?
return false unless extname == '.rb'
return false unless lines.count > 2
return lines[2].start_with?("# This file is automatically generated by Racc")
end
# Internal: Is this a JFlex-generated file?
#
# A JFlex-generated file contains:
# /* The following code was generated by JFlex x.y.z on d/at/e ti:me */
# on the first line.
#
# Return true or false
def generated_jflex?
return false unless extname == '.java'
return false unless lines.count > 1
return lines[0].start_with?("/* The following code was generated by JFlex ")
end
# Internal: Is this a GrammarKit-generated file?
#
# A GrammarKit-generated file typically contain:
# // This is a generated file. Not intended for manual editing.
# on the first line. This is not always the case, as it's possible to
# customize the class header.
#
# Return true or false
def generated_grammarkit?
return false unless extname == '.java'
return false unless lines.count > 1
return lines[0].start_with?("// This is a generated file. Not intended for manual editing.")
end
end end
end end

View File

@@ -1,6 +1,3 @@
# Note: This file is included in the github-linguist-grammars gem, not the
# github-linguist gem.
module Linguist module Linguist
module Grammars module Grammars
# Get the path to the directory containing the language grammar JSON files. # Get the path to the directory containing the language grammar JSON files.

View File

@@ -13,11 +13,14 @@ module Linguist
# ]) # ])
# #
# Returns an Array of languages, or empty if none matched or were inconclusive. # Returns an Array of languages, or empty if none matched or were inconclusive.
def self.call(blob, languages) def self.call(blob, candidates)
data = blob.data data = blob.data
@heuristics.each do |heuristic| @heuristics.each do |heuristic|
return Array(heuristic.call(data)) if heuristic.matches?(languages) if heuristic.matches?(blob.name)
languages = Array(heuristic.call(data))
return languages if languages.any? || languages.all? { |l| candidates.include?(l) }
end
end end
[] # No heuristics matched [] # No heuristics matched
@@ -30,7 +33,7 @@ module Linguist
# #
# Examples # Examples
# #
# disambiguate "Perl", "Prolog" do |data| # disambiguate ".pm" do |data|
# if data.include?("use strict") # if data.include?("use strict")
# Language["Perl"] # Language["Perl"]
# elsif /^[^#]+:-/.match(data) # elsif /^[^#]+:-/.match(data)
@@ -38,22 +41,23 @@ module Linguist
# end # end
# end # end
# #
def self.disambiguate(*languages, &heuristic) def self.disambiguate(*extensions, &heuristic)
@heuristics << new(languages, &heuristic) @heuristics << new(extensions, &heuristic)
end end
# Internal: Array of defined heuristics # Internal: Array of defined heuristics
@heuristics = [] @heuristics = []
# Internal # Internal
def initialize(languages, &heuristic) def initialize(extensions, &heuristic)
@languages = languages @extensions = extensions
@heuristic = heuristic @heuristic = heuristic
end end
# Internal: Check if this heuristic matches the candidate languages. # Internal: Check if this heuristic matches the candidate languages.
def matches?(candidates) def matches?(filename)
candidates.any? && candidates.all? { |l| @languages.include?(l.name) } filename = filename.downcase
@extensions.any? { |ext| filename.end_with?(ext) }
end end
# Internal: Perform the heuristic # Internal: Perform the heuristic
@@ -62,9 +66,19 @@ module Linguist
end end
# Common heuristics # Common heuristics
ObjectiveCRegex = /^[ \t]*@(interface|class|protocol|property|end|synchronised|selector|implementation)\b/ ObjectiveCRegex = /^\s*(@(interface|class|protocol|property|end|synchronised|selector|implementation)\b|#import\s+.+\.h[">])/
disambiguate "BitBake", "BlitzBasic" do |data| disambiguate ".asc" do |data|
if /^(----[- ]BEGIN|ssh-(rsa|dss)) /.match(data)
Language["Public Key"]
elsif /^[=-]+(\s|\n)|{{[A-Za-z]/.match(data)
Language["AsciiDoc"]
elsif /^(\/\/.+|((import|export)\s+)?(function|int|float|char)\s+((room|repeatedly|on|game)_)?([A-Za-z]+[A-Za-z_0-9]+)\s*[;\(])/.match(data)
Language["AGS Script"]
end
end
disambiguate ".bb" do |data|
if /^\s*; /.match(data) || data.include?("End Function") if /^\s*; /.match(data) || data.include?("End Function")
Language["BlitzBasic"] Language["BlitzBasic"]
elsif /^\s*(# |include|require)\b/.match(data) elsif /^\s*(# |include|require)\b/.match(data)
@@ -72,64 +86,14 @@ module Linguist
end end
end end
disambiguate "C#", "Smalltalk" do |data| disambiguate ".ch" do |data|
if /![\w\s]+methodsFor: /.match(data) if /^\s*#\s*(if|ifdef|ifndef|define|command|xcommand|translate|xtranslate|include|pragma|undef)\b/i.match(data)
Language["Smalltalk"] Language["xBase"]
elsif /^\s*namespace\s*[\w\.]+\s*{/.match(data) || /^\s*\/\//.match(data)
Language["C#"]
end end
end end
disambiguate "Objective-C", "C++", "C" do |data| disambiguate ".cl" do |data|
if ObjectiveCRegex.match(data) if /^\s*\((defun|in-package|defpackage) /i.match(data)
Language["Objective-C"]
elsif (/^\s*#\s*include <(cstdint|string|vector|map|list|array|bitset|queue|stack|forward_list|unordered_map|unordered_set|(i|o|io)stream)>/.match(data) ||
/^\s*template\s*</.match(data) || /^[ \t]*try/.match(data) || /^[ \t]*catch\s*\(/.match(data) || /^[ \t]*(class|(using[ \t]+)?namespace)\s+\w+/.match(data) || /^[ \t]*(private|public|protected):$/.match(data) || /std::\w+/.match(data))
Language["C++"]
end
end
disambiguate "Perl", "Perl6", "Prolog" do |data|
if data.include?("use v6")
Language["Perl6"]
elsif data.match(/use strict|use\s+v?5\./)
Language["Perl"]
elsif /^[^#]+:-/.match(data)
Language["Prolog"]
end
end
disambiguate "ECL", "Prolog" do |data|
if /^[^#]+:-/.match(data)
Language["Prolog"]
elsif data.include?(":=")
Language["ECL"]
end
end
disambiguate "IDL", "Prolog", "INI", "QMake" do |data|
if /^[^#]+:-/.match(data)
Language["Prolog"]
elsif data.include?("last_client=")
Language["INI"]
elsif data.include?("HEADERS") && data.include?("SOURCES")
Language["QMake"]
elsif /^\s*function[ \w,]+$/.match(data)
Language["IDL"]
end
end
disambiguate "GAP", "Scilab" do |data|
if (data.include?("gap> "))
Language["GAP"]
# Heads up - we don't usually write heuristics like this (with no regex match)
else
Language["Scilab"]
end
end
disambiguate "Common Lisp", "OpenCL", "Cool" do |data|
if data.include?("(defun ")
Language["Common Lisp"] Language["Common Lisp"]
elsif /^class/x.match(data) elsif /^class/x.match(data)
Language["Cool"] Language["Cool"]
@@ -138,41 +102,59 @@ module Linguist
end end
end end
disambiguate "Hack", "PHP" do |data| disambiguate ".cs" do |data|
if data.include?("<?hh") if /![\w\s]+methodsFor: /.match(data)
Language["Hack"] Language["Smalltalk"]
elsif /<?[^h]/.match(data) elsif /^\s*namespace\s*[\w\.]+\s*{/.match(data) || /^\s*\/\//.match(data)
Language["PHP"] Language["C#"]
end end
end end
disambiguate "Scala", "SuperCollider" do |data| disambiguate ".d" do |data|
if /\^(this|super)\./.match(data) || /^\s*(\+|\*)\s*\w+\s*{/.match(data) || /^\s*~\w+\s*=\./.match(data) if /^module /.match(data)
Language["SuperCollider"] Language["D"]
elsif /^\s*import (scala|java)\./.match(data) || /^\s*val\s+\w+\s*=/.match(data) || /^\s*class\b/.match(data) elsif /^((dtrace:::)?BEGIN|provider |#pragma (D (option|attributes)|ident)\s)/.match(data)
Language["Scala"] Language["DTrace"]
elsif /(\/.*:( .* \\)$| : \\$|^ : |: \\$)/.match(data)
Language["Makefile"]
end end
end end
disambiguate "AsciiDoc", "AGS Script", "Public Key" do |data| disambiguate ".ecl" do |data|
if /^[=-]+(\s|\n)|{{[A-Za-z]/.match(data) if /^[^#]+:-/.match(data)
Language["AsciiDoc"] Language["ECLiPSe"]
elsif /^(\/\/.+|((import|export)\s+)?(function|int|float|char)\s+((room|repeatedly|on|game)_)?([A-Za-z]+[A-Za-z_0-9]+)\s*[;\(])/.match(data) elsif data.include?(":=")
Language["AGS Script"] Language["ECL"]
elsif /^-----BEGIN/.match(data)
Language["Public Key"]
end end
end end
disambiguate "FORTRAN", "Forth", "Formatted" do |data| disambiguate ".es" do |data|
if /^\s*(?:%%|main\s*\(.*?\)\s*->)/.match(data)
Language["Erlang"]
elsif /(?:\/\/|("|')use strict\1|export\s+default\s|\/\*.*?\*\/)/m.match(data)
Language["JavaScript"]
end
end
disambiguate ".for", ".f" do |data|
if /^: /.match(data) if /^: /.match(data)
Language["Forth"] Language["Forth"]
elsif /^([c*][^a-z]| (subroutine|program)\s|\s*!)/i.match(data) elsif /^([c*][^abd-z]| (subroutine|program|end)\s|\s*!)/i.match(data)
Language["FORTRAN"] Language["FORTRAN"]
end end
end end
disambiguate "F#", "Forth", "GLSL", "Filterscript" do |data| disambiguate ".fr" do |data|
if /^(: |also |new-device|previous )/.match(data)
Language["Forth"]
elsif /^\s*(import|module|package|data|type) /.match(data)
Language["Frege"]
else
Language["Text"]
end
end
disambiguate ".fs" do |data|
if /^(: |new-device)/.match(data) if /^(: |new-device)/.match(data)
Language["Forth"] Language["Forth"]
elsif /^\s*(#light|import|let|module|namespace|open|type)/.match(data) elsif /^\s*(#light|import|let|module|namespace|open|type)/.match(data)
@@ -184,7 +166,48 @@ module Linguist
end end
end end
disambiguate "M", "MUF", "Mathematica", "Matlab", "Mercury", "Objective-C" do |data| disambiguate ".gs" do |data|
Language["Gosu"] if /^uses java\./.match(data)
end
disambiguate ".h" do |data|
if ObjectiveCRegex.match(data)
Language["Objective-C"]
elsif (/^\s*#\s*include <(cstdint|string|vector|map|list|array|bitset|queue|stack|forward_list|unordered_map|unordered_set|(i|o|io)stream)>/.match(data) ||
/^\s*template\s*</.match(data) || /^[ \t]*try/.match(data) || /^[ \t]*catch\s*\(/.match(data) || /^[ \t]*(class|(using[ \t]+)?namespace)\s+\w+/.match(data) || /^[ \t]*(private|public|protected):$/.match(data) || /std::\w+/.match(data))
Language["C++"]
end
end
disambiguate ".l" do |data|
if /\(def(un|macro)\s/.match(data)
Language["Common Lisp"]
elsif /^(%[%{}]xs|<.*>)/.match(data)
Language["Lex"]
elsif /^\.[a-z][a-z](\s|$)/i.match(data)
Language["Groff"]
elsif /^\((de|class|rel|code|data|must)\s/.match(data)
Language["PicoLisp"]
end
end
disambiguate ".ls" do |data|
if /^\s*package\s*[\w\.\/\*\s]*\s*{/.match(data)
Language["LoomScript"]
else
Language["LiveScript"]
end
end
disambiguate ".lsp", ".lisp" do |data|
if /^\s*\((defun|in-package|defpackage) /i.match(data)
Language["Common Lisp"]
elsif /^\s*\(define /.match(data)
Language["NewLisp"]
end
end
disambiguate ".m" do |data|
if ObjectiveCRegex.match(data) if ObjectiveCRegex.match(data)
Language["Objective-C"] Language["Objective-C"]
elsif data.include?(":- module") elsif data.include?(":- module")
@@ -197,49 +220,149 @@ module Linguist
Language["Mathematica"] Language["Mathematica"]
elsif /^\s*%/.match(data) elsif /^\s*%/.match(data)
Language["Matlab"] Language["Matlab"]
elsif /^\w+\s*:\s*module\s*{/.match(data)
Language["Limbo"]
end end
end end
disambiguate "Gosu", "JavaScript" do |data| disambiguate ".ml" do |data|
Language["Gosu"] if /^uses java\./.match(data) if /(^\s*module)|let rec |match\s+(\S+\s)+with/.match(data)
end Language["OCaml"]
elsif /=> |case\s+(\S+\s)+of/.match(data)
disambiguate "LoomScript", "LiveScript" do |data| Language["Standard ML"]
if /^\s*package\s*[\w\.\/\*\s]*\s*{/.match(data)
Language["LoomScript"]
else
Language["LiveScript"]
end end
end end
disambiguate "Common Lisp", "NewLisp" do |data| disambiguate ".mod" do |data|
if /^\s*\((defun|in-package|defpackage) /.match(data) if data.include?('<!ENTITY ')
Language["Common Lisp"]
elsif /^\s*\(define /.match(data)
Language["NewLisp"]
end
end
disambiguate "TypeScript", "XML" do |data|
if data.include?("<TS ")
Language["XML"] Language["XML"]
elsif /MODULE\s\w+\s*;/i.match(data) || /^\s*END \w+;$/i.match(data)
Language["Modula-2"]
else else
Language["TypeScript"] [Language["Linux Kernel Module"], Language["AMPL"]]
end end
end end
disambiguate "Frege", "Forth", "Text" do |data| disambiguate ".ms" do |data|
if /^(: |also |new-device|previous )/.match(data) if /^[.'][a-z][a-z](\s|$)/i.match(data)
Language["Forth"] Language["Groff"]
elsif /^\s*(import|module|package|data|type) /.match(data) elsif /(?<!\S)\.(include|globa?l)\s/.match(data) || /(?<!\/\*)(\A|\n)\s*\.[A-Za-z]/.match(data.gsub(/"([^\\"]|\\.)*"|'([^\\']|\\.)*'|\\\s*(?:--.*)?\n/, ""))
Language["Frege"] Language["GAS"]
else else
Language["MAXScript"]
end
end
disambiguate ".n" do |data|
if /^[.']/.match(data)
Language["Groff"]
elsif /^(module|namespace|using)\s/.match(data)
Language["Nemerle"]
end
end
disambiguate ".ncl" do |data|
if data.include?("THE_TITLE")
Language["Text"] Language["Text"]
end end
end end
disambiguate "PLSQL", "SQLPL", "PLpgSQL", "SQL" do |data| disambiguate ".nl" do |data|
if /^\\i\b|AS \$\$|LANGUAGE '+plpgsql'+/i.match(data) || /SECURITY (DEFINER|INVOKER)/i.match(data) || /BEGIN( WORK| TRANSACTION)?;/i.match(data) if /^(b|g)[0-9]+ /.match(data)
Language["NL"]
else
Language["NewLisp"]
end
end
disambiguate ".php" do |data|
if data.include?("<?hh")
Language["Hack"]
elsif /<?[^h]/.match(data)
Language["PHP"]
end
end
disambiguate ".pl" do |data|
if /^[^#]+:-/.match(data)
Language["Prolog"]
elsif /use strict|use\s+v?5\./.match(data)
Language["Perl"]
elsif /^(use v6|(my )?class|module)/.match(data)
Language["Perl6"]
end
end
disambiguate ".pm", ".t" do |data|
if /use strict|use\s+v?5\./.match(data)
Language["Perl"]
elsif /^(use v6|(my )?class|module)/.match(data)
Language["Perl6"]
end
end
disambiguate ".pod" do |data|
if /^=\w+$/.match(data)
Language["Pod"]
else
Language["Perl"]
end
end
disambiguate ".pro" do |data|
if /^[^#]+:-/.match(data)
Language["Prolog"]
elsif data.include?("last_client=")
Language["INI"]
elsif data.include?("HEADERS") && data.include?("SOURCES")
Language["QMake"]
elsif /^\s*function[ \w,]+$/.match(data)
Language["IDL"]
end
end
disambiguate ".props" do |data|
if /^(\s*)(<Project|<Import|<Property|<?xml|xmlns)/i.match(data)
Language["XML"]
elsif /\w+\s*=\s*/i.match(data)
Language["INI"]
end
end
disambiguate ".r" do |data|
if /\bRebol\b/i.match(data)
Language["Rebol"]
elsif data.include?("<-")
Language["R"]
end
end
disambiguate ".rpy" do |data|
if /(^(import|from|class|def)\s)/m.match(data)
Language["Python"]
else
Language["Ren'Py"]
end
end
disambiguate ".rs" do |data|
if /^(use |fn |mod |pub |macro_rules|impl|#!?\[)/.match(data)
Language["Rust"]
elsif /#include|#pragma\s+(rs|version)|__attribute__/.match(data)
Language["RenderScript"]
end
end
disambiguate ".sc" do |data|
if /\^(this|super)\./.match(data) || /^\s*(\+|\*)\s*\w+\s*{/.match(data) || /^\s*~\w+\s*=\./.match(data)
Language["SuperCollider"]
elsif /^\s*import (scala|java)\./.match(data) || /^\s*val\s+\w+\s*=/.match(data) || /^\s*class\b/.match(data)
Language["Scala"]
end
end
disambiguate ".sql" do |data|
if /^\\i\b|AS \$\$|LANGUAGE '?plpgsql'?/i.match(data) || /SECURITY (DEFINER|INVOKER)/i.match(data) || /BEGIN( WORK| TRANSACTION)?;/i.match(data)
#Postgres #Postgres
Language["PLpgSQL"] Language["PLpgSQL"]
elsif /(alter module)|(language sql)|(begin( NOT)+ atomic)/i.match(data) || /signal SQLSTATE '[0-9]+'/i.match(data) elsif /(alter module)|(language sql)|(begin( NOT)+ atomic)/i.match(data) || /signal SQLSTATE '[0-9]+'/i.match(data)
@@ -254,37 +377,20 @@ module Linguist
end end
end end
disambiguate "D", "DTrace", "Makefile" do |data| disambiguate ".ts" do |data|
if /^module /.match(data) if data.include?("<TS ")
Language["D"] Language["XML"]
elsif /^((dtrace:::)?BEGIN|provider |#pragma (D (option|attributes)|ident)\s)/.match(data)
Language["DTrace"]
elsif /(\/.*:( .* \\)$| : \\$|^ : |: \\$)/.match(data)
Language["Makefile"]
end
end
disambiguate "OCaml", "Standard ML" do |data|
if /module|let rec |match\s+(\S+\s)+with/.match(data)
Language["OCaml"]
elsif /=> |case\s+(\S+\s)+of/.match(data)
Language["Standard ML"]
end
end
disambiguate "NL", "NewLisp" do |data|
if /^g3 /.match(data)
Language["NL"]
else else
Language["NewLisp"] Language["TypeScript"]
end end
end end
disambiguate "Rust", "RenderScript" do |data| disambiguate ".tst" do |data|
if data.include?("^(use |fn |mod |pub |macro_rules|impl|#!?\[)") if (data.include?("gap> "))
Language["Rust"] Language["GAP"]
elsif /#include|#pragma\s+(rs|version)|__attribute__/.match(data) # Heads up - we don't usually write heuristics like this (with no regex match)
Language["RenderScript"] else
Language["Scilab"]
end end
end end
end end

View File

@@ -87,14 +87,6 @@ module Linguist
language language
end end
STRATEGIES = [
Linguist::Strategy::Modeline,
Linguist::Shebang,
Linguist::Strategy::Filename,
Linguist::Heuristics,
Linguist::Classifier
]
# Public: Detects the Language of the blob. # Public: Detects the Language of the blob.
# #
# blob - an object that includes the Linguist `BlobHelper` interface; # blob - an object that includes the Linguist `BlobHelper` interface;
@@ -102,34 +94,8 @@ module Linguist
# #
# Returns Language or nil. # Returns Language or nil.
def self.detect(blob) def self.detect(blob)
# Bail early if the blob is binary or empty. warn "[DEPRECATED] `Linguist::Language.detect` is deprecated. Use `Linguist.detect`. #{caller[0]}"
return nil if blob.likely_binary? || blob.binary? || blob.empty? Linguist.detect(blob)
Linguist.instrument("linguist.detection", :blob => blob) do
# Call each strategy until one candidate is returned.
languages = []
returning_strategy = nil
STRATEGIES.each do |strategy|
returning_strategy = strategy
candidates = Linguist.instrument("linguist.strategy", :blob => blob, :strategy => strategy, :candidates => languages) do
strategy.call(blob, languages)
end
if candidates.size == 1
languages = candidates
break
elsif candidates.size > 1
# More than one candidate was found, pass them to the next strategy.
languages = candidates
else
# No candidates, try the next strategy
end
end
Linguist.instrument("linguist.detected", :blob => blob, :strategy => returning_strategy, :language => languages.first)
languages.first
end
end end
# Public: Get all Languages # Public: Get all Languages
@@ -150,7 +116,8 @@ module Linguist
# #
# Returns the Language or nil if none was found. # Returns the Language or nil if none was found.
def self.find_by_name(name) def self.find_by_name(name)
name && @name_index[name.downcase] return nil if name.to_s.empty?
name && (@name_index[name.downcase] || @name_index[name.split(',').first.downcase])
end end
# Public: Look up Language by one of its aliases. # Public: Look up Language by one of its aliases.
@@ -164,7 +131,8 @@ module Linguist
# #
# Returns the Language or nil if none was found. # Returns the Language or nil if none was found.
def self.find_by_alias(name) def self.find_by_alias(name)
name && @alias_index[name.downcase] return nil if name.to_s.empty?
name && (@alias_index[name.downcase] || @alias_index[name.split(',').first.downcase])
end end
# Public: Look up Languages by filename. # Public: Look up Languages by filename.
@@ -240,7 +208,8 @@ module Linguist
# #
# Returns the Language or nil if none was found. # Returns the Language or nil if none was found.
def self.[](name) def self.[](name)
name && @index[name.downcase] return nil if name.to_s.empty?
name && (@index[name.downcase] || @index[name.split(',').first.downcase])
end end
# Public: A List of popular languages # Public: A List of popular languages
@@ -541,7 +510,7 @@ module Linguist
if extnames = extensions[name] if extnames = extensions[name]
extnames.each do |extname| extnames.each do |extname|
if !options['extensions'].index { |x| x.downcase.end_with? extname.downcase } if !options['extensions'].index { |x| x.downcase.end_with? extname.downcase }
warn "#{name} has a sample with extension (#{extname.downcase}) that isn't explicitly defined in languages.yml" unless extname == '.script!' warn "#{name} has a sample with extension (#{extname.downcase}) that isn't explicitly defined in languages.yml"
options['extensions'] << extname options['extensions'] << extname
end end
end end

791
lib/linguist/languages.yml Normal file → Executable file

File diff suppressed because it is too large Load Diff

View File

@@ -4,7 +4,11 @@ require 'rugged'
module Linguist module Linguist
class LazyBlob class LazyBlob
GIT_ATTR = ['linguist-documentation', 'linguist-language', 'linguist-vendored'] GIT_ATTR = ['linguist-documentation',
'linguist-language',
'linguist-vendored',
'linguist-generated']
GIT_ATTR_OPTS = { :priority => [:index], :skip_system => true } GIT_ATTR_OPTS = { :priority => [:index], :skip_system => true }
GIT_ATTR_FLAGS = Rugged::Repository::Attributes.parse_opts(GIT_ATTR_OPTS) GIT_ATTR_FLAGS = Rugged::Repository::Attributes.parse_opts(GIT_ATTR_OPTS)
@@ -24,6 +28,7 @@ module Linguist
@oid = oid @oid = oid
@path = path @path = path
@mode = mode @mode = mode
@data = nil
end end
def git_attributes def git_attributes
@@ -31,14 +36,6 @@ module Linguist
name, GIT_ATTR, GIT_ATTR_FLAGS) name, GIT_ATTR, GIT_ATTR_FLAGS)
end end
def vendored?
if attr = git_attributes['linguist-vendored']
return boolean_attribute(attr)
else
return super
end
end
def documentation? def documentation?
if attr = git_attributes['linguist-documentation'] if attr = git_attributes['linguist-documentation']
boolean_attribute(attr) boolean_attribute(attr)
@@ -47,6 +44,22 @@ module Linguist
end end
end end
def generated?
if attr = git_attributes['linguist-generated']
boolean_attribute(attr)
else
super
end
end
def vendored?
if attr = git_attributes['linguist-vendored']
return boolean_attribute(attr)
else
super
end
end
def language def language
return @language if defined?(@language) return @language if defined?(@language)
@@ -67,11 +80,15 @@ module Linguist
@size @size
end end
def cleanup!
@data.clear if @data
end
protected protected
# Returns true if the attribute is present and not the string "false". # Returns true if the attribute is present and not the string "false".
def boolean_attribute(attr) def boolean_attribute(attribute)
attr != "false" attribute != "false"
end end
def load_blob! def load_blob!

View File

@@ -30,6 +30,9 @@ module Linguist
@repository = repo @repository = repo
@commit_oid = commit_oid @commit_oid = commit_oid
@old_commit_oid = nil
@old_stats = nil
raise TypeError, 'commit_oid must be a commit SHA1' unless commit_oid.is_a?(String) raise TypeError, 'commit_oid must be a commit SHA1' unless commit_oid.is_a?(String)
end end
@@ -126,12 +129,13 @@ module Linguist
end end
protected protected
MAX_TREE_SIZE = 100_000
def compute_stats(old_commit_oid, cache = nil) def compute_stats(old_commit_oid, cache = nil)
return {} if current_tree.count_recursive(MAX_TREE_SIZE) >= MAX_TREE_SIZE
old_tree = old_commit_oid && Rugged::Commit.lookup(repository, old_commit_oid).tree old_tree = old_commit_oid && Rugged::Commit.lookup(repository, old_commit_oid).tree
read_index read_index
diff = Rugged::Tree.diff(repository, old_tree, current_tree) diff = Rugged::Tree.diff(repository, old_tree, current_tree)
# Clear file map and fetch full diff if any .gitattributes files are changed # Clear file map and fetch full diff if any .gitattributes files are changed
@@ -150,15 +154,19 @@ module Linguist
next if delta.binary next if delta.binary
if [:added, :modified].include? delta.status if [:added, :modified].include? delta.status
# Skip submodules # Skip submodules and symlinks
mode = delta.new_file[:mode] mode = delta.new_file[:mode]
next if (mode & 040000) != 0 mode_format = (mode & 0170000)
next if mode_format == 0120000 || mode_format == 040000 || mode_format == 0160000
blob = Linguist::LazyBlob.new(repository, delta.new_file[:oid], new, mode.to_s(8)) blob = Linguist::LazyBlob.new(repository, delta.new_file[:oid], new, mode.to_s(8))
next unless blob.include_in_language_stats? if blob.include_in_language_stats?
file_map[new] = [blob.language.group.name, blob.size] file_map[new] = [blob.language.group.name, blob.size]
end end
blob.cleanup!
end
end end
file_map file_map

View File

@@ -50,16 +50,13 @@ module Linguist
end end
else else
path = File.join(dirname, filename) path = File.join(dirname, filename)
extname = File.extname(filename)
if File.extname(filename) == ""
raise "#{path} is missing an extension, maybe it belongs in filenames/ subdir"
end
yield({ yield({
:path => path, :path => path,
:language => category, :language => category,
:interpreter => Shebang.interpreter(File.read(path)), :interpreter => Shebang.interpreter(File.read(path)),
:extname => File.extname(filename) :extname => extname.empty? ? nil : extname
}) })
end end
end end

View File

@@ -23,23 +23,29 @@ module Linguist
# First line must start with #! # First line must start with #!
return unless shebang && shebang.start_with?("#!") return unless shebang && shebang.start_with?("#!")
# Get the parts of the shebang without the #! s = StringScanner.new(shebang)
tokens = shebang.sub(/^#!\s*/, '').strip.split(' ')
# There was nothing after the #! # There was nothing after the #!
return if tokens.empty? return unless path = s.scan(/^#!\s*\S+/)
# Get the name of the interpreter # Keep going
script = File.basename(tokens.first) script = path.split('/').last
# Get next argument if interpreter was /usr/bin/env # if /usr/bin/env type shebang then walk the string
script = tokens[1] if script == 'env' if script == 'env'
s.scan(/\s+/)
s.scan(/.*=[^\s]+\s+/) # skip over variable arguments e.g. foo=bar
script = s.scan(/\S+/)
end
# Interpreter was /usr/bin/env with no arguments # Interpreter was /usr/bin/env with no arguments
return unless script return unless script
# "python2.6" -> "python2" # "python2.6" -> "python2"
script.sub! /(\.\d+)$/, '' script.sub!(/(\.\d+)$/, '')
# #! perl -> perl
script.sub!(/^#!\s*/, '')
# Check for multiline shebang hacks that call `exec` # Check for multiline shebang hacks that call `exec`
if script == 'sh' && if script == 'sh' &&

View File

@@ -3,17 +3,7 @@ module Linguist
# Detects language based on filename and/or extension # Detects language based on filename and/or extension
class Filename class Filename
def self.call(blob, _) def self.call(blob, _)
name = blob.name.to_s Language.find_by_filename(blob.name.to_s)
# A bit of an elegant hack. If the file is executable but extensionless,
# append a "magic" extension so it can be classified with other
# languages that have shebang scripts.
extensions = FileBlob.new(name).extensions
if extensions.empty? && blob.mode && (blob.mode.to_i(8) & 05) == 05
name += ".script!"
end
Language.find_by_filename(name)
end end
end end
end end

View File

@@ -1,8 +1,19 @@
module Linguist module Linguist
module Strategy module Strategy
class Modeline class Modeline
EmacsModeline = /-\*-\s*(?:(?!mode)[\w-]+\s*:\s*(?:[\w+-]+)\s*;?\s*)*(?:mode\s*:)?\s*([\w+-]+)\s*(?:;\s*(?!mode)[\w-]+\s*:\s*[\w+-]+\s*)*;?\s*-\*-/i EMACS_MODELINE = /-\*-\s*(?:(?!mode)[\w-]+\s*:\s*(?:[\w+-]+)\s*;?\s*)*(?:mode\s*:)?\s*([\w+-]+)\s*(?:;\s*(?!mode)[\w-]+\s*:\s*[\w+-]+\s*)*;?\s*-\*-/i
VimModeline = /\/\*\s*vim:\s*set\s*(?:ft|filetype)=(\w+):\s*\*\//i
# First form vim modeline
# [text]{white}{vi:|vim:|ex:}[white]{options}
# ex: 'vim: syntax=ruby'
VIM_MODELINE_1 = /(?:vim|vi|ex):\s*(?:ft|filetype|syntax)=(\w+)\s?/i
# Second form vim modeline (compatible with some versions of Vi)
# [text]{white}{vi:|vim:|Vim:|ex:}[white]se[t] {options}:[text]
# ex: 'vim set syntax=ruby:'
VIM_MODELINE_2 = /(?:vim|vi|Vim|ex):\s*se(?:t)?.*\s(?:ft|filetype|syntax)=(\w+)\s?.*:/i
MODELINES = [EMACS_MODELINE, VIM_MODELINE_1, VIM_MODELINE_2]
# Public: Detects language based on Vim and Emacs modelines # Public: Detects language based on Vim and Emacs modelines
# #
@@ -22,7 +33,7 @@ module Linguist
# #
# Returns a String or nil # Returns a String or nil
def self.modeline(data) def self.modeline(data)
match = data.match(EmacsModeline) || data.match(VimModeline) match = MODELINES.map { |regex| data.match(regex) }.reject(&:nil?).first
match[1] if match match[1] if match
end end
end end

View File

@@ -22,8 +22,10 @@ module Linguist
# Start state on token, ignore anything till the next newline # Start state on token, ignore anything till the next newline
SINGLE_LINE_COMMENTS = [ SINGLE_LINE_COMMENTS = [
'//', # C '//', # C
'--', # Ada, Haskell, AppleScript
'#', # Ruby '#', # Ruby
'%', # Tex '%', # Tex
'"', # Vim
] ]
# Start state on opening token, ignore anything until the closing # Start state on opening token, ignore anything until the closing
@@ -84,17 +86,17 @@ module Linguist
if s.peek(1) == "\"" if s.peek(1) == "\""
s.getch s.getch
else else
s.skip_until(/[^\\]"/) s.skip_until(/(?<!\\)"/)
end end
elsif s.scan(/'/) elsif s.scan(/'/)
if s.peek(1) == "'" if s.peek(1) == "'"
s.getch s.getch
else else
s.skip_until(/[^\\]'/) s.skip_until(/(?<!\\)'/)
end end
# Skip number literals # Skip number literals
elsif s.scan(/(0x)?\d(\d|\.)*/) elsif s.scan(/(0x\h(\h|\.)*|\d(\d|\.)*)([uU][lL]{0,2}|([eE][-+]\d*)?[fFlL]*)/)
# SGML style brackets # SGML style brackets
elsif token = s.scan(/<[^\s<>][^<>]*>/) elsif token = s.scan(/<[^\s<>][^<>]*>/)
@@ -130,6 +132,9 @@ module Linguist
# extract_shebang("#!/usr/bin/env node") # extract_shebang("#!/usr/bin/env node")
# # => "node" # # => "node"
# #
# extract_shebang("#!/usr/bin/env A=B foo=bar awk -f")
# # => "awk"
#
# Returns String token or nil it couldn't be parsed. # Returns String token or nil it couldn't be parsed.
def extract_shebang(data) def extract_shebang(data)
s = StringScanner.new(data) s = StringScanner.new(data)
@@ -138,6 +143,7 @@ module Linguist
script = path.split('/').last script = path.split('/').last
if script == 'env' if script == 'env'
s.scan(/\s+/) s.scan(/\s+/)
s.scan(/.*=[^\s]+\s+/)
script = s.scan(/\S+/) script = s.scan(/\S+/)
end end
script = script[/[^\d]+/, 0] if script script = script[/[^\d]+/, 0] if script

View File

@@ -20,10 +20,17 @@
- ^deps/ - ^deps/
- ^tools/ - ^tools/
- (^|/)configure$ - (^|/)configure$
- (^|/)configure.ac$
- (^|/)config.guess$ - (^|/)config.guess$
- (^|/)config.sub$ - (^|/)config.sub$
# stuff autogenerated by autoconf - still C deps
- (^|/)aclocal.m4
- (^|/)libtool.m4
- (^|/)ltoptions.m4
- (^|/)ltsugar.m4
- (^|/)ltversion.m4
- (^|/)lt~obsolete.m4
# Linters # Linters
- cpplint.py - cpplint.py
@@ -70,6 +77,7 @@
- 3rd[-_]?party/ - 3rd[-_]?party/
- vendors?/ - vendors?/
- extern(al)?/ - extern(al)?/
- (^|/)[Vv]+endor/
# Debian packaging # Debian packaging
- ^debian/ - ^debian/
@@ -77,6 +85,9 @@
# Haxelib projects often contain a neko bytecode file named run.n # Haxelib projects often contain a neko bytecode file named run.n
- run.n$ - run.n$
# Bootstrap Datepicker
- bootstrap-datepicker/
## Commonly Bundled JavaScript frameworks ## ## Commonly Bundled JavaScript frameworks ##
# jQuery # jQuery
@@ -87,6 +98,34 @@
- (^|/)jquery\-ui(\-\d\.\d+(\.\d+)?)?(\.\w+)?\.(js|css)$ - (^|/)jquery\-ui(\-\d\.\d+(\.\d+)?)?(\.\w+)?\.(js|css)$
- (^|/)jquery\.(ui|effects)\.([^.]*)\.(js|css)$ - (^|/)jquery\.(ui|effects)\.([^.]*)\.(js|css)$
# jQuery Gantt
- jquery.fn.gantt.js
# jQuery fancyBox
- jquery.fancybox.(js|css)
# Fuel UX
- fuelux.js
# jQuery File Upload
- (^|/)jquery\.fileupload(-\w+)?\.js$
# Slick
- (^|/)slick\.\w+.js$
# Leaflet plugins
- (^|/)Leaflet\.Coordinates-\d+\.\d+\.\d+\.src\.js$
- leaflet.draw-src.js
- leaflet.draw.css
- Control.FullScreen.css
- Control.FullScreen.js
- leaflet.spin.js
- wicket-leaflet.js
# Sublime Text workspace files
- .sublime-project
- .sublime-workspace
# Prototype # Prototype
- (^|/)prototype(.*)\.js$ - (^|/)prototype(.*)\.js$
- (^|/)effects\.js$ - (^|/)effects\.js$
@@ -121,7 +160,7 @@
- (^|/)Chart\.js$ - (^|/)Chart\.js$
# Codemirror # Codemirror
- (^|/)[Cc]ode[Mm]irror/(lib|mode|theme|addon|keymap) - (^|/)[Cc]ode[Mm]irror/(\d+\.\d+/)?(lib|mode|theme|addon|keymap|demo)
# SyntaxHighlighter - http://alexgorbatchev.com/ # SyntaxHighlighter - http://alexgorbatchev.com/
- (^|/)shBrush([^.]*)\.js$ - (^|/)shBrush([^.]*)\.js$
@@ -163,12 +202,31 @@
## Obj-C ## ## Obj-C ##
# Xcode
- \.xctemplate/
- \.imageset/
# Carthage
- ^Carthage/
# Cocoapods # Cocoapods
- ^Pods/ - ^Pods/
# Sparkle # Sparkle
- (^|/)Sparkle/ - (^|/)Sparkle/
# Crashlytics
- Crashlytics.framework/
# Fabric
- Fabric.framework/
# git config files
- gitattributes$
- gitignore$
- gitmodules$
## Groovy ## ## Groovy ##
# Gradle # Gradle
@@ -213,21 +271,9 @@
# Html5shiv # Html5shiv
- (^|/)html5shiv\.js$ - (^|/)html5shiv\.js$
# Samples folders
- ^[Ss]amples/
# LICENSE, README, git config files
- ^COPYING$
- LICENSE$
- License$
- gitattributes$
- gitignore$
- gitmodules$
- ^README$
- ^readme$
# Test fixtures # Test fixtures
- ^[Tt]ests?/fixtures/ - ^[Tt]ests?/fixtures/
- ^[Ss]pecs?/fixtures/
# PhoneGap/Cordova # PhoneGap/Cordova
- (^|/)cordova([^.]*)\.js$ - (^|/)cordova([^.]*)\.js$
@@ -263,3 +309,6 @@
# Android Google APIs # Android Google APIs
- (^|/)\.google_apis/ - (^|/)\.google_apis/
# Jenkins Pipeline
- ^Jenkinsfile$

View File

@@ -1,3 +1,3 @@
module Linguist module Linguist
VERSION = "4.5.4" VERSION = "4.8.2"
end end

View File

@@ -2,5 +2,6 @@
"repository": "https://github.com/github/linguist", "repository": "https://github.com/github/linguist",
"dependencies": { "dependencies": {
"season": "~>5.0" "season": "~>5.0"
} },
"license": "MIT"
} }

58
samples/AMPL/CT2.mod Normal file
View File

@@ -0,0 +1,58 @@
param num_beams; # number of beams
param num_rows >= 1, integer; # number of rows
param num_cols >= 1, integer; # number of columns
set BEAMS := 1 .. num_beams; # set of beams
set ROWS := 1 .. num_rows; # set of rows
set COLUMNS := 1 .. num_cols; # set of columns
# values for entries of each beam
param beam_values {BEAMS, ROWS, COLUMNS} >= 0;
# values of tumor
param tumor_values {ROWS, COLUMNS} >= 0;
# values of critical area
param critical_values {ROWS, COLUMNS} >= 0;
# critical maximum dosage requirement
param critical_max;
# tumor minimum dosage requirement
param tumor_min;
# dosage scalar of each beam
var X {i in BEAMS} >= 0;
# define the tumor area which includes the locations where tumor exists
set tumor_area := {k in ROWS, h in COLUMNS: tumor_values[k,h] > 0};
# define critical area
set critical_area := {k in ROWS, h in COLUMNS: critical_values[k,h] > 0};
var S {(k,h) in tumor_area} >= 0;
var T {(k,h) in critical_area} >= 0;
# maximize total dosage in tumor area
maximize total_tumor_dosage: sum {i in BEAMS} sum {(k,h) in tumor_area} X[i] * beam_values[i,k,h];
# minimize total dosage in critical area
minimize total_critical_dosage: sum {i in BEAMS} sum {(k,h) in critical_area} X[i] * beam_values[i,k,h];
# minimize total tumor slack
minimize total_tumor_slack: sum {(k,h) in tumor_area} S[k,h];
# minimize total critical area slack
minimize total_critical_slack: sum {(k,h) in critical_area} T[k,h];
# total dosage at each tumor location [k,h] should be >= min tumor dosage with slack variable
subject to tumor_limit {(k,h) in tumor_area} : sum {i in BEAMS} X[i] * beam_values[i,k,h] == tumor_min - S[k,h];
# total dosage at each critical location [k,h] should be = max critical dosage with slack variable
subject to critical_limit {(k,h) in critical_area} : sum {i in BEAMS} X[i] * beam_values[i,k,h] == critical_max + T[k,h];

View File

@@ -0,0 +1,55 @@
FORMAT: 1A
# Advanced Action API
A resource action is in fact a state transition. This API example demonstrates an action - state transition - to another resource.
## API Blueprint
+ [Previous: Resource Model](11.%20Resource%20Model.md)
+ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/11.%20Advanced%20Action.md)
# Tasks [/tasks/tasks{?status,priority}]
+ Parameters
+ status (string)
+ priority (number)
## List All Tasks [GET]
+ Response 200 (application/json)
[
{
"id": 123,
"name": "Exercise in gym",
"done": false,
"type": "task"
},
{
"id": 124,
"name": "Shop for groceries",
"done": true,
"type": "task"
}
]
## Retrieve Task [GET /task/{id}]
This is a state transition to another resource
+ Parameters
+ id (string)
+ Response 200 (application/json)
{
"id": 123,
"name": "Go to gym",
"done": false,
"type": "task"
}
## Delete Task [DELETE /task/{id}]
+ Parameters
+ id (string)
+ Response 204

View File

@@ -0,0 +1,39 @@
FORMAT: 1A
# Attributes API
This API example demonstrates how to describe body attributes of a request or response message.
In this case, the description is complementary (and duplicate!) to the provided JSON example in the body section. The [Advanced Attributes](09.%20Advanced%20Attributes.md) API example will demonstrate how to avoid duplicates and how to reuse attributes descriptions.
## API Blueprint
+ [Previous: Parameters](07.%20Parameters.md)
+ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/08.%20Attributes.md)
+ [Next: Advanced Attributes](09.%20Advanced%20Attributes.md)
# Group Coupons
## Coupon [/coupons/{id}]
A coupon contains information about a percent-off or amount-off discount you might want to apply to a customer.
### Retrieve a Coupon [GET]
Retrieves the coupon with the given ID.
+ Response 200 (application/json)
+ Attributes (object)
+ id: 250FF (string)
+ created: 1415203908 (number) - Time stamp
+ percent_off: 25 (number)
A positive integer between 1 and 100 that represents the discount the coupon will apply.
+ redeem_by (number) - Date after which the coupon can no longer be redeemed
+ Body
{
"id": "250FF",
"created": 1415203908,
"percent_off": 25,
"redeem_by:" null
}

View File

@@ -0,0 +1,18 @@
FORMAT: 1A
# The Simplest API
This is one of the simplest APIs written in the **API Blueprint**.
One plain resource combined with a method and that's it! We will explain what is going on in the next installment - [Resource and Actions](02.%20Resource%20and%20Actions.md).
**Note:** As we progress through the examples, do not also forget to view the [Raw](https://raw.github.com/apiaryio/api-blueprint/master/examples/01.%20Simplest%20API.md) code to see what is really going on in the API Blueprint, as opposed to just seeing the output of the Github Markdown parser.
Also please keep in mind that every single example in this course is a **real API Blueprint** and as such you can **parse** it with the [API Blueprint parser](https://github.com/apiaryio/drafter) or one of its [bindings](https://github.com/apiaryio/drafter#bindings).
## API Blueprint
+ [This: Raw API Blueprint](https://raw.github.com/apiaryio/api-blueprint/master/examples/01.%20Simplest%20API.md)
+ [Next: Resource and Actions](02.%20Resource%20and%20Actions.md)
# GET /message
+ Response 200 (text/plain)
Hello World!

View File

@@ -0,0 +1,17 @@
#######################
# HOSTNAME
######################
<VirtualHost 127.0.0.1:PORT>
ServerAdmin patrick@heysparkbox.com
DocumentRoot "/var/www/HOSTNAME"
ServerName HOSTNAME
<Directory "/var/www/HOSTNAME">
Options Indexes MultiViews FollowSymLinks
AllowOverride All
Order allow,deny
Allow from all
DirectoryIndex index.php
</Directory>
</VirtualHost>

View File

@@ -1,6 +1,9 @@
AsciiDoc Home Page AsciiDoc Home Page
================== ==================
Title
-----
Example Articles Example Articles
~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~
- Item 1 - Item 1

View File

@@ -0,0 +1,245 @@
push r2
dint
nop
bis #MPYDLYWRTEN,&MPY32CTL0
bic #MPYDLY32,&MPY32CTL0
mov #SUMEXT,r13
clr r12
mov @r15+,r4
mov @r15+,r5
mov @r15+,r6
mov @r15+,r7
mov @r15+,r8
mov @r15+,r9
mov @r15+,r10
mov @r15+,r11
sub #2*8,r15
/* SELF_STEP_FIRST */
mov r4,&MPY32L
mov r5,&MPY32H
mov r4,&OP2L
mov r5,&OP2H
/* COLUMN_END */
mov &RES0,2*0(r14)
mov &RES1,2*(0+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
/* STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov r6,&OP2L
mov r7,&OP2H
add &SUMEXT,r12
mov r6,&OP2L
mov r7,&OP2H
/* COLUMN_END */
mov &RES0,2*2(r14)
add @r13,r12
mov &RES1,2*(2+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov r8,&OP2L
mov r9,&OP2H
add &SUMEXT,r12
mov r8,&OP2L
mov r9,&OP2H
/* SELF_STEP */
mov r6,&MAC32L
mov r7,&MAC32H
add @r13,r12
mov r6,&OP2L
mov r7,&OP2H
/* COLUMN_END */
mov &RES0,2*4(r14)
add @r13,r12
mov &RES1,2*(4+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov r10,&OP2L
mov r11,&OP2H
add &SUMEXT,r12
mov r10,&OP2L
mov r11,&OP2H
/* STEP_2MORE */
mov r6,&MAC32L
mov r7,&MAC32H
add @r13,r12
mov r8,&OP2L
mov r9,&OP2H
add &SUMEXT,r12
mov r8,&OP2L
mov r9,&OP2H
/* COLUMN_END */
mov &RES0,2*6(r14)
add @r13,r12
mov &RES1,2*(6+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov 2*8(r15),&OP2L
mov 2*9(r15),&OP2H
add &SUMEXT,r12
mov 2*8(r15),&OP2L
mov 2*9(r15),&OP2H
/* STEP_2MORE */
mov r6,&MAC32L
mov r7,&MAC32H
add @r13,r12
mov r10,&OP2L
mov r11,&OP2H
add &SUMEXT,r12
mov r10,&OP2L
mov r11,&OP2H
/* SELF_STEP */
mov r8,&MAC32L
mov r9,&MAC32H
add @r13,r12
mov r8,&OP2L
mov r9,&OP2H
/* COLUMN_END */
mov &RES0,2*8(r14)
add @r13,r12
mov &RES1,2*(8+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
mov 2*8(r15),r4
mov 2*(8+1)(r15),r5
/* STEP_1 */
mov r6,&MAC32L
mov r7,&MAC32H
mov r4,&OP2L
mov r5,&OP2H
add &SUMEXT,r12
mov r4,&OP2L
mov r5,&OP2H
/* STEP_2MORE */
mov r8,&MAC32L
mov r9,&MAC32H
add @r13,r12
mov r10,&OP2L
mov r11,&OP2H
add &SUMEXT,r12
mov r10,&OP2L
mov r11,&OP2H
/* COLUMN_END */
mov &RES0,2*10(r14)
add @r13,r12
mov &RES1,2*(10+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r8,&MAC32L
mov r9,&MAC32H
mov r4,&OP2L
mov r5,&OP2H
add &SUMEXT,r12
mov r4,&OP2L
mov r5,&OP2H
/* SELF_STEP */
mov r10,&MAC32L
mov r11,&MAC32H
add @r13,r12
mov r10,&OP2L
mov r11,&OP2H
/* COLUMN_END */
mov &RES0,2*12(r14)
add @r13,r12
mov &RES1,2*(12+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* STEP_1 */
mov r10,&MAC32L
mov r11,&MAC32H
mov r4,&OP2L
mov r5,&OP2H
add &SUMEXT,r12
mov r4,&OP2L
mov r5,&OP2H
/* COLUMN_END */
mov &RES0,2*14(r14)
add @r13,r12
mov &RES1,2*(14+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* SELF_STEP_1 */
mov r4,&MAC32L
mov r5,&MAC32H
mov r4,&OP2L
mov r5,&OP2H
/* COLUMN_END */
mov &RES0,2*16(r14)
add @r13,r12
mov &RES1,2*(16+1)(r14)
mov &RES2,&RES0
mov &RES3,&RES1
mov r12,&RES2
clr &RES3
clr r12
/* END */
mov &RES0,2*18(r14)
mov &RES1,2*(18+1)(r14)
pop r2
eint

170
samples/Assembly/lib.inc Normal file
View File

@@ -0,0 +1,170 @@
; ------------------------------------------------------------------------
; 显示 AL 中的数字
; ------------------------------------------------------------------------
DispAL:
push ecx
push edx
push edi
mov edi, [dwDispPos]
mov ah, 0Fh ; 0000b: 黑底 1111b: 白字
mov dl, al
shr al, 4
mov ecx, 2
.begin:
and al, 01111b
cmp al, 9
ja .1
add al, '0'
jmp .2
.1:
sub al, 0Ah
add al, 'A'
.2:
mov [gs:edi], ax
add edi, 2
mov al, dl
loop .begin
;add edi, 2
mov [dwDispPos], edi
pop edi
pop edx
pop ecx
ret
; DispAL 结束-------------------------------------------------------------
; ------------------------------------------------------------------------
; 显示一个整形数
; ------------------------------------------------------------------------
DispInt:
mov eax, [esp + 4]
shr eax, 24
call DispAL
mov eax, [esp + 4]
shr eax, 16
call DispAL
mov eax, [esp + 4]
shr eax, 8
call DispAL
mov eax, [esp + 4]
call DispAL
mov ah, 07h ; 0000b: 黑底 0111b: 灰字
mov al, 'h'
push edi
mov edi, [dwDispPos]
mov [gs:edi], ax
add edi, 4
mov [dwDispPos], edi
pop edi
ret
; DispInt 结束------------------------------------------------------------
; ------------------------------------------------------------------------
; 显示一个字符串
; ------------------------------------------------------------------------
DispStr:
push ebp
mov ebp, esp
push ebx
push esi
push edi
mov esi, [ebp + 8] ; pszInfo
mov edi, [dwDispPos]
mov ah, 0Fh
.1:
lodsb
test al, al
jz .2
cmp al, 0Ah ; 是回车吗?
jnz .3
push eax
mov eax, edi
mov bl, 160
div bl
and eax, 0FFh
inc eax
mov bl, 160
mul bl
mov edi, eax
pop eax
jmp .1
.3:
mov [gs:edi], ax
add edi, 2
jmp .1
.2:
mov [dwDispPos], edi
pop edi
pop esi
pop ebx
pop ebp
ret
; DispStr 结束------------------------------------------------------------
; ------------------------------------------------------------------------
; 换行
; ------------------------------------------------------------------------
DispReturn:
push szReturn
call DispStr ;printf("\n");
add esp, 4
ret
; DispReturn 结束---------------------------------------------------------
; ------------------------------------------------------------------------
; 内存拷贝,仿 memcpy
; ------------------------------------------------------------------------
; void* MemCpy(void* es:pDest, void* ds:pSrc, int iSize);
; ------------------------------------------------------------------------
MemCpy:
push ebp
mov ebp, esp
push esi
push edi
push ecx
mov edi, [ebp + 8] ; Destination
mov esi, [ebp + 12] ; Source
mov ecx, [ebp + 16] ; Counter
.1:
cmp ecx, 0 ; 判断计数器
jz .2 ; 计数器为零时跳出
mov al, [ds:esi] ;
inc esi ;
; 逐字节移动
mov byte [es:edi], al ;
inc edi ;
dec ecx ; 计数器减一
jmp .1 ; 循环
.2:
mov eax, [ebp + 8] ; 返回值
pop ecx
pop edi
pop esi
mov esp, ebp
pop ebp
ret ; 函数结束,返回
; MemCpy 结束-------------------------------------------------------------

321
samples/Assembly/macros.inc Normal file
View File

@@ -0,0 +1,321 @@
BLARGG_MACROS_INCLUDED = 1
; Allows extra error checking with modified version
; of ca65. Otherwise acts like a constant of 0.
ADDR = 0
; Switches to Segment and places Line there.
; Line can be an .align directive, .res, .byte, etc.
; Examples:
; seg_data BSS, .align 256
; seg_data RODATA, {message: .byte "Test",0}
.macro seg_data Segment, Line
.pushseg
.segment .string(Segment)
Line
.popseg
.endmacro
; Reserves Size bytes in Segment for Name.
; If Size is omitted, reserves one byte.
.macro seg_res Segment, Name, Size
.ifblank Size
seg_data Segment, Name: .res 1
.else
seg_data Segment, Name: .res Size
.endif
.endmacro
; Shortcuts for zeropage, bss, and stack
.define zp_res seg_res ZEROPAGE,
.define nv_res seg_res NVRAM,
.define bss_res seg_res BSS,
.define sp_res seg_res STACK,
.define zp_byte zp_res
; Copies byte from Src to Addr. If Src begins with #,
; it sets Addr to the immediate value.
; Out: A = byte copied
; Preserved: X, Y
.macro mov Addr, Src
lda Src
sta Addr
.endmacro
; Copies word from Src to Addr. If Src begins with #,
; it sets Addr the immediate value.
; Out: A = high byte of word
; Preserved: X, Y
.macro movw Addr, Src
.if .match( .left( 1, {Src} ), # )
lda #<(.right( .tcount( {Src} )-1, {Src} ))
sta Addr
lda #>(.right( .tcount( {Src} )-1, {Src} ))
sta 1+(Addr)
.else
lda Src
sta Addr
lda 1+(Src)
sta 1+(Addr)
.endif
.endmacro
; Increments 16-bit value at Addr.
; Out: EQ/NE based on resulting 16-bit value
; Preserved: A, X, Y
.macro incw Addr
.local @Skip
inc Addr
bne @Skip
inc 1+(Addr)
@Skip:
.endmacro
; Adds Src to word at Addr.
; Out: A = high byte of result, carry set appropriately
; Preserved: X, Y
.macro addw Addr, Src
.if .match( .left( 1, {Src} ), # )
addw_ Addr,(.right( .tcount( {Src} )-1, {Src} ))
.else
lda Addr
clc
adc Src
sta Addr
lda 1+(Addr)
adc 1+(Src)
sta 1+(Addr)
.endif
.endmacro
.macro addw_ Addr, Imm
lda Addr
clc
adc #<Imm
sta Addr
;.if (Imm >> 8) <> 0
lda 1+(Addr)
adc #>Imm
sta 1+(Addr)
;.else
; .local @Skip
; bcc @Skip
; inc 1+(Addr)
;@Skip:
;.endif
.endmacro
; Splits list of words into tables of low and high bytes
; Example: split_words foo, {$1234, $5678}
; expands to:
; foo_l: $34, $78
; foo_h: $12, $56
; foo_count = 2
.macro split_words Label, Words
.ident (.concat (.string(Label), "_l")): .lobytes Words
.ident (.concat (.string(Label), "_h")): .hibytes Words
.ident (.concat (.string(Label), "_count")) = * - .ident (.concat (.string(Label), "_h"))
.endmacro
.macro SELECT Bool, True, False, Extra
.ifndef Bool
False Extra
.elseif Bool <> 0
True Extra
.else
False Extra
.endif
.endmacro
.macro DEFAULT Name, Value
.ifndef Name
Name = Value
.endif
.endmacro
.ifp02
; 6502 doesn't define these alternate names
.define blt bcc
.define bge bcs
.endif
.define jlt jcc
.define jge jcs
; Jxx Target = Bxx Target, except it can go farther than
; 128 bytes. Implemented via branch around a JMP.
; Don't use ca65's longbranch, because they fail for @labels
;.macpack longbranch
.macro jeq Target
bne *+5
jmp Target
.endmacro
.macro jne Target
beq *+5
jmp Target
.endmacro
.macro jmi Target
bpl *+5
jmp Target
.endmacro
.macro jpl Target
bmi *+5
jmp Target
.endmacro
.macro jcs Target
bcc *+5
jmp Target
.endmacro
.macro jcc Target
bcs *+5
jmp Target
.endmacro
.macro jvs Target
bvc *+5
jmp Target
.endmacro
.macro jvc Target
bvs *+5
jmp Target
.endmacro
; Passes constant data to routine in addr
; Preserved: A, X, Y
.macro jsr_with_addr routine,data
.local Addr
pha
lda #<Addr
sta addr
lda #>Addr
sta addr+1
pla
jsr routine
seg_data RODATA,{Addr: data}
.endmacro
; Calls routine multiple times, with A having the
; value 'start' the first time, 'start+step' the
; second time, up to 'end' for the last time.
.macro for_loop routine,start,end,step
.local @for_loop
lda #start
@for_loop:
pha
jsr routine
pla
clc
adc #step
cmp #<((end)+(step))
bne @for_loop
.endmacro
; Calls routine n times. The value of A in the routine
; counts from 0 to n-1.
.macro loop_n_times routine,n
for_loop routine,0,n-1,+1
.endmacro
; Same as for_loop, except uses 16-bit value in YX.
; -256 <= step <= 255
.macro for_loop16 routine,start,end,step
.if (step) < -256 || (step) > 255
.error "Step must be within -256 to 255"
.endif
.local @for_loop_skip
.local @for_loop
ldy #>(start)
lda #<(start)
@for_loop:
tax
pha
tya
pha
jsr routine
pla
tay
pla
clc
adc #step
.if (step) > 0
bcc @for_loop_skip
iny
.else
bcs @for_loop_skip
dey
.endif
@for_loop_skip:
cmp #<((end)+(step))
bne @for_loop
cpy #>((end)+(step))
bne @for_loop
.endmacro
; Stores byte at addr
; Preserved: X, Y
.macro setb addr, byte
lda #byte
sta addr
.endmacro
; Stores word at addr
; Preserved: X, Y
.macro setw addr, word
lda #<(word)
sta addr
lda #>(word)
sta addr+1
.endmacro
; Loads XY with 16-bit immediate or value at address
.macro ldxy Arg
.if .match( .left( 1, {Arg} ), # )
ldy #<(.right( .tcount( {Arg} )-1, {Arg} ))
ldx #>(.right( .tcount( {Arg} )-1, {Arg} ))
.else
ldy (Arg)
ldx (Arg)+1
.endif
.endmacro
; Increments XY as 16-bit register, in CONSTANT time.
; Z flag set based on entire result.
; Preserved: A
; Time: 7 clocks
.macro inxy
iny ; 2
beq *+4 ; 3
; -1
bne *+3 ; 3
; -1
inx ; 2
.endmacro
; Negates A and adds it to operand
.macro subaf Operand
eor #$FF
sec
adc Operand
.endmacro
; Initializes CPU registers to reasonable values
; Preserved: A, Y
.macro init_cpu_regs
sei
cld ; unnecessary on NES, but might help on clone
ldx #$FF
txs
.ifndef BUILD_NSF
inx
stx PPUCTRL
.endif
.endmacro

195
samples/Brainfuck/factor.b Normal file
View File

@@ -0,0 +1,195 @@
* factor an arbitrarily large positive integer
*
* Copyright (C) 1999 by Brian Raiter
* under the GNU General Public License
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-
*
* read in the number
*
<<<<<<<<<+
[-[>>>>>>>>>>][-]<<<<<<<<<<[[->>>>>>>>>>+<<<<<<<<<<]<<<<<<<<<<]
>>>>>>>>>>,----------]
>>>>>>>>>>[------------------------------------->>>>>>>>>->]
<[+>[>>>>>>>>>+>]<-<<<<<<<<<<]-
*
* display the number and initialize the loop variable to two
*
[>++++++++++++++++++++++++++++++++++++++++++++++++.
------------------------------------------------<<<<<<<<<<<]
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.
--------------------------.[-]
>>>>>>>>>>>>++<<<<+
*
* the main loop
*
[ [-]>>
*
* make copies of the number and the loop variable
*
[>>>>[-]>[-]>[-]>[-]
>[-]>[-]
<<<<<<<[->>>+>+<<<<]>>>>>>>>]
<<<<<<<<<<[>>>>>>[-<<<<+>>>>]<<<<<<<<<<<<<<<<]>>>>>>>>>>
[>[->>>+>>+<<<<<]>>>>>>>>>]
<<<<<<<<<<[>>>>>>[-<<<<<+>>>>>]<<<<<<<<<<<<<<<<]>>>>>>>>>>
*
* divide the number by the loop variable
*
[>>>[-]>>>[-]>[-]>>>] initialize
<<<<<<<<<<[<<<<<<<<<<]
>>>>>>>>>[-]>>>>>>>+<<<<<<<<[+]+
[ ->> double divisor until above dividend
[>>>>>>[->++<]>>>>]<<<<<<<<<<
[>>>>>>>>[-]>[-]
<<<<[->>>++<<<]<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<
[->--------->>>>>>>>>+<<<<<<<<<<[->+<]]]]]]]]]]]>>]
<<<<<<<<<<[>>>>>>>>>[-<+<<<+>>>>]<<<<<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>[-<+>
[-<--------->>>>>>>>>>>+<<<<<<<<<<[-<+>]]]]]]]]]]]>>>]
<<<<<<<<<<
[>>>>[->>>+>>+<<<<<]<<<<<<<<<<<<<<]
>>>>>>>>>>[>>>>>>>[-<<<+>>>]>>>]<<<<<<<<<<
[>>>>>>>>[->-<]>
[<<<<<<<<<[<[-]>>>>>>>>>>[-<<<<<<<<<<+>>>>>>>>>>]<<<<<<<<<<<<<<<<<<<]
>>>>>>>>>>>>>>>>>>>]
<<<<<<<<<<<<<<<<<<<]
>>>>>>>>>[+[+[+[+[+[+[+[+[+[+[[-]<+>]]]]]]]]]]]<
]
>>>>>>>>
[ subtract divisor from dividend
<<<<<<
[>>>>>>>>[-]>[-]<<<<<[->>>+>+<<<<]>>>>>>]<<<<<<<<<<
[>>>>>>>>[-<<<<+>>>>]<<<[->>>+>+<<<<]<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>>[-<<<<+>>>>]>]<<<<<<<<<<
[>>>>>>>>[-<->]<<<<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<[->+<
[++++++++++[+>-<]>>>>>>>>>>-<<<<<<<<<<]]]]]]]]]]]>>>]
>>>>>>>+
[ if difference is nonnegative then
[-]<<<<<<<<<<<<<<<<< replace dividend and increment quotient
[>>>>[-]>>>>[-<<<<+>>>>]<<[->>+<<]<<<<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>[->+<<<+>>]>>]<<<<<<<<<<
[>>>[->>>>>>+<<<<<<]<<<<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>>[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
[-<<<<<<+>>>>>>[-<<<<<<+>>>>>>
[-<<<<<<+>>>>>>[-<<<<<<--------->>>>>>>>>>>>>>>>+<<<<<<<<<<
[-<<<<<<+>>>>>>]]]]]]]]]]]>]
>>>>>>>
] halve divisor and loop until zero
<<<<<<<<<<<<<<<<<[<<<<<<<<<<]>>>>>>>>>>
[>>>>>>>>[-]<<[->+<]<[->>>+<<<]>>>>>]<<<<<<<<<<
[+>>>>>>>[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
[-<<<<<<<+>>>>>>>[-<<<<<<<->>>>>>+>
[-<<<<<<<+>>>>>>>]]]]]]]]]<<<<<<<
[->>>>>>>+<<<<<<<]-<<<<<<<<<<]
>>>>>>>
[-<<<<<<<<<<<+>>>>>>>>>>>]
>>>[>>>>>>>[-<<<<<<<<<<<+++++>>>>>>>>>>>]>>>]<<<<<<<<<<
[+>>>>>>>>[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
[-<<<<<<<<+>>>>>>>>[-<<<<<<<<->>>>>+>>>
[-<<<<<<<<+>>>>>>>>]]]]]]]]]<<<<<<<<
[->>>>>>>>+<<<<<<<<]-<<<<<<<<<<]
>>>>>>>>[-<<<<<<<<<<<<<+>>>>>>>>>>>>>]>>
[>>>>>>>>[-<<<<<<<<<<<<<+++++>>>>>>>>>>>>>]>>]<<<<<<<<<<
[<<<<<<<<<<]>>>>>>>>>>
>>>>>>
]
<<<<<<
*
* make copies of the loop variable and the quotient
*
[>>>[->>>>+>+<<<<<]>>>>>>>]
<<<<<<<<<<
[>>>>>>>[-<<<<+>>>>]<<<<<[->>>>>+>>+<<<<<<<]<<<<<<<<<<<<]
>>>>>>>>>>[>>>>>>>[-<<<<<+>>>>>]>>>]<<<<<<<<<<
*
* break out of the loop if the quotient is larger than the loop variable
*
[>>>>>>>>>[-<->]<
[<<<<<<<<
[<<[-]>>>>>>>>>>[-<<<<<<<<<<+>>>>>>>>>>]<<<<<<<<<<<<<<<<<<]
>>>>>>>>>>>>>>>>>>]<<<<<<<<<<<<<<<<<<]
>>>>>>>>[>-<[+[+[+[+[+[+[+[+[+[[-]>+<]]]]]]]]]]]>+
[ [-]
*
* partially increment the loop variable
*
<[-]+>>>>+>>>>>>>>[>>>>>>>>>>]<<<<<<<<<<
*
* examine the remainder for nonzero digits
*
[<<<<<<[<<<<[<<<<<<<<<<]>>>>+<<<<<<<<<<]<<<<]
>>>>>>>>>>>>>>>>>>>>[>>>>>>>>>>]<<<<<<<<<<[<<<<<<<<<<]
>>>>-
[ [+]
*
* decrement the loop variable and replace the number with the quotient
*
>>>>>>>>-<<[>[-]>>[-<<+>>]>>>>>>>]<<<<<<<<<<
*
* display the loop variable
*
[+>>[>>>>>>>>+>>]<<-<<<<<<<<<<]-
[>>++++++++++++++++++++++++++++++++++++++++++++++++.
------------------------------------------------<<<<<<<<<<<<]
++++++++++++++++++++++++++++++++.[-]>>>>
]
*
* normalize the loop variable
*
>>>>>>
[>>[->>>>>+<<<<<[->>>>>+<<<<<
[->>>>>+<<<<<[->>>>>+<<<<<
[->>>>>+<<<<<[->>>>>+<<<<<
[->>>>>+<<<<<[->>>>>+<<<<<
[->>>>>+<<<<<[->>>>>--------->>>>>+<<<<<<<<<<
[->>>>>+<<<<<]]]]]]]]]]]>>>>>>>>]
<<<<<<<<<<[>>>>>>>[-<<<<<+>>>>>]<<<<<<<<<<<<<<<<<]
>>>>>>>>>
]<
]>>
*
* display the number and end
*
[>>>>>>>>>>]<<<<<<<<<<[+>[>>>>>>>>>+>]<-<<<<<<<<<<]-
[>++++++++++++++++++++++++++++++++++++++++++++++++.<<<<<<<<<<<]
++++++++++.

86
samples/C#/build.cake Normal file
View File

@@ -0,0 +1,86 @@
///////////////////////////////////////////////////////////////////////////////
// ARGUMENTS
///////////////////////////////////////////////////////////////////////////////
var target = Argument<string>("target", "Default");
var configuration = Argument<string>("configuration", "Release");
///////////////////////////////////////////////////////////////////////////////
// GLOBAL VARIABLES
///////////////////////////////////////////////////////////////////////////////
var solutions = GetFiles("./**/*.sln");
var solutionPaths = solutions.Select(solution => solution.GetDirectory());
///////////////////////////////////////////////////////////////////////////////
// SETUP / TEARDOWN
///////////////////////////////////////////////////////////////////////////////
Setup(() =>
{
// Executed BEFORE the first task.
Information("Running tasks...");
});
Teardown(() =>
{
// Executed AFTER the last task.
Information("Finished running tasks.");
});
///////////////////////////////////////////////////////////////////////////////
// TASK DEFINITIONS
///////////////////////////////////////////////////////////////////////////////
Task("Clean")
.Does(() =>
{
// Clean solution directories.
foreach(var path in solutionPaths)
{
Information("Cleaning {0}", path);
CleanDirectories(path + "/**/bin/" + configuration);
CleanDirectories(path + "/**/obj/" + configuration);
}
});
Task("Restore")
.Does(() =>
{
// Restore all NuGet packages.
foreach(var solution in solutions)
{
Information("Restoring {0}...", solution);
NuGetRestore(solution);
}
});
Task("Build")
.IsDependentOn("Clean")
.IsDependentOn("Restore")
.Does(() =>
{
// Build all solutions.
foreach(var solution in solutions)
{
Information("Building {0}", solution);
MSBuild(solution, settings =>
settings.SetPlatformTarget(PlatformTarget.MSIL)
.WithProperty("TreatWarningsAsErrors","true")
.WithTarget("Build")
.SetConfiguration(configuration));
}
});
///////////////////////////////////////////////////////////////////////////////
// TARGETS
///////////////////////////////////////////////////////////////////////////////
Task("Default")
.IsDependentOn("Build");
///////////////////////////////////////////////////////////////////////////////
// EXECUTION
///////////////////////////////////////////////////////////////////////////////
RunTarget(target);

View File

@@ -0,0 +1,57 @@
//===- ClasspathVMSystem/Properties.cpp -----------------------------------===//
//===--------------------- GNU classpath gnu/classpath/VMSystemProperties -===//
//
// The VMKit project
//
// This file is distributed under the University of Illinois Open Source
// License. See LICENSE.TXT for details.
//
//===----------------------------------------------------------------------===//
#include <sys/utsname.h>
#include "types.h"
#include "Classpath.h"
#include "JavaArray.h"
#include "JavaClass.h"
#include "JavaObject.h"
#include "JavaThread.h"
#include "JavaUpcalls.h"
#include "Jnjvm.h"
#include "SetProperties.inc"
using namespace j3;
extern "C" {
JNIEXPORT void JNICALL Java_gnu_classpath_VMSystemProperties_preInit(
#ifdef NATIVE_JNI
JNIEnv *env,
jclass clazz,
#endif
JavaObject* prop) {
llvm_gcroot(prop, 0);
BEGIN_NATIVE_EXCEPTION(0)
setProperties(prop);
END_NATIVE_EXCEPTION
}
extern "C" void Java_gnu_classpath_VMSystemProperties_postInit__Ljava_util_Properties_2(JavaObject* prop) {
llvm_gcroot(prop, 0);
BEGIN_NATIVE_EXCEPTION(0)
setCommandLineProperties(prop);
END_NATIVE_EXCEPTION
}
}

2764
samples/C++/initClasses.inc Normal file

File diff suppressed because it is too large Load Diff

34
samples/C++/instances.inc Normal file
View File

@@ -0,0 +1,34 @@
#include "QPBO.h"
#ifdef _MSC_VER
#pragma warning(disable: 4661)
#endif
// Instantiations
template class QPBO<int>;
template class QPBO<float>;
template class QPBO<double>;
template <>
inline void QPBO<int>::get_type_information(char*& type_name, char*& type_format)
{
type_name = "int";
type_format = "d";
}
template <>
inline void QPBO<float>::get_type_information(char*& type_name, char*& type_format)
{
type_name = "float";
type_format = "f";
}
template <>
inline void QPBO<double>::get_type_information(char*& type_name, char*& type_format)
{
type_name = "double";
type_format = "Lf";
}

View File

@@ -58,6 +58,34 @@ var BA: [BlockSpace] int;
forall ba in BA do forall ba in BA do
ba = here.id; ba = here.id;
//
// The 'hasSingleLocalSubdomain' method on arrays will return true if the
// index set for a locale can be represented by a single domain.
//
if !BA.hasSingleLocalSubdomain() then
halt("For a Block distribution, the index set per locale should be \
represented by a single domain");
//
// If the distribution's subdomains can be represented as single subdomain,
// we can use the 'localSubdomain' method to get the index set for the
// current locale.
//
// Below, we'll use the index set to confirm that the array elements have the
// correct locale id.
//
for L in Locales {
on L {
const indices = BA.localSubdomain();
for i in indices {
if BA[i] != L.id then
halt("Error: incorrect locale id");
}
}
}
// //
// Output the Block-distributed array to visually see how the elements // Output the Block-distributed array to visually see how the elements
// are partitioned across the locales. // are partitioned across the locales.
@@ -104,6 +132,14 @@ writeln("Block Array Index Map");
writeln(BA2); writeln(BA2);
writeln(); writeln();
//
// We can use the 'targetLocales' method available on an array to get the
// locales array used as targets.
//
for (L, ML) in zip(BA2.targetLocales(), MyLocales) do
if L != ML then
halt("Error: BA2.targetLocales() should equal MyLocales");
// //
@@ -126,6 +162,18 @@ writeln("Cyclic Array Index Map");
writeln(CA); writeln(CA);
writeln(); writeln();
//
// The domain returned by 'localSubdomain' need not be a dense block, as is
// the case for the Cyclic Distribution.
//
on Locales[0] {
const indices = CA.localSubdomain();
for i in indices {
if CA[i] != 0 then
halt("Error: Cyclic array values on Locale 0 should be zero");
}
}
// //
// Next, we'll declare a Block-Cyclic distribution. These // Next, we'll declare a Block-Cyclic distribution. These
@@ -146,6 +194,46 @@ writeln("Block-Cyclic Array Index Map");
writeln(BCA); writeln(BCA);
writeln(); writeln();
//
// A locale's index set for a Block-Cyclic distribution cannot be represented
// by a single subdomain.
//
if BCA.hasSingleLocalSubdomain() then
halt("A Block-Cyclic index set cannot be represented by a single subdomain");
//
// If the local index set cannot be represented by a single subdomain,
// we can use the 'localSubdomains' iterator to yield a number of domains
// that represent the whole index set.
//
// Let's write a function that will use 'localSubdomains' to verify the
// correctness of the array values.
//
proc verifyID(Data: []) {
for L in Locales {
on L {
for indices in Data.localSubdomains() {
for i in indices {
if Data[i] != L.id then
halt("Error: incorrect locale id");
}
}
}
}
}
verifyID(BCA);
//
// The 'localSubdomains' iterator is also available on distributions that
// can represent a locale's index set with a single domain. This allows us to
// write more general code that will work for all distributions.
//
// This means that we can call the 'verifyID' function on any array, like the
// 'BA' array from earlier.
//
verifyID(BA);
// //
// The ReplicatedDist distribution is different: each of the // The ReplicatedDist distribution is different: each of the

View File

@@ -292,14 +292,14 @@ proc main() {
LagrangeLeapFrog(); LagrangeLeapFrog();
if debug { if debug {
// deprint("[[ Forces ]]", fx, fy, fz); deprintatomic("[[ Forces ]]", fx, fy, fz);
deprint("[[ Positions ]]", x, y, z); deprint("[[ Positions ]]", x, y, z);
deprint("[[ p, e, q ]]", p, e, q); deprint("[[ p, e, q ]]", p, e, q);
} }
if showProgress then if showProgress then
writeln("time = ", format("%e", time), ", dt=", format("%e", deltatime), writef("time = %er, dt=%er, %s", time, deltatime,
if doTiming then ", elapsed = " + (getCurrentTime()-iterTime) if doTiming then ", elapsed = " + (getCurrentTime()-iterTime) +"\n"
else ""); else "\n");
} }
if (cycle == maxcycles) { if (cycle == maxcycles) {
writeln("Stopped early due to reaching maxnumsteps"); writeln("Stopped early due to reaching maxnumsteps");
@@ -314,12 +314,10 @@ proc main() {
if printCoords { if printCoords {
var outfile = open("coords.out", iomode.cw); var outfile = open("coords.out", iomode.cw);
var writer = outfile.writer(); var writer = outfile.writer();
var fmtstr = if debug then "%1.9e" else "%1.4e"; var fmtstr = if debug then "%1.9re %1.9er %1.9er\n"
for i in Nodes { else "%1.4er %1.4er %1.4er\n";
writer.writeln(format(fmtstr, x[i]), " ", for i in Nodes do
format(fmtstr, y[i]), " ", writer.writef(fmtstr, x[i], y[i], z[i]);
format(fmtstr, z[i]));
}
writer.close(); writer.close();
outfile.close(); outfile.close();
} }
@@ -479,7 +477,7 @@ inline proc localizeNeighborNodes(eli: index(Elems),
y: [] real, ref y_local: 8*real, y: [] real, ref y_local: 8*real,
z: [] real, ref z_local: 8*real) { z: [] real, ref z_local: 8*real) {
for param i in 1..nodesPerElem { for i in 1..nodesPerElem {
const noi = elemToNode[eli][i]; const noi = elemToNode[eli][i];
x_local[i] = x[noi]; x_local[i] = x[noi];
@@ -670,7 +668,7 @@ proc SumElemStressesToNodeForces(b_x: 8*real, b_y: 8*real, b_z: 8*real,
ref fx: 8*real, ref fx: 8*real,
ref fy: 8*real, ref fy: 8*real,
ref fz: 8*real) { ref fz: 8*real) {
for param i in 1..8 { for i in 1..8 {
fx[i] = -(stress_xx * b_x[i]); fx[i] = -(stress_xx * b_x[i]);
fy[i] = -(stress_yy * b_y[i]); fy[i] = -(stress_yy * b_y[i]);
fz[i] = -(stress_zz * b_z[i]); fz[i] = -(stress_zz * b_z[i]);
@@ -725,17 +723,17 @@ inline proc CalcElemFBHourglassForce(xd: 8*real, yd: 8*real, zd: 8*real,
var hx, hy, hz: 4*real; var hx, hy, hz: 4*real;
// reduction // reduction
for param i in 1..4 { for i in 1..4 {
for param j in 1..8 { for j in 1..8 {
hx[i] += hourgam[j][i] * xd[j]; hx[i] += hourgam[j][i] * xd[j];
hy[i] += hourgam[j][i] * yd[j]; hy[i] += hourgam[j][i] * yd[j];
hz[i] += hourgam[j][i] * zd[j]; hz[i] += hourgam[j][i] * zd[j];
} }
} }
for param i in 1..8 { for i in 1..8 {
var shx, shy, shz: real; var shx, shy, shz: real;
for param j in 1..4 { for j in 1..4 {
shx += hourgam[i][j] * hx[j]; shx += hourgam[i][j] * hx[j];
shy += hourgam[i][j] * hy[j]; shy += hourgam[i][j] * hy[j];
shz += hourgam[i][j] * hz[j]; shz += hourgam[i][j] * hz[j];
@@ -1088,16 +1086,16 @@ proc CalcFBHourglassForceForElems(determ, x8n, y8n, z8n, dvdx, dvdy, dvdz) {
/* TODO: Can we enable this local block? */ /* TODO: Can we enable this local block? */
// local { // local {
for param i in 1..4 { for i in 1..4 {
var hourmodx, hourmody, hourmodz: real; var hourmodx, hourmody, hourmodz: real;
// reduction // reduction
for param j in 1..8 { for j in 1..8 {
hourmodx += x8n[eli][j] * gammaCoef[i][j]; hourmodx += x8n[eli][j] * gammaCoef[i][j];
hourmody += y8n[eli][j] * gammaCoef[i][j]; hourmody += y8n[eli][j] * gammaCoef[i][j];
hourmodz += z8n[eli][j] * gammaCoef[i][j]; hourmodz += z8n[eli][j] * gammaCoef[i][j];
} }
for param j in 1..8 { for j in 1..8 {
hourgam[j][i] = gammaCoef[i][j] - volinv * hourgam[j][i] = gammaCoef[i][j] - volinv *
(dvdx[eli][j] * hourmodx + (dvdx[eli][j] * hourmodx +
dvdy[eli][j] * hourmody + dvdy[eli][j] * hourmody +
@@ -1221,7 +1219,7 @@ proc CalcKinematicsForElems(dxx, dyy, dzz, const dt: real) {
arealg[k] = CalcElemCharacteristicLength(x_local, y_local, z_local, arealg[k] = CalcElemCharacteristicLength(x_local, y_local, z_local,
volume); volume);
for param i in 1..8 { for i in 1..8 {
x_local[i] -= dt2 * xd_local[i]; x_local[i] -= dt2 * xd_local[i];
y_local[i] -= dt2 * yd_local[i]; y_local[i] -= dt2 * yd_local[i];
z_local[i] -= dt2 * zd_local[i]; z_local[i] -= dt2 * zd_local[i];
@@ -1669,7 +1667,7 @@ proc CalcSoundSpeedForElems(vnewc, rho0:real, enewc, pnewc, pbvc, bvc) {
iter elemToNodes(elem) { iter elemToNodes(elem) {
for param i in 1..nodesPerElem do for i in 1..nodesPerElem do
yield elemToNode[elem][i]; yield elemToNode[elem][i];
} }
@@ -1679,14 +1677,19 @@ iter elemToNodesTuple(e) {
} }
proc deprint(title:string, x:[?D] real, y:[D]real, z:[D]real) { proc deprint(title:string, x:[?D] real, y:[D] real, z:[D] real) {
writeln(title); writeln(title);
for i in D { for i in D do
writeln(format("%3d", i), ": ", writef("%3i: %3.4er %3.4er %3.4er\n",
format("%3.4e", x[i]), " ", if use3DRepresentation then idx3DTo1D(i, D.dim(1).size) else i,
format("%3.4e", y[i]), " ", x[i], y[i], z[i]);
format("%3.4e", z[i]));
}
} }
proc deprintatomic(title:string, x:[?D] atomic real, y:[] atomic real, z:[] atomic real) {
writeln(title);
for i in D do
writef("%3i: %3.4er %3.4er %3.4er\n",
if use3DRepresentation then idx3DTo1D(i, D.dim(1).size) else i,
x[i].peek(), y[i].peek(), z[i].peek());
}

View File

@@ -0,0 +1,6 @@
%
% Some very badly written Charity
%
data LA(A) -> D = ss: A -> D
| ff: -> D.

View File

@@ -0,0 +1,172 @@
Member()
omit('***$***',_VER_C55)
_ABCDllMode_ EQUATE(0)
_ABCLinkMode_ EQUATE(1)
***$***
Include('Equates.CLW'),ONCE
Include('Keycodes.CLW'),ONCE
Include('Errors.CLW'),ONCE
Map
End ! map
Include('CStringClass.inc'),ONCE
CStringClass.Construct PROCEDURE ! Declare Procedure
CODE
SELF.bufferSize = DEFAULT_CS_BUFFER_SIZE
SELF.CS &= New(CSTRING(SELF.bufferSize))
CStringClass.Destruct PROCEDURE ! Declare Procedure
CODE
Dispose(SELF.cs)
CStringClass.Cat PROCEDURE (STRING pStr) !,*CSTRING,PROC ! Declare Procedure
newLen LONG,AUTO
oldCS &CSTRING
CODE
newLen = Len(pStr)
IF (newLen+SELF.strLength+2) > SELF.newStrSize
! Only grow the internal string if the result of the cat will be larger than the string currently is.
! The reason for the "+2" is because this is used in the string slicing outside this IF. Without this matching +2 there is potential for an out of bounds slice which would be bad!
! Save a temporary copy of the old string so we can us it in the concatination after we have grown it!
oldCS &= New(CSTRING(SELF.strLength+1))
oldCS = SELF.CS
Dispose(SELF.CS)
SELF.newStrSize = newLen + SELF.strLength + 1 + SELF.bufferSize
SELF.CS &= New(CSTRING(SELF.newStrSize))
SELF.CS = oldCS
Dispose(oldCS)
END
! Append the new string directly to the end of the old one.
SELF.CS[SELF.strLength+1 : SELF.strLength+newLen] = pStr
! And terminate the CSTRING manually
SELF.CS[SELF.strLength+newLen+1] = '<0>'
! This is the same as doing "SELF.strLength = Len(SELF.CS)" but the Len() is _really_ slow on large strings. This is much faster!
SELF.strLength += newLen
! This is what it used to be:
! SELF.Str(SELF.Str() & s)
! It is a nice and neat solution but performance, especially on large strings was terrible!
RETURN SELF.Str()
CStringClass.Str PROCEDURE (STRING pStr) !,*CSTRING, PROC ! Declare Procedure
CODE
IF Len(pStr) > SELF.newStrSize
! Only Dispose/New the internal string if the new one requires it.
! This might be slightly innefficient in terms of memory usage when the string gets smaller
! But it is _vasty_ better for performance when the string gets added to a lot.
Dispose(SELF.CS)
SELF.newStrSize = Len(pStr) + 1 + SELF.bufferSize
SELF.CS &= New(CSTRING(SELF.newStrSize))
END
SELF.CS = pStr
SELF.strLength = Len(SELF.CS)
RETURN SELF.CS
CStringClass.Len PROCEDURE !,LONG ! Declare Procedure
CODE
RETURN SELF.strLength
CStringClass.Replace PROCEDURE (STRING pFind, STRING pReplace) !,*CSTRING,PROC ! Declare Procedure
! FindString , ReplaceWith
locate LONG,AUTO
lastLocate LONG
CODE
LOOP
locate = InString(Upper(pFind), Upper(SELF.Str()), 1, lastLocate+1)
IF ~locate
BREAK
END
! So we dont end up having recursive replacement.
lastLocate = locate + Len(pReplace)-1
SELF.Str(Sub(SELF.Str(), 1, locate-1) & |
pReplace & |
Sub(SELF.Str(), locate+Len(pFind), SELF.Len()) |
)
END
RETURN SELF.Str()
CStringClass.Str PROCEDURE () !,*CSTRING ! Declare Procedure 3
CODE
RETURN SELF.CS
!------------------------------------------------------------------------------
CStringClass.Contains PROCEDURE (STRING pFind, BYTE pCaseSensitive=TRUE) !,BYTE ! Declare Procedure
! Returns a value (TRUE) indicating whether the specified String occurs within this string.
! Second parameter defaults to a case sensitive search.
CODE
IF pCaseSensitive = TRUE
IF InString(pFind, SELF.Str(), 1 , 1) > 0
RETURN TRUE
END
ELSE
IF InString(Lower(pFind), SELF.Lower(), 1 , 1) > 0
RETURN TRUE
END
END
RETURN FALSE
CStringClass.Lower PROCEDURE () !,STRING ! Declare Procedure
! Returns a "Lowered" version of the self.cs doesnt change the self.cs
CODE
RETURN Lower(SELF.CS)
CStringClass.SubString PROCEDURE (LONG pPosition, LONG pLength) !,STRING,PROC ! Declare Procedure
CODE
RETURN Sub(SELF.Str(), pPosition, pLength)
CStringClass.ToLower PROCEDURE () !,*CSTRING,PROC ! Declare Procedure
! Converts this string to lowercase and returns the converted string
CODE
RETURN SELF.Str(SELF.Lower())
CStringClass.ToUpper PROCEDURE () !,*CSTRING,PROC ! Declare Procedure
! Converts this string to uppercase and returns the converted string
CODE
RETURN SELF.Str(SELF.Upper())
CStringClass.Trim PROCEDURE () !,*CSTRING,PROC ! Declare Procedure
CODE
SELF.Str(Left(SELF.Str()))
SELF.Str(Clip(SELF.Str()))
RETURN SELF.Str()
CStringClass.Upper PROCEDURE () !,STRING ! Declare Procedure
CODE
RETURN Upper(SELF.Str())
CStringClass.IndexOf PROCEDURE (STRING pLookIn, BYTE pCaseSensitive=TRUE) !,LONG ! Declare Procedure
! Returns the index of the first parameter (pLookIn) is found within the SELF.CS
! zero if it is not found
CODE
IF pCaseSensitive = TRUE
RETURN InString(SELF.Str(), pLookIn, 1 , 1)
ELSE
RETURN InString(SELF.Lower(), Lower(pLookIn), 1 , 1)
END
CStringClass.FoundIn PROCEDURE (STRING pLookIn, BYTE pCaseSensitive=TRUE) !,BYTE ! Declare Procedure
! Returns TRUE if the first parameter (pLookIn) is found within the SELF.CS
! FALSE if it is no
CODE
IF SELF.IndexOf(pLookIn, pCaseSensitive) > 0
RETURN TRUE
ELSE
RETURN FALSE
END
CStringClass.SetBuffer PROCEDURE (LONG pNewBuffer) ! Declare Procedure
CODE
SELF.bufferSize = pNewBuffer
CStringClass.EscapeXml PROCEDURE (<STRING pStr>) !,STRING ! Declare Procedure
CS CStringClass
CODE
IF Omitted(pStr)=FALSE
CS.Str(pStr)
ELSE
! Make a copy so we don't alter the original
CS.Str(SELF.Str())
END
CS.Replace('&', '&amp;')
CS.Replace('<', '&lt;')
CS.Replace('>', '&gt;')
CS.Replace('"', '&quot;')
CS.Replace('''', '&apos;')
RETURN CS.Str()

View File

@@ -0,0 +1,68 @@
Member()
Include('ConsoleSupport.inc'),ONCE
Map
MODULE('32-bit Windows API')
! General functions
GetLastError(),DWORD,PASCAL
! Console functions
GetStdHandle(DWORD),HANDLE,PASCAL,PROC,RAW
WriteConsole(Handle,Long,Dword,long,long),bool,Raw,Pascal,name('WriteConsoleA')
ReadConsole(Handle,Long,Dword,long,long),bool,Raw,Pascal,name('ReadConsoleA')
SetConsoleTitle(Long),Bool,Raw,Pascal,name('SetConsoleTitleA')
GetConsoleTitle(Long,dword),Bool,Raw,Pascal,name('GetConsoleTitleA')
SetConsoleMode(Handle,dWord),BOOL,RAW,PASCAL
GetConsoleMode(Handle,Long),BOOL,RAW,PASCAL
End
End
ConsoleSupport.Construct PROCEDURE
CODE
ConsoleSupport.Destruct PROCEDURE
CODE
ConsoleSupport.Init PROCEDURE () !,BYTE,VIRTUAL
CODE
SELF.OutputHandle = GetStdHandle(STD_OUTPUT_HANDLE)
If SELF.OutputHandle = INVALID_HANDLE_VALUE
Halt(1,'Unable to get output handle (' & GetLastError() & ')')
RETURN INVALID_HANDLE_VALUE
End
SELF.InputHandle = GetStdHandle(STD_INPUT_HANDLE)
if SELF.InputHandle = INVALID_HANDLE_VALUE
Halt(2,'Unable to get console input handle (' & GetLastError() & ')')
RETURN INVALID_HANDLE_VALUE
End
If ~SetConsoleMode(SELF.InputHandle,ENABLE_PROCESSED_INPUT )
Halt(3,'Unable to set console mode (' & GetLastError() & ')')
RETURN INVALID_OTHER
End
RETURN FALSE
ConsoleSupport.WriteLine PROCEDURE (STRING pText) !,BYTE,PROC,VIRTUAL
CODE
SELF.TextBuffer = SELF.Prefix & pText & '<13,10>'
If WriteConsole(SELF.OutputHandle, ADDRESS(SELF.TextBuffer), LEN(SELF.TextBuffer),ADDRESS(SELF.BytesWritten), NULL) = 0
Halt(4,'WriteConsoleError (' & GetLastError() & ')')
RETURN -1
End
RETURN FALSE
Consolesupport.ReadKey PROCEDURE () !,STRING,PROC,VIRTUAL
CODE
SELF.WriteLine('Press any key to continue...')
Clear(SELF.InBuffer)
Loop
IF ReadConsole(SELF.InputHandle,Address(SELF.InBuffer),100,Address(SELF.BytesRead),NULL) = 0 THEN
Halt(5,'Error on read console (' & GetLastError() & ')')
Break
End
Until SELF.BytesRead > 0
RETURN SELF.InBuffer

View File

@@ -0,0 +1,10 @@
PROGRAM
MAP
END
CODE
MESSAGE('Hello World!')
RETURN

12
samples/Clarion/hello.clw Normal file
View File

@@ -0,0 +1,12 @@
MEMBER()
INCLUDE('HelloClass.inc'),ONCE
MAP
END
HelloClass.Construct PROCEDURE
CODE
HelloClass.Destruct PROCEDURE() !,VIRTUAL
CODE
HelloClass.SayHello PROCEDURE
CODE
MESSAGE('Hello World!')

133
samples/Click/sr2.click Normal file
View File

@@ -0,0 +1,133 @@
rates :: AvailableRates
elementclass sr2 {
$sr2_ip, $sr2_nm, $wireless_mac, $gateway, $probes|
arp :: ARPTable();
lt :: LinkTable(IP $sr2_ip);
gw :: SR2GatewaySelector(ETHTYPE 0x062c,
IP $sr2_ip,
ETH $wireless_mac,
LT lt,
ARP arp,
PERIOD 15,
GW $gateway);
gw -> SR2SetChecksum -> [0] output;
set_gw :: SR2SetGateway(SEL gw);
es :: SR2ETTStat(ETHTYPE 0x0641,
ETH $wireless_mac,
IP $sr2_ip,
PERIOD 30000,
TAU 300000,
ARP arp,
PROBES $probes,
ETT metric,
RT rates);
metric :: SR2ETTMetric(LT lt);
forwarder :: SR2Forwarder(ETHTYPE 0x0643,
IP $sr2_ip,
ETH $wireless_mac,
ARP arp,
LT lt);
querier :: SR2Querier(ETH $wireless_mac,
SR forwarder,
LT lt,
ROUTE_DAMPENING true,
TIME_BEFORE_SWITCH 5,
DEBUG true);
query_forwarder :: SR2MetricFlood(ETHTYPE 0x0644,
IP $sr2_ip,
ETH $wireless_mac,
LT lt,
ARP arp,
DEBUG false);
query_responder :: SR2QueryResponder(ETHTYPE 0x0645,
IP $sr2_ip,
ETH $wireless_mac,
LT lt,
ARP arp,
DEBUG true);
query_responder -> SR2SetChecksum -> [0] output;
query_forwarder -> SR2SetChecksum -> SR2Print(forwarding) -> [0] output;
query_forwarder [1] -> query_responder;
data_ck :: SR2SetChecksum()
input [1]
-> host_cl :: IPClassifier(dst net $sr2_ip mask $sr2_nm,
-)
-> querier
-> data_ck;
host_cl [1] -> [0] set_gw [0] -> querier;
forwarder[0]
-> dt ::DecIPTTL
-> data_ck
-> [2] output;
dt[1]
-> Print(ttl-error)
-> ICMPError($sr2_ip, timeexceeded, 0)
-> querier;
// queries
querier [1] -> [1] query_forwarder;
es -> SetTimestamp() -> [1] output;
forwarder[1] //ip packets to me
-> SR2StripHeader()
-> CheckIPHeader()
-> from_gw_cl :: IPClassifier(src net $sr2_ip mask $sr2_nm,
-)
-> [3] output;
from_gw_cl [1] -> [1] set_gw [1] -> [3] output;
input [0]
-> ncl :: Classifier(
12/0643 , //sr2_forwarder
12/0644 , //sr2
12/0645 , //replies
12/0641 , //sr2_es
12/062c , //sr2_gw
);
ncl[0] -> SR2CheckHeader() -> [0] forwarder;
ncl[1] -> SR2CheckHeader() -> PrintSR(query) -> query_forwarder
ncl[2] -> SR2CheckHeader() -> query_responder;
ncl[3] -> es;
ncl[4] -> SR2CheckHeader() -> gw;
}
Idle -> s :: sr2(2.0.0.1, 255.0.0.0, 00:00:00:00:00:01, false, "12 60 12 1500") -> Discard;
Idle -> [1] s;
s[1] -> Discard;
s[2] -> Discard;
s[3] -> Discard;

View File

@@ -0,0 +1,142 @@
// This Click configuration implements a firewall and NAT, roughly based on the
// mazu-nat.click example.
//
// This example assumes there is one interface that is IP-aliased. In this
// example, eth0 and eth0:0 have IP addresses 66.68.65.90 and 192.168.1.1,
// respectively. There is a local network, 192.168.1.0/24, and an upstream
// gateway, 66.58.65.89. Traffic from the local network is NATed.
//
// Connections can be initiated from the NAT box itself, also.
//
// For bugs, suggestions, and, corrections, please email me.
//
// Author: Thomer M. Gil (click@thomer.com)
AddressInfo(
eth0-in 192.168.1.1 192.168.1.0/24 00:0d:87:9d:1c:e9,
eth0-ex 66.58.65.90 00:0d:87:9d:1c:e9,
gw-addr 66.58.65.89 00:20:6f:14:54:c2
);
elementclass SniffGatewayDevice {
$device |
from :: FromDevice($device)
-> t1 :: Tee
-> output;
input -> q :: Queue(1024)
-> t2 :: PullTee
-> to :: ToDevice($device);
t1[1] -> ToHostSniffers;
t2[1] -> ToHostSniffers($device);
ScheduleInfo(from .1, to 1);
}
device :: SniffGatewayDevice(eth0);
arpq_in :: ARPQuerier(eth0-in) -> device;
ip_to_extern :: GetIPAddress(16)
-> CheckIPHeader
-> EtherEncap(0x800, eth0-ex, gw-addr)
-> device;
ip_to_host :: EtherEncap(0x800, gw-addr, eth0-ex)
-> ToHost;
ip_to_intern :: GetIPAddress(16)
-> CheckIPHeader
-> arpq_in;
arp_class :: Classifier(
12/0806 20/0001, // [0] ARP requests
12/0806 20/0002, // [1] ARP replies to host
12/0800); // [2] IP packets
device -> arp_class;
// ARP crap
arp_class[0] -> ARPResponder(eth0-in, eth0-ex) -> device;
arp_class[1] -> arp_t :: Tee;
arp_t[0] -> ToHost;
arp_t[1] -> [1]arpq_in;
// IP packets
arp_class[2] -> Strip(14)
-> CheckIPHeader
-> ipclass :: IPClassifier(dst host eth0-ex,
dst host eth0-in,
src net eth0-in);
// Define pattern NAT
iprw :: IPRewriterPatterns(NAT eth0-ex 50000-65535 - -);
// Rewriting rules for UDP/TCP packets
// output[0] rewritten to go into the wild
// output[1] rewritten to come back from the wild or no match
rw :: IPRewriter(pattern NAT 0 1,
pass 1);
// Rewriting rules for ICMP packets
irw :: ICMPPingRewriter(eth0-ex, -);
irw[0] -> ip_to_extern;
irw[1] -> icmp_me_or_intern :: IPClassifier(dst host eth0-ex, -);
icmp_me_or_intern[0] -> ip_to_host;
icmp_me_or_intern[1] -> ip_to_intern;
// Rewriting rules for ICMP error packets
ierw :: ICMPRewriter(rw irw);
ierw[0] -> icmp_me_or_intern;
ierw[1] -> icmp_me_or_intern;
// Packets directed at eth0-ex.
// Send it through IPRewriter(pass). If there was a mapping, it will be
// rewritten such that dst is eth0-in:net, otherwise dst will still be for
// eth0-ex.
ipclass[0] -> [1]rw;
// packets that were rewritten, heading into the wild world.
rw[0] -> ip_to_extern;
// packets that come back from the wild or are not part of an established
// connection.
rw[1] -> established_class :: IPClassifier(dst host eth0-ex,
dst net eth0-in);
// not established yet or returning packets for a connection that was
// established from this host itself.
established_class[0] ->
firewall :: IPClassifier(dst tcp port ssh,
dst tcp port smtp,
dst tcp port domain,
dst udp port domain,
icmp type echo-reply,
proto icmp,
port > 4095,
-);
firewall[0] -> ip_to_host; // ssh
firewall[1] -> ip_to_host; // smtp
firewall[2] -> ip_to_host; // domain (t)
firewall[3] -> ip_to_host; // domain (u)
firewall[4] -> [0]irw; // icmp reply
firewall[5] -> [0]ierw; // other icmp
firewall[6] -> ip_to_host; // port > 4095, probably for connection
// originating from host itself
firewall[7] -> Discard; // don't allow incoming for port <= 4095
// established connection
established_class[1] -> ip_to_intern;
// To eth0-in. Only accept from inside network.
ipclass[1] -> IPClassifier(src net eth0-in) -> ip_to_host;
// Packets from eth0-in:net either stay on local network or go to the wild.
// Those that go into the wild need to go through the appropriate rewriting
// element. (Either UDP/TCP rewriter or ICMP rewriter.)
ipclass[2] -> inter_class :: IPClassifier(dst net eth0-in, -);
inter_class[0] -> ip_to_intern;
inter_class[1] -> ip_udp_class :: IPClassifier(tcp or udp,
icmp type echo);
ip_udp_class[0] -> [0]rw;
ip_udp_class[1] -> [0]irw;

View File

@@ -0,0 +1,17 @@
fs = require 'fs'
{print} = require 'sys'
{spawn} = require 'child_process'
build = (callback) ->
coffee = spawn 'coffee', ['-c', '-o', '.', '.']
coffee.stderr.on 'data', (data) ->
process.stderr.write data.toString()
coffee.stdout.on 'data', (data) ->
print data.toString()
coffee.on 'exit', (code) ->
callback?() if code is 0
task 'build', 'Build from source', ->
build()

164
samples/Common Lisp/array.l Normal file
View File

@@ -0,0 +1,164 @@
;;; -*- Mode: Lisp; Package: LISP -*-
;;;
;;; This file is part of xyzzy.
;;;
(provide "array")
(in-package "lisp")
(export '(make-vector make-array vector array-dimensions array-in-bounds-p
upgraded-array-element-type adjust-array))
(defun upgraded-array-element-type (type)
(cond ((or (eq type 't)
(null type))
't)
((member type '(character base-character standard-char
extended-character) :test #'eq)
'character)
(t
(setq type (car (si:canonicalize-type type)))
(cond ((or (eq type 't)
(null type))
't)
((member type '(character base-character standard-char
extended-character) :test #'eq)
'character)
(t 't)))))
(defun check-array-initialize-option (ies-p ics-p displaced-to)
(let ((x 0))
(and ies-p (incf x))
(and ics-p (incf x))
(and displaced-to (incf x))
(when (> x 1)
(error ":initial-element, :initial-contents, :displaced-to"))))
(defun make-vector (length &key
(element-type t)
(initial-element nil ies-p)
(initial-contents nil ics-p)
fill-pointer
adjustable
displaced-to
(displaced-index-offset 0))
(setq element-type (upgraded-array-element-type element-type))
(check-array-initialize-option ies-p ics-p displaced-to)
(let ((vector (si:*make-vector length element-type initial-element adjustable
fill-pointer displaced-to displaced-index-offset)))
(when ics-p
(si:*copy-into-seq vector initial-contents))
vector))
(defun make-array (dimensions &rest rest
&key
(element-type t)
(initial-element nil ies-p)
(initial-contents nil ics-p)
fill-pointer
adjustable
displaced-to
(displaced-index-offset 0))
(cond ((integerp dimensions)
(apply #'make-vector dimensions rest))
((= (length dimensions) 1)
(apply #'make-vector (car dimensions) rest))
(t
(setq element-type (upgraded-array-element-type element-type))
(check-array-initialize-option ies-p ics-p displaced-to)
(when fill-pointer
(error ":fill-pointer"))
(let ((array (si:*make-array dimensions element-type
initial-element adjustable
displaced-to displaced-index-offset)))
(when ics-p
(let ((dims (make-list (array-rank array)
:initial-element 0))
(stack (list initial-contents))
(rank (1- (array-rank array))))
(dolist (x dims)
(push (elt (car stack) 0) stack))
(dotimes (i (array-total-size array))
(setf (row-major-aref array i) (car stack))
(do ((x dims (cdr x))
(j rank (1- j)))
((null x))
(pop stack)
(incf (car x))
(when (< (car x) (array-dimension array j))
(do ((r (- rank j) (1- r)))
((< r 0))
(push (elt (car stack) (nth r dims)) stack))
(return))
(setf (car x) 0)))))
array))))
(defun vector (&rest list)
(make-vector (length list) :element-type t :initial-contents list))
(defun array-dimensions (array)
(do ((i (1- (array-rank array)) (1- i))
(dims '()))
((minusp i) dims)
(push (array-dimension array i) dims)))
(defun array-in-bounds-p (array &rest subscripts)
(let ((r (array-rank array)))
(when (/= r (length subscripts))
(error "subscripts: ~S" subscripts))
(do ((i 0 (1+ i))
(s subscripts (cdr s)))
((= i r) t)
(unless (<= 0 (car s) (1- (array-dimension array i)))
(return nil)))))
(defun adjust-array (old-array
dimensions
&rest rest
&key
(element-type nil ets-p)
initial-element
(initial-contents nil ics-p)
(fill-pointer nil fps-p)
displaced-to
displaced-index-offset)
(when (/= (length dimensions) (array-rank old-array))
(error "?"))
(unless ets-p
(push (array-element-type old-array) rest)
(push :element-type rest))
(when (adjustable-array-p old-array)
(push t rest)
(push :adjustable rest))
(cond (fps-p
(unless (array-has-fill-pointer-p old-array)
(error "?")))
(t
(when (array-has-fill-pointer-p old-array)
(push (fill-pointer old-array) rest)
(push :fill-pointer rest))))
(when (eq old-array displaced-to)
(error "?"))
(let ((new-array (apply #'make-array dimensions rest)))
(or ics-p displaced-to
(copy-array-partially old-array new-array))
(cond ((adjustable-array-p old-array)
(si:*replace-array old-array new-array)
old-array)
(t
new-array))))
(defun copy-array-partially (src dst)
(let* ((dims (mapcar #'min (array-dimensions src) (array-dimensions dst)))
(r (array-rank src))
(s (make-list r :initial-element 0)))
(setq r (1- r))
(dotimes (x (apply #'* dims))
(setf (apply #'aref dst s) (apply #'aref src s))
(do ((i r (1- i)))
((minusp i))
(incf (nth i s))
(when (< (nth i s) (nth i dims))
(return))
(setf (nth i s) 0)))))

1201
samples/Common Lisp/common.l Normal file

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,2 @@
((exe_name hello)
(link_order (world hello)))

View File

@@ -0,0 +1,2 @@
(DEFUN HELLO ()
(PRINT 'HELLO))

View File

@@ -0,0 +1,103 @@
(:TURTLE
(:@PREFIX "rdf:" "<http://www.w3.org/1999/02/22-rdf-syntax-ns#>")
(:@PREFIX "owl:" "<http://www.w3.org/2002/07/owl#>")
(:@PREFIX "dc:" "<http://purl.org/dc/elements/1.1/>")
(:@PREFIX "xsd:" "<http://www.w3.org/2001/XMLSchema#>")
(:@PREFIX "rdfs:" "<http://www.w3.org/2000/01/rdf-schema#>")
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/channel>")
(:PREDICATE-OBJECT-LIST
(:URIREF #1="<http://www.w3.org/1999/02/22-rdf-syntax-ns#type>")
(:OBJECTS
(:QNAME "rdfs:Class")))
(:PREDICATE-OBJECT-LIST
(:QNAME "rdfs:comment")
(:OBJECTS
(:STRING "An RSS information channel.")))
(:PREDICATE-OBJECT-LIST
(:QNAME "rdfs:isDefinedBy")
(:OBJECTS
(:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST
(:QNAME "rdfs:label")
(:OBJECTS
(:STRING "Channel"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/description>")
(:PREDICATE-OBJECT-LIST
(:URIREF #1#)
(:OBJECTS
(:QNAME "rdf:Property")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment")
(:OBJECTS (:STRING "A short text description of the subject.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Description")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:subPropertyOf") (:OBJECTS (:QNAME "dc:description"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/image>")
(:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdfs:Class")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") (:OBJECTS (:STRING "An RSS image.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Image"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/item>")
(:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdfs:Class")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") (:OBJECTS (:STRING "An RSS item.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Item"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/items>")
(:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment")
(:OBJECTS
(:STRING "Points to a list of rss:item elements that are members of the subject channel.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Items"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/link>")
(:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment")
(:OBJECTS (:STRING "The URL to which an HTML rendering of the subject will link.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Link")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:subPropertyOf") (:OBJECTS (:QNAME "dc:identifier"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/name>")
(:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment")
(:OBJECTS (:STRING "The text input field's (variable) name.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Name"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/textinput>")
(:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdfs:Class")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment") (:OBJECTS (:STRING "An RSS text input.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Text Input"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/title>")
(:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment")
(:OBJECTS (:STRING "A descriptive title for the channel.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "Title")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:subPropertyOf") (:OBJECTS (:QNAME "dc:title"))))
(:TRIPLES (:URIREF "<http://purl.org/rss/1.0/url>")
(:PREDICATE-OBJECT-LIST (:URIREF #1#) (:OBJECTS (:QNAME "rdf:Property")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:comment")
(:OBJECTS
(:STRING
"The URL of the image to used in the 'src' attribute of the channel's image tag when rendered as HTML.")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:isDefinedBy")
(:OBJECTS (:URIREF "<http://purl.org/rss/1.0/>")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:label") (:OBJECTS (:STRING "URL")))
(:PREDICATE-OBJECT-LIST (:QNAME "rdfs:subPropertyOf") (:OBJECTS (:QNAME "dc:identifier")))))

View File

@@ -0,0 +1,443 @@
$!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
$! !
$! Copyright 2001, 2011 Fidelity Information Services, Inc !
$! !
$! This source code contains the intellectual property !
$! of its copyright holder(s), and is made available !
$! under a license. If you do not know the terms of !
$! the license, please stop and do not read further. !
$! !
$!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
$!
$!
$! KITINSTAL.COM PROCEDURE FOR THE GT.M PRODUCT
$!
$ ON CONTROL_Y THEN VMI$CALLBACK CONTROL_Y
$! ON WARNING THEN EXIT $STATUS !! allow warning errors for INSTALL REPLACE
$ IF P1 .EQS. "VMI$_INSTALL" THEN GOTO INSTALL
$ IF P1 .EQS. "VMI$_POSTINSTALL" THEN GOTO POSTINSTALL
$ IF P1 .EQS. "VMI$_IVP" THEN GOTO IVP
$ EXIT VMI$_UNSUPPORTED
$!
$INSTALL:
$ TYPE SYS$INPUT
GT.M (c) COPYRIGHT 1985 - 2000 by Sanchez Computer Associates
ALL RIGHTS RESERVED
$! the following 2 lines must be maintained
$ GTM$VMS_VERSION :== 072 ! Minimum VMS version required
$ ALPHA = (f$getsyi("arch_name") .eqs. "Alpha")
$ IF ALPHA
$ THEN
$ GTM$DISK_SPACE == 28000 ! Minumum disk space on system disk required
$ ELSE
$ GTM$DISK_SPACE == 16000 ! Minumum disk space on system disk required
$ ENDIF
$ IF F$ELEMENT(0,",",VMI$VMS_VERSION) .EQS. "RELEASED"
$ THEN
$ GTM$VMS_IS == F$ELEMENT(1,",",VMI$VMS_VERSION)
$ IF GTM$VMS_IS .LTS. GTM$VMS_VERSION
$ THEN
$ VMI$CALLBACK MESSAGE E VMSMISMATCH "This GT.M kit requires an existing VMS''GTM$VMS_VERSION' system."
$ EXIT VMI$_FAILURE
$ ENDIF
$ ELSE
$ GTM$VMS_IS :==
$ WRITE SYS$OUTPUT " No VMS version checking performed for field test versions."
$ ENDIF
$ IF (GTM$VMS_IS .GES. "052") THEN T1 = F$VERIFY(VMI$KIT_DEBUG)
$ VMI$CALLBACK CHECK_NET_UTILIZATION GTM$ROOM 'GTM$DISK_SPACE'
$ IF .NOT. GTM$ROOM
$ THEN
$ VMI$CALLBACK MESSAGE E NOSPACE "There is not enough disk space -- GT.M needs ''GTM$DISK_SPACE' blocks."
$ EXIT VMI$_FAILURE
$ ENDIF
$! setup default answers
$ GTM$DOPURGE :== YES
$ GTM$RUN_IVP :== YES
$ GTM$STD_CNF :== YES
$ GTM$DST_OWN :== SYSTEM
$ IF F$IDENTIFIER(GTM$DST_OWN,"NAME_TO_NUMBER") .EQ. 0 THEN GTM$DST_OWN :== 1,4
$ GTM$SYS_DST :== YES
$ GTM$DST_DIR :== GTM_DIST
$ GTM$DST_CRE == GTM$DST_DIR
$ GTM$DST_DEV :==
$ GTM$STARTDB :== YES
$ GTM$MGR_COM :== YES
$ GTM$HLP_DIR :== NO
$ GTM$DEF_DCL :== YES
$ GTM$DEF_SYS :== YES
$ GTM$LNK_LOG :== YES
$ GTM$INSTALL :== YES
$ GTM$DEF_GLD :== YES
$ GTM$GBL_DIR :== MUMPS.GLD
$ GTM$DEF_RTN :== YES
$ GTM$RTN_DIR :== [],GTM$DIST:
$ GTM$PCT_RTN :== YES
$ VMI$CALLBACK ASK GTM$DOPURGE "Do you want to purge files replaced by this installation" 'GTM$DOPURGE' B -
"@VMI$KWD:GTMKITHLP HELP_PURGE"
$ IF .NOT. GTM$DOPURGE THEN VMI$CALLBACK SET PURGE NO
$ VMI$CALLBACK ASK GTM$STD_CNF "Do you want the standard GT.M configuration (performs INSTALL)" 'GTM$STD_CNF' B -
"@VMI$KWD:GTMKITHLP HELP_STD_CNF"
$ IF GTM$STD_CNF
$ THEN
$ GTM$SYS_DST == 1
$ GTM$STARTDB == 1
$ GTM$MGR_COM == 1
$ GTM$HLP_DIR == 0
$ GTM$DEF_DCL == 1
$ GTM$DEF_SYS == 1
$ GTM$INSTALL == 1
$ GTM$LNK_LOG == 1
$ GTM$INSTALL == 1
$ GTM$DEF_GLD == 1
$ GTM$DEF_RTN == 1
$ GTM$PCT_RTN == 1
$ GTM$DST_LOG :== SYS$COMMON:['GTM$DST_DIR']
$ GTM$DIR_TYPE :== COMMON
$ ELSE ! Not standard configuration
$ VMI$CALLBACK ASK GTM$DST_OWN "What UIC should own the GT.M distribution" 'GTM$DST_OWN' S "@VMI$KWD:GTMKITHLP HELP_DST_OWN"
$ GTM$DST_OWN == GTM$DST_OWN - "[" - "]"
$ VMI$CALLBACK ASK GTM$SYS_DST "Do you want the GT.M distribution to go into a System Directory" 'GTM$SYS_DST' B -
"@VMI$KWD:GTMKITHLP HELP_SYS_DST"
$ IF GTM$SYS_DST
$ THEN
$ VMI$CALLBACK ASK GTM$DST_DIR "In what System Directory do you want to place GT.M" 'GTM$DST_DIR' S -
"@VMI$KWD:GTMKITHLP HELP_SYS_DIR"
$ GTM$DST_DIR == GTM$DST_DIR - "[" - "]"
$ GTM$DST_CRE == GTM$DST_DIR
$ GTM$DST_LOG :== SYS$COMMON:['GTM$DST_DIR']
$ GTM$DIR_TYPE :== COMMON
$ ELSE ! Not system disk
$ VMI$CALLBACK ASK GTM$DST_DEV "On which device do you want to place GT.M" "''GTM$DST_DEV'" S "@VMI$KWD:GTMKITHLP HELP_DST_DEV"
$ VMI$CALLBACK ASK GTM$DST_DIR "In what directory on that device do you want to place GT.M" 'GTM$DST_DIR' S -
"@VMI$KWD:GTMKITHLP HELP_DST_DIR"
$ GTM$DST_DEV == GTM$DST_DEV - ":"
$ GTM$DST_DIR == GTM$DST_DIR - "[" - "]"
$ GTM$DST_LOG :== 'GTM$DST_DEV':['GTM$DST_DIR']
$ GTM$DST_CRE == GTM$DST_LOG
$ GTM$DIR_TYPE :== USER
$ ENDIF ! system disk
$ VMI$CALLBACK ASK GTM$STARTDB "Do you want GTMSTART.COM in the startup database" 'GTM$STARTDB' B -
"@VMI$KWD:GTMKITHLP HELP_STARTDB"
$ IF .NOT. GTM$STARTDB
$ THEN
$ VMI$CALLBACK ASK GTM$MGR_COM "Do you want the GT.M .COM files in SYS$MANAGER" 'GTM$MGR_COM' B -
"@VMI$KWD:GTMKITHLP HELP_MGR_COM"
$ ENDIF
$ VMI$CALLBACK ASK GTM$HLP_DIR "Do you want the GT.M help files in SYS$HELP" 'GTM$HLP_DIR' B "@VMI$KWD:GTMKITHLP HELP_HLP_DIR"
$ VMI$CALLBACK ASK GTM$DEF_DCL "Do you want to define GT.M commands to the system" 'GTM$DEF_DCL' B -
"@VMI$KWD:GTMKITHLP HELP_DEF_DCL"
$ VMI$CALLBACK ASK GTM$DEF_SYS "Do you want to define GT.M logical names in the System Table" 'GTM$DEF_SYS' B -
"@VMI$KWD:GTMKITHLP HELP_DEF_SYS"
$ VMI$CALLBACK ASK GTM$LNK_LOG "Do you want to define the LNK$LIBRARY logical names" 'GTM$LNK_LOG' B -
"@VMI$KWD:GTMKITHLP HELP_LNK_LOG"
$ VMI$CALLBACK ASK GTM$RUN_IVP "Do you want to run the IVP (performs INSTALL)" 'GTM$RUN_IVP' B -
"@VMI$KWD:GTMKITHLP HELP_RUN_IVP"
$ IF GTM$RUN_IVP
$ THEN
$ GTM$PCT_RTN == 1
$ ELSE
$ VMI$CALLBACK ASK GTM$PCT_RTN "Do you want to compile the GT.M percent routines (performs INSTALL)" 'GTM$PCT_RTN' B -
"@VMI$KWD:GTMKITHLP HELP_PCT_RTN"
$ ENDIF
$ IF (GTM$RUN_IVP .OR. GTM$PCT_RTN)
$ THEN
$ GTM$INSTALL == 1
$ ELSE
$ VMI$CALLBACK ASK GTM$INSTALL "Do you want to INSTALL the GT.M shareable images now" 'GTM$INSTALL' B -
"@VMI$KWD:GTMKITHLP HELP_INSTALL"
$ ENDIF
$ VMI$CALLBACK ASK GTM$DEF_RTN "Do you want to have a default definition for GTM$ROUTINES" 'GTM$DEF_RTN' B -
"@VMI$KWD:GTMKITHLP HELP_DEF_RTN"
$ IF GTM$DEF_RTN
$ THEN
$ VMI$CALLBACK ASK GTM$RTN_DIR "What is the search specification for GTM$ROUTINES" 'GTM$RTN_DIR' S -
"@VMI$KWD:GTMKITHLP HELP_RTN_DIR"
$ ENDIF
$ VMI$CALLBACK ASK GTM$DEF_GLD "Do you want to have a default definition for GTM$GBLDIR" 'GTM$DEF_GLD' B -
"@VMI$KWD:GTMKITHLP HELP_DEF_GLD"
$ IF GTM$DEF_GLD
$ THEN
$ VMI$CALLBACK ASK GTM$GBL_DIR "What is the file specification for GTM$GBLDIR" 'GTM$GBL_DIR' S -
"@VMI$KWD:GTMKITHLP HELP_GBL_DIR"
$ ENDIF
$ ENDIF ! standard configuration
$! tell them what's happening
$ IF GTM$MGR_COM
$ THEN
$ WRITE SYS$OUTPUT " The following command files are created and copied to SYS$MANAGER:"
$ ELSE
$ WRITE SYS$OUTPUT " The following command files are created:"
$ ENDIF
$ TYPE SYS$INPUT
GTMINSTALL.COM
GTMLOGICALS.COM
GTMLOGIN.COM
GTMSTART.COM
GTMSTOP.COM
Each file contains its own user documentation.
All the questions have been asked. Installation now proceeds without your
manual intervention for about 10-15 minutes.
$ IF GTM$RUN_IVP THEN WRITE SYS$OUTPUT " Finally the Installation Verification Procedure tests the installation."
$ WRITE SYS$OUTPUT ""
$ VMI$CALLBACK CREATE_DIRECTORY 'GTM$DIR_TYPE' 'GTM$DST_CRE' "/OWNER_UIC=[''GTM$DST_OWN'] /PROTECTION=(WO:RE)"
$ VMI$CALLBACK RESTORE_SAVESET B
$ VMI$CALLBACK RESTORE_SAVESET C
$ WRITE SYS$OUTPUT ""
$ VMI$CALLBACK MESSAGE I CRECOM "Creating command files."
$! Create GTMINSTALL.COM
$ OPEN /WRITE OUFILE VMI$KWD:GTMINSTALL.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMINSTALL.COM installs GTMSECSHR and other GT.M images."
$ WRITE OUFILE "$! GTMSECSHR is a small protected image and must be installed."
$ WRITE OUFILE "$! GTMSHR is the run-time library and is installed for performance."
$ WRITE OUFILE "$! GTM$DMOD and MCOMPILE are small images frequently used in development."
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$ INSTALL"
$ WRITE OUFILE "REPLACE /OPEN/SHARED/HEADER/PROTECTED GTMSECSHR"
$ WRITE OUFILE "REPLACE /OPEN/SHARED/HEADER GTMSHR"
$ WRITE OUFILE "REPLACE /OPEN/SHARED/HEADER GTM$DMOD"
$ WRITE OUFILE "REPLACE /OPEN/SHARED/HEADER MCOMPILE"
$ WRITE OUFILE "$ EXIT"
$ CLOSE OUFILE
$! Create GTMLOGICALS.COM
$ GTM$HLP_LOG :== GTM$DIST
$ IF GTM$HLP_DIR THEN GTM$HLP_LOG :== SYS$HELP
$ OPEN /WRITE OUFILE VMI$KWD:GTMLOGICALS.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMLOGICALS.COM defines the logical names required to use GT.M."
$ WRITE OUFILE "$! By default the definitions are placed in the PROCESS table."
$ WRITE OUFILE "$! Parameter 1, if supplied should be the name of a logical name table"
$ WRITE OUFILE "$! and/or the mode of definition."
$ WRITE OUFILE "$! Assignments in a ""permanent"" table reduce GT.M activation time."
$ WRITE OUFILE "$!"
$ IF GTM$LNK_LOG THEN WRITE OUFILE "$! The LNK$LIBRARY names many require adjustment to your environment."
$ IF GTM$DEF_GLD THEN WRITE OUFILE "$! GTM$GBLDIR is defined to provide default access to a global directory."
$ IF GTM$DEF_RTN THEN WRITE OUFILE "$! GTM$ROUTINES is defined to provide access to the GT.M utilities."
$ IF GTM$DEF_RTN THEN WRITE OUFILE "$! You may wish to define a different structure for $ZROUTINES."
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$ IF (P1 .NES. """") .AND. (F$EXTRACT(0,1,P1) .NES. ""/"") THEN P1 := /'P1"
$ WRITE OUFILE "$ DEFINE 'P1' GTM$DIST ''GTM$DST_LOG'"
$ IF GTM$DEF_GLD THEN WRITE OUFILE "$ DEFINE 'P1' GTM$GBLDIR ''GTM$GBL_DIR'"
$ IF GTM$DEF_RTN THEN WRITE OUFILE "$ DEFINE 'P1' GTM$ROUTINES ""''GTM$RTN_DIR'"""
$ WRITE OUFILE "$ DEFINE 'P1' GTM$HELP ''GTM$HLP_LOG'"
$ WRITE OUFILE "$ DEFINE 'P1' GTMSHR GTM$DIST:GTMSHR.EXE"
$ WRITE OUFILE "$ DEFINE 'P1' GTMSECSHR GTM$DIST:GTMSECSHR.EXE"
$ WRITE OUFILE "$ DEFINE 'P1' GTM$DMOD GTM$DIST:GTM$DMOD.EXE"
$ WRITE OUFILE "$ DEFINE 'P1' MCOMPILE GTM$DIST:MCOMPILE.EXE"
$ IF GTM$LNK_LOG
$ THEN
$ N1 = 0
$ DN = 0
$ T1 = F$TRNLNM("LNK$LIBRARY")
$ IF (T1 .EQS. "") .OR. (F$LOCATE("GTMLIB",T1) .NE. F$LENGTH(T1)) .OR. (F$LOCATE("GTMSHR",T1) .NE. F$LENGTH(T1))
$ THEN
$ WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY GTM$DIST:GTMLIB.OLB"
$ DN = 1
$ ELSE ! lnk$library is in use
$LNK_LOOP:
$ N1 = N1 + 1
$ T1 = F$TRNLNM("LNK$LIBRARY_''N1'")
$ IF (T1 .EQS. "") .OR. (F$LOCATE("GTMLIB",T1) .NE. F$LENGTH(T1)) .OR. (F$LOCATE("GTMSHR",T1) .NE. F$LENGTH(T1))
$ THEN
$ WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY_''N1' GTM$DIST:GTMLIB.OLB"
$ DN = 1
$ ENDIF
$ IF (.NOT. DN) .AND. (N1 .LT. 998) THEN GOTO LNK_LOOP
$ ENDIF ! gtmlib handling
$ IF DN ! placed gtmlib
$ THEN
$ N1 = N1 + 1
$ WRITE OUFILE "$ DEFINE 'P1' LNK$LIBRARY_''N1' GTM$DIST:GTMSHR.OLB"
$ ELSE
$ VMI$CALLBACK MESSAGE I NOLNKLOG "No LNK$LIBRARY logical names available"
$ ENDIF
$ ENDIF ! setting up LNK$LIBRARYs
$ WRITE OUFILE "$ EXIT"
$ CLOSE OUFILE
$! Create GTMLOGIN.COM
$ OPEN /WRITE OUFILE VMI$KWD:GTMLOGIN.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMLOGIN.COM performs process specific setup for GT.M."
$ WRITE OUFILE "$! It calls GTMLOGICALS.COM if the logical names are not"
$ WRITE OUFILE "$! in the SYSTEM table."
$ WRITE OUFILE "$! It defines symbols to access GT.M images."
$ WRITE OUFILE "$! It defines GT.M commands locally if they are not defined to the system."
$ WRITE OUFILE "$! When the command and logical names are not defined on a process level,"
$ WRITE OUFILE "$! a production user may save start-up time by not using GTMLOGIN."
$ WRITE OUFILE "$! CCE is infrequently used, but may be defined as a foreign command."
$ WRITE OUFILE "$!"
$ IF .NOT. GTM$DEF_SYS
$ THEN
$ WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
$ WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
$ WRITE OUFILE "$ @'dir'GTMLOGICALS.COM"
$ ENDIF
$ IF .NOT. GTM$DEF_DCL THEN WRITE OUFILE "$ SET COMMAND GTM$DIST:GTMCOMMANDS.CLD"
$ WRITE OUFILE "$ DSE :== $GTM$DIST:DSE.EXE ! Database System Editor"
$ WRITE OUFILE "$ GDE :== $GTM$DIST:GDE.EXE ! Global Directory Editor"
$ WRITE OUFILE "$ GTM :== MUMPS/DIRECT ! Direct Mode MUMPS"
$ WRITE OUFILE "$ LKE :== $GTM$DIST:LKE.EXE ! Lock Editor"
$ WRITE OUFILE "$ MUPI*P :== $GTM$DIST:MUPIP.EXE ! MUMPS Peripheral Interchange Program"
$ WRITE OUFILE "$ EXIT"
$ WRITE OUFILE "$ CCE :== $GTM$DIST:CCE.EXE ! GT.CX Operator Interface Program"
$ WRITE OUFILE "$ EXIT"
$ CLOSE OUFILE
$! Create GTMSTART.COM
$ OPEN /WRITE OUFILE VMI$KWD:GTMSTART.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMSTART.COM should be placed in the VMS startup database."
$ WRITE OUFILE "$! It invokes GTMLOGICALS.COM and GTMINSTALL.COM."
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
$ WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
$ IF GTM$DEF_SYS THEN WRITE OUFILE "$ IF P1 .EQS. """" .OR. (P1 .EQS. ""FULL"") THEN P1 := SYSTEM/EXEC"
$ WRITE OUFILE "$ @'dir'GTMLOGICALS 'P1'"
$ WRITE OUFILE "$ @'dir'GTMINSTALL"
$ WRITE OUFILE "$ EXIT"
$ CLOSE OUFILE
$! Create GTMSTOP.COM
$ OPEN /WRITE OUFILE VMI$KWD:GTMSTOP.COM
$ WRITE OUFILE "$!"
$ WRITE OUFILE "$! GTMSTOP.COM stops all the active GT.M processes and does a RUNDOWN."
$ WRITE OUFILE "$! Place an invocation or copy of this procedure in the site specific"
$ WRITE OUFILE "$! shutdown: SYS$MANAGER:SYSHUTDWN to ensure all GT.M databases are"
$ WRITE OUFILE "$! properly closed before VMS terminates. GTMSTOP should follow"
$ WRITE OUFILE "$! GTCMSTOP and precede GTCXSTOP, if they are used."
$ WRITE OUFILE "$! If GTMSTOP is not intended to disable subsequent use of GT.M,"
$ WRITE OUFILE "$! add a comment (!) before the INSTALL REMOVE GTMSECSHR."
$ WRITE OUFILE "$!"
$ IF .NOT. GTM$DEF_SYS
$ THEN
$ WRITE OUFILE "$ dir = F$ENVIRONMENT(""PROCEDURE"")"
$ WRITE OUFILE "$ dir = F$PARSE(dir,,,""DEVICE"") + F$PARSE(dir,,,""DIRECTORY"")"
$ WRITE OUFILE "$ @'dir'GTMLOGICALS.COM"
$ ENDIF
$ WRITE OUFILE "$ MUPIP := $GTM$DIST:MUPIP.EXE"
$ WRITE OUFILE "$ STOP := $GTM$DIST:GTM$STOP"
$ WRITE OUFILE "$ STOP 'P1'"
$ WRITE OUFILE "$ MUPIP RUNDOWN"
$ WRITE OUFILE "$ INSTALL REMOVE GTMSECSHR"
$ WRITE OUFILE "$ EXIT"
$ IF GTM$DEF_SYS THEN WRITE OUFILE "$ IF P2 .EQS. """" THEN P2 := /SYSTEM/EXEC"
$ WRITE OUFILE "$ DEASSIGN 'P2' GTMSECSHR"
$ CLOSE OUFILE
$ VMI$CALLBACK MESSAGE I PREINS "Preparing files for installation."
$! GTMFILES.KIT must be maintained as kit contents change
$ GTM$HLP_LOG == GTM$DST_LOG
$ IF GTM$HLP_DIR THEN GTM$HLP_LOG :== VMI$ROOT:[SYSHLP]
$ OPEN /WRITE OUFILE VMI$KWD:GTMFILES.KIT
$ IF GTM$MGR_COM
$ THEN
$ WRITE OUFILE "GTM$ GTMINSTALL.COM VMI$ROOT:[SYSMGR] C"
$ WRITE OUFILE "GTM$ GTMLOGICALS.COM VMI$ROOT:[SYSMGR] C"
$ WRITE OUFILE "GTM$ GTMLOGIN.COM VMI$ROOT:[SYSMGR] C"
$ WRITE OUFILE "GTM$ GTMSTART.COM VMI$ROOT:[SYSMGR] C"
$ WRITE OUFILE "GTM$ GTMSTOP.COM VMI$ROOT:[SYSMGR] C"
$ ENDIF
$ WRITE OUFILE "GTM$ GTMINSTALL.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMLOGICALS.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMLOGIN.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMSTART.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMSTOP.COM ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ DSE.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ GDE.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ LKE.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ MUMPS.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ MUPIP.HLB ''GTM$HLP_LOG'"
$ WRITE OUFILE "GTM$ GTMLIB.OLB ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMSHR.OLB ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMZCALL.MLB ''GTM$DST_LOG'"
$ IF ALPHA
$ THEN
$ WRITE OUFILE "GTM$ GTM$DEFAULTS.M64 ''GTM$DST_LOG'"
$ ELSE
$ WRITE OUFILE "GTM$ GTM$DEFAULTS.MAR ''GTM$DST_LOG'"
$ ENDIF
$ WRITE OUFILE "GTM$ GTM$CE.H ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMCOLLECT.OPT ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMCOMMANDS.CLD ''GTM$DST_LOG' C"
$ WRITE OUFILE "GTM$ *.M ''GTM$DST_LOG'"
$ CLOSE OUFILE
$! GTMIMAGES.KIT must be maintained as kit contents change
$ OPEN /WRITE OUFILE VMI$KWD:GTMIMAGES.KIT
$ WRITE OUFILE "GTM$ GTMSECSHR.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTMSHR.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ DSE.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GDE.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTM$DMOD.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ LKE.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ MCOMPILE.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ MUPIP.EXE ''GTM$DST_LOG'"
$ WRITE OUFILE "GTM$ GTM$STOP.EXE ''GTM$DST_LOG'"
$ CLOSE OUFILE
$! Provide with file.KITs
$ VMI$CALLBACK PROVIDE_FILE "" VMI$KWD:GTMFILES.KIT "" T
$ VMI$CALLBACK PROVIDE_IMAGE "" VMI$KWD:GTMIMAGES.KIT "" T
$ VMI$CALLBACK MESSAGE I FININS "Finalizing the installation."
$ IF GTM$DEF_DCL THEN VMI$CALLBACK PROVIDE_DCL_COMMAND GTMCOMMANDS.CLD
$ IF GTM$STARTDB THEN VMI$CALLBACK MODIFY_STARTUP_DB ADD GTMSTART.COM LPMAIN
$! GTM$INSTALL is TRUE if GTM$RUN_IVP or GTM$PCT_RTN
$ IF GTM$INSTALL THEN VMI$CALLBACK SET POSTINSTALL YES
$ IF GTM$RUN_IVP THEN VMI$CALLBACK SET IVP YES
$ EXIT VMI$_SUCCESS
$!
$POSTINSTALL:
$ ON CONTROL_Y THEN EXIT VMI$_FAILURE
$! remove MUPIP from command tables for change from V2.4 to V2.5
$ SET NOON
$ DEFINE /USER_MODE SYS$OUTPUT NL:
$ DEFINE /USER_MODE SYS$ERROR NL:
$ SET COMMAND /TABLE=SYS$COMMON:[SYSLIB]DCLTABLES /OUTPUT=SYS$COMMON:[SYSLIB]DCLTABLES /DELETE=MUPIP
$ DEFINE /USER_MODE SYS$OUTPUT NL:
$ DEFINE /USER_MODE SYS$ERROR NL:
$ SET COMMAND /DELETE=MUPIP
$ SET ON
$ IF GTM$MGR_COM
$ THEN
$ T1 := SYS$MANAGER:
$ ELSE
$ T1 = GTM$DST_LOG
$ ENDIF
$ @'T1'GTMSTART
$ @'T1'GTMLOGIN
$ ON CONTROL_Y THEN EXIT VMI$_FAILURE
$ SET DEFAULT GTM$DIST
$ T2 = F$ENVIRONMENT("PROTECTION")
$ SET PROTECTION=(S=REWD,O=REWD,G=REWD,W=RE)/DEFAULT
$ MUMPS GTM$DMOD.M
$ IF GTM$LNK_LOG
$ THEN
$ T1 :=
$ ELSE
$ T1 :=,GTMLIB.OLB/LIB,GTMSHR.OLB/LIB
$ ENDIF
$ LINK GTM$DMOD.OBJ/NOTRACE'T1
$ IF GTM$PCT_RTN
$ THEN
$ TYPE SYS$INPUT
Compiling the GT.M percent (%) routines.
$ MUMPS *
$ IF GTM$DOPURGE THEN PURGE *.*
$ SET DEFAULT VMI$KWD
$ ENDIF ! percent routines
$ SET PROTECTION=('T2')/DEFAULT
$ EXIT VMI$_SUCCESS
$!
$IVP:
$! The real Installation Verification Procedure.
$ TYPE SYS$INPUT
GT.M Installation Verification Procedure
$! Extract the IVP .COM file from the text library.
$ LIBRARIAN /EXTRACT=GTM$IVP /OUTPUT=GTM$IVP.COM GTM$IVP.TLB
$ @GTM$IVP
$ EXIT $STATUS
$!

View File

@@ -0,0 +1,867 @@
$! make libz under VMS written by
$! Martin P.J. Zinser
$!
$! In case of problems with the install you might contact me at
$! zinser@zinser.no-ip.info(preferred) or
$! martin.zinser@eurexchange.com (work)
$!
$! Make procedure history for Zlib
$!
$!------------------------------------------------------------------------------
$! Version history
$! 0.01 20060120 First version to receive a number
$! 0.02 20061008 Adapt to new Makefile.in
$! 0.03 20091224 Add support for large file check
$! 0.04 20100110 Add new gzclose, gzlib, gzread, gzwrite
$! 0.05 20100221 Exchange zlibdefs.h by zconf.h.in
$! 0.06 20120111 Fix missing amiss_err, update zconf_h.in, fix new exmples
$! subdir path, update module search in makefile.in
$! 0.07 20120115 Triggered by work done by Alexey Chupahin completly redesigned
$! shared image creation
$! 0.08 20120219 Make it work on VAX again, pre-load missing symbols to shared
$! image
$! 0.09 20120305 SMS. P1 sets builder ("MMK", "MMS", " " (built-in)).
$! "" -> automatic, preference: MMK, MMS, built-in.
$!
$ on error then goto err_exit
$!
$ true = 1
$ false = 0
$ tmpnam = "temp_" + f$getjpi("","pid")
$ tt = tmpnam + ".txt"
$ tc = tmpnam + ".c"
$ th = tmpnam + ".h"
$ define/nolog tconfig 'th'
$ its_decc = false
$ its_vaxc = false
$ its_gnuc = false
$ s_case = False
$!
$! Setup variables holding "config" information
$!
$ Make = "''p1'"
$ name = "Zlib"
$ version = "?.?.?"
$ v_string = "ZLIB_VERSION"
$ v_file = "zlib.h"
$ ccopt = "/include = []"
$ lopts = ""
$ dnsrl = ""
$ aconf_in_file = "zconf.h.in#zconf.h_in#zconf_h.in"
$ conf_check_string = ""
$ linkonly = false
$ optfile = name + ".opt"
$ mapfile = name + ".map"
$ libdefs = ""
$ vax = f$getsyi("HW_MODEL").lt.1024
$ axp = f$getsyi("HW_MODEL").ge.1024 .and. f$getsyi("HW_MODEL").lt.4096
$ ia64 = f$getsyi("HW_MODEL").ge.4096
$!
$! 2012-03-05 SMS.
$! Why is this needed? And if it is needed, why not simply ".not. vax"?
$!
$!!! if axp .or. ia64 then set proc/parse=extended
$!
$ whoami = f$parse(f$environment("Procedure"),,,,"NO_CONCEAL")
$ mydef = F$parse(whoami,,,"DEVICE")
$ mydir = f$parse(whoami,,,"DIRECTORY") - "]["
$ myproc = f$parse(whoami,,,"Name") + f$parse(whoami,,,"type")
$!
$! Check for MMK/MMS
$!
$ if (Make .eqs. "")
$ then
$ If F$Search ("Sys$System:MMS.EXE") .nes. "" Then Make = "MMS"
$ If F$Type (MMK) .eqs. "STRING" Then Make = "MMK"
$ else
$ Make = f$edit( Make, "trim")
$ endif
$!
$ gosub find_version
$!
$ open/write topt tmp.opt
$ open/write optf 'optfile'
$!
$ gosub check_opts
$!
$! Look for the compiler used
$!
$ gosub check_compiler
$ close topt
$ close optf
$!
$ if its_decc
$ then
$ ccopt = "/prefix=all" + ccopt
$ if f$trnlnm("SYS") .eqs. ""
$ then
$ if axp
$ then
$ define sys sys$library:
$ else
$ ccopt = "/decc" + ccopt
$ define sys decc$library_include:
$ endif
$ endif
$!
$! 2012-03-05 SMS.
$! Why /NAMES = AS_IS? Why not simply ".not. vax"? And why not on VAX?
$!
$ if axp .or. ia64
$ then
$ ccopt = ccopt + "/name=as_is/opt=(inline=speed)"
$ s_case = true
$ endif
$ endif
$ if its_vaxc .or. its_gnuc
$ then
$ if f$trnlnm("SYS").eqs."" then define sys sys$library:
$ endif
$!
$! Build a fake configure input header
$!
$ open/write conf_hin config.hin
$ write conf_hin "#undef _LARGEFILE64_SOURCE"
$ close conf_hin
$!
$!
$ i = 0
$FIND_ACONF:
$ fname = f$element(i,"#",aconf_in_file)
$ if fname .eqs. "#" then goto AMISS_ERR
$ if f$search(fname) .eqs. ""
$ then
$ i = i + 1
$ goto find_aconf
$ endif
$ open/read/err=aconf_err aconf_in 'fname'
$ open/write aconf zconf.h
$ACONF_LOOP:
$ read/end_of_file=aconf_exit aconf_in line
$ work = f$edit(line, "compress,trim")
$ if f$extract(0,6,work) .nes. "#undef"
$ then
$ if f$extract(0,12,work) .nes. "#cmakedefine"
$ then
$ write aconf line
$ endif
$ else
$ cdef = f$element(1," ",work)
$ gosub check_config
$ endif
$ goto aconf_loop
$ACONF_EXIT:
$ write aconf ""
$ write aconf "/* VMS specifics added by make_vms.com: */"
$ write aconf "#define VMS 1"
$ write aconf "#include <unistd.h>"
$ write aconf "#include <unixio.h>"
$ write aconf "#ifdef _LARGEFILE"
$ write aconf "# define off64_t __off64_t"
$ write aconf "# define fopen64 fopen"
$ write aconf "# define fseeko64 fseeko"
$ write aconf "# define lseek64 lseek"
$ write aconf "# define ftello64 ftell"
$ write aconf "#endif"
$ write aconf "#if !defined( __VAX) && (__CRTL_VER >= 70312000)"
$ write aconf "# define HAVE_VSNPRINTF"
$ write aconf "#endif"
$ close aconf_in
$ close aconf
$ if f$search("''th'") .nes. "" then delete 'th';*
$! Build the thing plain or with mms
$!
$ write sys$output "Compiling Zlib sources ..."
$ if make.eqs.""
$ then
$ if (f$search( "example.obj;*") .nes. "") then delete example.obj;*
$ if (f$search( "minigzip.obj;*") .nes. "") then delete minigzip.obj;*
$ CALL MAKE adler32.OBJ "CC ''CCOPT' adler32" -
adler32.c zlib.h zconf.h
$ CALL MAKE compress.OBJ "CC ''CCOPT' compress" -
compress.c zlib.h zconf.h
$ CALL MAKE crc32.OBJ "CC ''CCOPT' crc32" -
crc32.c zlib.h zconf.h
$ CALL MAKE deflate.OBJ "CC ''CCOPT' deflate" -
deflate.c deflate.h zutil.h zlib.h zconf.h
$ CALL MAKE gzclose.OBJ "CC ''CCOPT' gzclose" -
gzclose.c zutil.h zlib.h zconf.h
$ CALL MAKE gzlib.OBJ "CC ''CCOPT' gzlib" -
gzlib.c zutil.h zlib.h zconf.h
$ CALL MAKE gzread.OBJ "CC ''CCOPT' gzread" -
gzread.c zutil.h zlib.h zconf.h
$ CALL MAKE gzwrite.OBJ "CC ''CCOPT' gzwrite" -
gzwrite.c zutil.h zlib.h zconf.h
$ CALL MAKE infback.OBJ "CC ''CCOPT' infback" -
infback.c zutil.h inftrees.h inflate.h inffast.h inffixed.h
$ CALL MAKE inffast.OBJ "CC ''CCOPT' inffast" -
inffast.c zutil.h zlib.h zconf.h inffast.h
$ CALL MAKE inflate.OBJ "CC ''CCOPT' inflate" -
inflate.c zutil.h zlib.h zconf.h infblock.h
$ CALL MAKE inftrees.OBJ "CC ''CCOPT' inftrees" -
inftrees.c zutil.h zlib.h zconf.h inftrees.h
$ CALL MAKE trees.OBJ "CC ''CCOPT' trees" -
trees.c deflate.h zutil.h zlib.h zconf.h
$ CALL MAKE uncompr.OBJ "CC ''CCOPT' uncompr" -
uncompr.c zlib.h zconf.h
$ CALL MAKE zutil.OBJ "CC ''CCOPT' zutil" -
zutil.c zutil.h zlib.h zconf.h
$ write sys$output "Building Zlib ..."
$ CALL MAKE libz.OLB "lib/crea libz.olb *.obj" *.OBJ
$ write sys$output "Building example..."
$ CALL MAKE example.OBJ "CC ''CCOPT' [.test]example" -
[.test]example.c zlib.h zconf.h
$ call make example.exe "LINK example,libz.olb/lib" example.obj libz.olb
$ write sys$output "Building minigzip..."
$ CALL MAKE minigzip.OBJ "CC ''CCOPT' [.test]minigzip" -
[.test]minigzip.c zlib.h zconf.h
$ call make minigzip.exe -
"LINK minigzip,libz.olb/lib" -
minigzip.obj libz.olb
$ else
$ gosub crea_mms
$ write sys$output "Make ''name' ''version' with ''Make' "
$ 'make'
$ endif
$!
$! Create shareable image
$!
$ gosub crea_olist
$ write sys$output "Creating libzshr.exe"
$ call map_2_shopt 'mapfile' 'optfile'
$ LINK_'lopts'/SHARE=libzshr.exe modules.opt/opt,'optfile'/opt
$ write sys$output "Zlib build completed"
$ delete/nolog tmp.opt;*
$ exit
$AMISS_ERR:
$ write sys$output "No source for config.hin found."
$ write sys$output "Tried any of ''aconf_in_file'"
$ goto err_exit
$CC_ERR:
$ write sys$output "C compiler required to build ''name'"
$ goto err_exit
$ERR_EXIT:
$ set message/facil/ident/sever/text
$ close/nolog optf
$ close/nolog topt
$ close/nolog aconf_in
$ close/nolog aconf
$ close/nolog out
$ close/nolog min
$ close/nolog mod
$ close/nolog h_in
$ write sys$output "Exiting..."
$ exit 2
$!
$!
$MAKE: SUBROUTINE !SUBROUTINE TO CHECK DEPENDENCIES
$ V = 'F$Verify(0)
$! P1 = What we are trying to make
$! P2 = Command to make it
$! P3 - P8 What it depends on
$
$ If F$Search(P1) .Eqs. "" Then Goto Makeit
$ Time = F$CvTime(F$File(P1,"RDT"))
$arg=3
$Loop:
$ Argument = P'arg
$ If Argument .Eqs. "" Then Goto Exit
$ El=0
$Loop2:
$ File = F$Element(El," ",Argument)
$ If File .Eqs. " " Then Goto Endl
$ AFile = ""
$Loop3:
$ OFile = AFile
$ AFile = F$Search(File)
$ If AFile .Eqs. "" .Or. AFile .Eqs. OFile Then Goto NextEl
$ If F$CvTime(F$File(AFile,"RDT")) .Ges. Time Then Goto Makeit
$ Goto Loop3
$NextEL:
$ El = El + 1
$ Goto Loop2
$EndL:
$ arg=arg+1
$ If arg .Le. 8 Then Goto Loop
$ Goto Exit
$
$Makeit:
$ VV=F$VERIFY(0)
$ write sys$output P2
$ 'P2
$ VV='F$Verify(VV)
$Exit:
$ If V Then Set Verify
$ENDSUBROUTINE
$!------------------------------------------------------------------------------
$!
$! Check command line options and set symbols accordingly
$!
$!------------------------------------------------------------------------------
$! Version history
$! 0.01 20041206 First version to receive a number
$! 0.02 20060126 Add new "HELP" target
$ CHECK_OPTS:
$ i = 1
$ OPT_LOOP:
$ if i .lt. 9
$ then
$ cparm = f$edit(p'i',"upcase")
$!
$! Check if parameter actually contains something
$!
$ if f$edit(cparm,"trim") .nes. ""
$ then
$ if cparm .eqs. "DEBUG"
$ then
$ ccopt = ccopt + "/noopt/deb"
$ lopts = lopts + "/deb"
$ endif
$ if f$locate("CCOPT=",cparm) .lt. f$length(cparm)
$ then
$ start = f$locate("=",cparm) + 1
$ len = f$length(cparm) - start
$ ccopt = ccopt + f$extract(start,len,cparm)
$ if f$locate("AS_IS",f$edit(ccopt,"UPCASE")) .lt. f$length(ccopt) -
then s_case = true
$ endif
$ if cparm .eqs. "LINK" then linkonly = true
$ if f$locate("LOPTS=",cparm) .lt. f$length(cparm)
$ then
$ start = f$locate("=",cparm) + 1
$ len = f$length(cparm) - start
$ lopts = lopts + f$extract(start,len,cparm)
$ endif
$ if f$locate("CC=",cparm) .lt. f$length(cparm)
$ then
$ start = f$locate("=",cparm) + 1
$ len = f$length(cparm) - start
$ cc_com = f$extract(start,len,cparm)
if (cc_com .nes. "DECC") .and. -
(cc_com .nes. "VAXC") .and. -
(cc_com .nes. "GNUC")
$ then
$ write sys$output "Unsupported compiler choice ''cc_com' ignored"
$ write sys$output "Use DECC, VAXC, or GNUC instead"
$ else
$ if cc_com .eqs. "DECC" then its_decc = true
$ if cc_com .eqs. "VAXC" then its_vaxc = true
$ if cc_com .eqs. "GNUC" then its_gnuc = true
$ endif
$ endif
$ if f$locate("MAKE=",cparm) .lt. f$length(cparm)
$ then
$ start = f$locate("=",cparm) + 1
$ len = f$length(cparm) - start
$ mmks = f$extract(start,len,cparm)
$ if (mmks .eqs. "MMK") .or. (mmks .eqs. "MMS")
$ then
$ make = mmks
$ else
$ write sys$output "Unsupported make choice ''mmks' ignored"
$ write sys$output "Use MMK or MMS instead"
$ endif
$ endif
$ if cparm .eqs. "HELP" then gosub bhelp
$ endif
$ i = i + 1
$ goto opt_loop
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Look for the compiler used
$!
$! Version history
$! 0.01 20040223 First version to receive a number
$! 0.02 20040229 Save/set value of decc$no_rooted_search_lists
$! 0.03 20060202 Extend handling of GNU C
$! 0.04 20090402 Compaq -> hp
$CHECK_COMPILER:
$ if (.not. (its_decc .or. its_vaxc .or. its_gnuc))
$ then
$ its_decc = (f$search("SYS$SYSTEM:DECC$COMPILER.EXE") .nes. "")
$ its_vaxc = .not. its_decc .and. (F$Search("SYS$System:VAXC.Exe") .nes. "")
$ its_gnuc = .not. (its_decc .or. its_vaxc) .and. (f$trnlnm("gnu_cc") .nes. "")
$ endif
$!
$! Exit if no compiler available
$!
$ if (.not. (its_decc .or. its_vaxc .or. its_gnuc))
$ then goto CC_ERR
$ else
$ if its_decc
$ then
$ write sys$output "CC compiler check ... hp C"
$ if f$trnlnm("decc$no_rooted_search_lists") .nes. ""
$ then
$ dnrsl = f$trnlnm("decc$no_rooted_search_lists")
$ endif
$ define/nolog decc$no_rooted_search_lists 1
$ else
$ if its_vaxc then write sys$output "CC compiler check ... VAX C"
$ if its_gnuc
$ then
$ write sys$output "CC compiler check ... GNU C"
$ if f$trnlnm(topt) then write topt "gnu_cc:[000000]gcclib.olb/lib"
$ if f$trnlnm(optf) then write optf "gnu_cc:[000000]gcclib.olb/lib"
$ cc = "gcc"
$ endif
$ if f$trnlnm(topt) then write topt "sys$share:vaxcrtl.exe/share"
$ if f$trnlnm(optf) then write optf "sys$share:vaxcrtl.exe/share"
$ endif
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! If MMS/MMK are available dump out the descrip.mms if required
$!
$CREA_MMS:
$ write sys$output "Creating descrip.mms..."
$ create descrip.mms
$ open/append out descrip.mms
$ copy sys$input: out
$ deck
# descrip.mms: MMS description file for building zlib on VMS
# written by Martin P.J. Zinser
# <zinser@zinser.no-ip.info or martin.zinser@eurexchange.com>
OBJS = adler32.obj, compress.obj, crc32.obj, gzclose.obj, gzlib.obj\
gzread.obj, gzwrite.obj, uncompr.obj, infback.obj\
deflate.obj, trees.obj, zutil.obj, inflate.obj, \
inftrees.obj, inffast.obj
$ eod
$ write out "CFLAGS=", ccopt
$ write out "LOPTS=", lopts
$ write out "all : example.exe minigzip.exe libz.olb"
$ copy sys$input: out
$ deck
@ write sys$output " Example applications available"
libz.olb : libz.olb($(OBJS))
@ write sys$output " libz available"
example.exe : example.obj libz.olb
link $(LOPTS) example,libz.olb/lib
minigzip.exe : minigzip.obj libz.olb
link $(LOPTS) minigzip,libz.olb/lib
clean :
delete *.obj;*,libz.olb;*,*.opt;*,*.exe;*
# Other dependencies.
adler32.obj : adler32.c zutil.h zlib.h zconf.h
compress.obj : compress.c zlib.h zconf.h
crc32.obj : crc32.c zutil.h zlib.h zconf.h
deflate.obj : deflate.c deflate.h zutil.h zlib.h zconf.h
example.obj : [.test]example.c zlib.h zconf.h
gzclose.obj : gzclose.c zutil.h zlib.h zconf.h
gzlib.obj : gzlib.c zutil.h zlib.h zconf.h
gzread.obj : gzread.c zutil.h zlib.h zconf.h
gzwrite.obj : gzwrite.c zutil.h zlib.h zconf.h
inffast.obj : inffast.c zutil.h zlib.h zconf.h inftrees.h inffast.h
inflate.obj : inflate.c zutil.h zlib.h zconf.h
inftrees.obj : inftrees.c zutil.h zlib.h zconf.h inftrees.h
minigzip.obj : [.test]minigzip.c zlib.h zconf.h
trees.obj : trees.c deflate.h zutil.h zlib.h zconf.h
uncompr.obj : uncompr.c zlib.h zconf.h
zutil.obj : zutil.c zutil.h zlib.h zconf.h
infback.obj : infback.c zutil.h inftrees.h inflate.h inffast.h inffixed.h
$ eod
$ close out
$ return
$!------------------------------------------------------------------------------
$!
$! Read list of core library sources from makefile.in and create options
$! needed to build shareable image
$!
$CREA_OLIST:
$ open/read min makefile.in
$ open/write mod modules.opt
$ src_check_list = "OBJZ =#OBJG ="
$MRLOOP:
$ read/end=mrdone min rec
$ i = 0
$SRC_CHECK_LOOP:
$ src_check = f$element(i, "#", src_check_list)
$ i = i+1
$ if src_check .eqs. "#" then goto mrloop
$ if (f$extract(0,6,rec) .nes. src_check) then goto src_check_loop
$ rec = rec - src_check
$ gosub extra_filnam
$ if (f$element(1,"\",rec) .eqs. "\") then goto mrloop
$MRSLOOP:
$ read/end=mrdone min rec
$ gosub extra_filnam
$ if (f$element(1,"\",rec) .nes. "\") then goto mrsloop
$MRDONE:
$ close min
$ close mod
$ return
$!------------------------------------------------------------------------------
$!
$! Take record extracted in crea_olist and split it into single filenames
$!
$EXTRA_FILNAM:
$ myrec = f$edit(rec - "\", "trim,compress")
$ i = 0
$FELOOP:
$ srcfil = f$element(i," ", myrec)
$ if (srcfil .nes. " ")
$ then
$ write mod f$parse(srcfil,,,"NAME"), ".obj"
$ i = i + 1
$ goto feloop
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Find current Zlib version number
$!
$FIND_VERSION:
$ open/read h_in 'v_file'
$hloop:
$ read/end=hdone h_in rec
$ rec = f$edit(rec,"TRIM")
$ if (f$extract(0,1,rec) .nes. "#") then goto hloop
$ rec = f$edit(rec - "#", "TRIM")
$ if f$element(0," ",rec) .nes. "define" then goto hloop
$ if f$element(1," ",rec) .eqs. v_string
$ then
$ version = 'f$element(2," ",rec)'
$ goto hdone
$ endif
$ goto hloop
$hdone:
$ close h_in
$ return
$!------------------------------------------------------------------------------
$!
$CHECK_CONFIG:
$!
$ in_ldef = f$locate(cdef,libdefs)
$ if (in_ldef .lt. f$length(libdefs))
$ then
$ write aconf "#define ''cdef' 1"
$ libdefs = f$extract(0,in_ldef,libdefs) + -
f$extract(in_ldef + f$length(cdef) + 1, -
f$length(libdefs) - in_ldef - f$length(cdef) - 1, -
libdefs)
$ else
$ if (f$type('cdef') .eqs. "INTEGER")
$ then
$ write aconf "#define ''cdef' ", 'cdef'
$ else
$ if (f$type('cdef') .eqs. "STRING")
$ then
$ write aconf "#define ''cdef' ", """", '''cdef'', """"
$ else
$ gosub check_cc_def
$ endif
$ endif
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Check if this is a define relating to the properties of the C/C++
$! compiler
$!
$ CHECK_CC_DEF:
$ if (cdef .eqs. "_LARGEFILE64_SOURCE")
$ then
$ copy sys$input: 'tc'
$ deck
#include "tconfig"
#define _LARGEFILE
#include <stdio.h>
int main(){
FILE *fp;
fp = fopen("temp.txt","r");
fseeko(fp,1,SEEK_SET);
fclose(fp);
}
$ eod
$ test_inv = false
$ comm_h = false
$ gosub cc_prop_check
$ return
$ endif
$ write aconf "/* ", line, " */"
$ return
$!------------------------------------------------------------------------------
$!
$! Check for properties of C/C++ compiler
$!
$! Version history
$! 0.01 20031020 First version to receive a number
$! 0.02 20031022 Added logic for defines with value
$! 0.03 20040309 Make sure local config file gets not deleted
$! 0.04 20041230 Also write include for configure run
$! 0.05 20050103 Add processing of "comment defines"
$CC_PROP_CHECK:
$ cc_prop = true
$ is_need = false
$ is_need = (f$extract(0,4,cdef) .eqs. "NEED") .or. (test_inv .eq. true)
$ if f$search(th) .eqs. "" then create 'th'
$ set message/nofac/noident/nosever/notext
$ on error then continue
$ cc 'tmpnam'
$ if .not. ($status) then cc_prop = false
$ on error then continue
$! The headers might lie about the capabilities of the RTL
$ link 'tmpnam',tmp.opt/opt
$ if .not. ($status) then cc_prop = false
$ set message/fac/ident/sever/text
$ on error then goto err_exit
$ delete/nolog 'tmpnam'.*;*/exclude='th'
$ if (cc_prop .and. .not. is_need) .or. -
(.not. cc_prop .and. is_need)
$ then
$ write sys$output "Checking for ''cdef'... yes"
$ if f$type('cdef_val'_yes) .nes. ""
$ then
$ if f$type('cdef_val'_yes) .eqs. "INTEGER" -
then call write_config f$fao("#define !AS !UL",cdef,'cdef_val'_yes)
$ if f$type('cdef_val'_yes) .eqs. "STRING" -
then call write_config f$fao("#define !AS !AS",cdef,'cdef_val'_yes)
$ else
$ call write_config f$fao("#define !AS 1",cdef)
$ endif
$ if (cdef .eqs. "HAVE_FSEEKO") .or. (cdef .eqs. "_LARGE_FILES") .or. -
(cdef .eqs. "_LARGEFILE64_SOURCE") then -
call write_config f$string("#define _LARGEFILE 1")
$ else
$ write sys$output "Checking for ''cdef'... no"
$ if (comm_h)
$ then
call write_config f$fao("/* !AS */",line)
$ else
$ if f$type('cdef_val'_no) .nes. ""
$ then
$ if f$type('cdef_val'_no) .eqs. "INTEGER" -
then call write_config f$fao("#define !AS !UL",cdef,'cdef_val'_no)
$ if f$type('cdef_val'_no) .eqs. "STRING" -
then call write_config f$fao("#define !AS !AS",cdef,'cdef_val'_no)
$ else
$ call write_config f$fao("#undef !AS",cdef)
$ endif
$ endif
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Check for properties of C/C++ compiler with multiple result values
$!
$! Version history
$! 0.01 20040127 First version
$! 0.02 20050103 Reconcile changes from cc_prop up to version 0.05
$CC_MPROP_CHECK:
$ cc_prop = true
$ i = 1
$ idel = 1
$ MT_LOOP:
$ if f$type(result_'i') .eqs. "STRING"
$ then
$ set message/nofac/noident/nosever/notext
$ on error then continue
$ cc 'tmpnam'_'i'
$ if .not. ($status) then cc_prop = false
$ on error then continue
$! The headers might lie about the capabilities of the RTL
$ link 'tmpnam'_'i',tmp.opt/opt
$ if .not. ($status) then cc_prop = false
$ set message/fac/ident/sever/text
$ on error then goto err_exit
$ delete/nolog 'tmpnam'_'i'.*;*
$ if (cc_prop)
$ then
$ write sys$output "Checking for ''cdef'... ", mdef_'i'
$ if f$type(mdef_'i') .eqs. "INTEGER" -
then call write_config f$fao("#define !AS !UL",cdef,mdef_'i')
$ if f$type('cdef_val'_yes) .eqs. "STRING" -
then call write_config f$fao("#define !AS !AS",cdef,mdef_'i')
$ goto msym_clean
$ else
$ i = i + 1
$ goto mt_loop
$ endif
$ endif
$ write sys$output "Checking for ''cdef'... no"
$ call write_config f$fao("#undef !AS",cdef)
$ MSYM_CLEAN:
$ if (idel .le. msym_max)
$ then
$ delete/sym mdef_'idel'
$ idel = idel + 1
$ goto msym_clean
$ endif
$ return
$!------------------------------------------------------------------------------
$!
$! Write configuration to both permanent and temporary config file
$!
$! Version history
$! 0.01 20031029 First version to receive a number
$!
$WRITE_CONFIG: SUBROUTINE
$ write aconf 'p1'
$ open/append confh 'th'
$ write confh 'p1'
$ close confh
$ENDSUBROUTINE
$!------------------------------------------------------------------------------
$!
$! Analyze the project map file and create the symbol vector for a shareable
$! image from it
$!
$! Version history
$! 0.01 20120128 First version
$! 0.02 20120226 Add pre-load logic
$!
$ MAP_2_SHOPT: Subroutine
$!
$ SAY := "WRITE_ SYS$OUTPUT"
$!
$ IF F$SEARCH("''P1'") .EQS. ""
$ THEN
$ SAY "MAP_2_SHOPT-E-NOSUCHFILE: Error, inputfile ''p1' not available"
$ goto exit_m2s
$ ENDIF
$ IF "''P2'" .EQS. ""
$ THEN
$ SAY "MAP_2_SHOPT: Error, no output file provided"
$ goto exit_m2s
$ ENDIF
$!
$ module1 = "deflate#deflateEnd#deflateInit_#deflateParams#deflateSetDictionary"
$ module2 = "gzclose#gzerror#gzgetc#gzgets#gzopen#gzprintf#gzputc#gzputs#gzread"
$ module3 = "gzseek#gztell#inflate#inflateEnd#inflateInit_#inflateSetDictionary"
$ module4 = "inflateSync#uncompress#zlibVersion#compress"
$ open/read map 'p1
$ if axp .or. ia64
$ then
$ open/write aopt a.opt
$ open/write bopt b.opt
$ write aopt " CASE_SENSITIVE=YES"
$ write bopt "SYMBOL_VECTOR= (-"
$ mod_sym_num = 1
$ MOD_SYM_LOOP:
$ if f$type(module'mod_sym_num') .nes. ""
$ then
$ mod_in = 0
$ MOD_SYM_IN:
$ shared_proc = f$element(mod_in, "#", module'mod_sym_num')
$ if shared_proc .nes. "#"
$ then
$ write aopt f$fao(" symbol_vector=(!AS/!AS=PROCEDURE)",-
f$edit(shared_proc,"upcase"),shared_proc)
$ write bopt f$fao("!AS=PROCEDURE,-",shared_proc)
$ mod_in = mod_in + 1
$ goto mod_sym_in
$ endif
$ mod_sym_num = mod_sym_num + 1
$ goto mod_sym_loop
$ endif
$MAP_LOOP:
$ read/end=map_end map line
$ if (f$locate("{",line).lt. f$length(line)) .or. -
(f$locate("global:", line) .lt. f$length(line))
$ then
$ proc = true
$ goto map_loop
$ endif
$ if f$locate("}",line).lt. f$length(line) then proc = false
$ if f$locate("local:", line) .lt. f$length(line) then proc = false
$ if proc
$ then
$ shared_proc = f$edit(line,"collapse")
$ chop_semi = f$locate(";", shared_proc)
$ if chop_semi .lt. f$length(shared_proc) then -
shared_proc = f$extract(0, chop_semi, shared_proc)
$ write aopt f$fao(" symbol_vector=(!AS/!AS=PROCEDURE)",-
f$edit(shared_proc,"upcase"),shared_proc)
$ write bopt f$fao("!AS=PROCEDURE,-",shared_proc)
$ endif
$ goto map_loop
$MAP_END:
$ close/nolog aopt
$ close/nolog bopt
$ open/append libopt 'p2'
$ open/read aopt a.opt
$ open/read bopt b.opt
$ALOOP:
$ read/end=aloop_end aopt line
$ write libopt line
$ goto aloop
$ALOOP_END:
$ close/nolog aopt
$ sv = ""
$BLOOP:
$ read/end=bloop_end bopt svn
$ if (svn.nes."")
$ then
$ if (sv.nes."") then write libopt sv
$ sv = svn
$ endif
$ goto bloop
$BLOOP_END:
$ write libopt f$extract(0,f$length(sv)-2,sv), "-"
$ write libopt ")"
$ close/nolog bopt
$ delete/nolog/noconf a.opt;*,b.opt;*
$ else
$ if vax
$ then
$ open/append libopt 'p2'
$ mod_sym_num = 1
$ VMOD_SYM_LOOP:
$ if f$type(module'mod_sym_num') .nes. ""
$ then
$ mod_in = 0
$ VMOD_SYM_IN:
$ shared_proc = f$element(mod_in, "#", module'mod_sym_num')
$ if shared_proc .nes. "#"
$ then
$ write libopt f$fao("UNIVERSAL=!AS",-
f$edit(shared_proc,"upcase"))
$ mod_in = mod_in + 1
$ goto vmod_sym_in
$ endif
$ mod_sym_num = mod_sym_num + 1
$ goto vmod_sym_loop
$ endif
$VMAP_LOOP:
$ read/end=vmap_end map line
$ if (f$locate("{",line).lt. f$length(line)) .or. -
(f$locate("global:", line) .lt. f$length(line))
$ then
$ proc = true
$ goto vmap_loop
$ endif
$ if f$locate("}",line).lt. f$length(line) then proc = false
$ if f$locate("local:", line) .lt. f$length(line) then proc = false
$ if proc
$ then
$ shared_proc = f$edit(line,"collapse")
$ chop_semi = f$locate(";", shared_proc)
$ if chop_semi .lt. f$length(shared_proc) then -
shared_proc = f$extract(0, chop_semi, shared_proc)
$ write libopt f$fao("UNIVERSAL=!AS",-
f$edit(shared_proc,"upcase"))
$ endif
$ goto vmap_loop
$VMAP_END:
$ else
$ write sys$output "Unknown Architecture (Not VAX, AXP, or IA64)"
$ write sys$output "No options file created"
$ endif
$ endif
$ EXIT_M2S:
$ close/nolog map
$ close/nolog libopt
$ endsubroutine

View File

@@ -0,0 +1,342 @@
$! BUILD_XSLT.COM
$!
$! Build the XSLT library
$!
$! Arguments:
$!
$! p1 - "DEBUG" is you want to build with debug
$!
$! This package requires libxml to have already been installed. You need
$! to ensure that the logical name LIBXML is defined and points to the
$! directory containing libxml's .h files
$!
$! This procedure creates the object libraries
$!
$! XML_LIBDIR:LIBXSLT.OLB
$! XML_LIBDIR:LIBEXSLT.OLB
$!
$! and the program
$!
$! XSLTPROC
$!
$! After the library is built, you can link these routines into
$! your code with the command
$!
$! LINK your_modules,XML_LIBDIR:LIBEXSLT/LIB,LIBXSLT/LIBRARY,LIBXML/LIB
$!
$! Change History
$! --------------
$! Command file author : John A Fotheringham (jaf@jafsoft.com)
$! Last update : 2 Nov 2001
$!
$!- configuration -------------------------------------------------------------
$!
$!- compile command.
$!
$ cc_opts = "/INCLUDE=([],XML_SRCDIR:,[-.libxslt])/NAMES=(SHORTENED)/FLOAT=IEEE/IEEE_MODE=DENORM_RESULTS"
$!
$ if p1.eqs."DEBUG"
$ then
$ debug = "Y"
$ cc_command = "CC''cc_opts'/DEBUG/NOOPTIMIZE/LIST/SHOW=ALL"
$ else
$ debug = "N"
$ cc_command = "CC''cc_opts'"
$ endif
$!
$!- configure multiple build passes for each library. -------------------------
$!
$! For each pass:
$!
$! "libname" is the name of the library or module being created
$!
$! "progname" is the name of the program being created
$!
$! "src" is the list of sources to be built into the library or program
$! - This should be compared to the definition of
$! "<NAME>_la_SOURCES" in the MAKEFILE.IN file in
$! corresponding directory.
$!
$ num_passes = 3 ! two libraries and a program
$!
$!- pass 1 - library LIBXSLT
$!
$ libname_1 = "LIBXSLT"
$ h_file_1 = "xslt.h"
$ progname_1 = ""
$!
$ ! see "libxslt_la_SOURCES" in [.libxslt]makefile.in
$ src_1 = "xslt.c xsltutils.c pattern.c templates.c variables.c keys.c"
$ src_1 = src_1 + " numbers.c extensions.c extra.c functions.c"
$ src_1 = src_1 + " namespaces.c imports.c attributes.c documents.c"
$ src_1 = src_1 + " preproc.c transform.c security.c"
$!
$!- pass 2 - library LIBEXSLT
$!
$ libname_2 = "LIBEXSLT"
$ h_file_2 = "exslt.h"
$ progname_2 = ""
$!
$ ! see "libexslt_la_SOURCES" in [.libexslt]makefile.in
$ src_2 = "exslt.c common.c math.c sets.c functions.c strings.c date.c saxon.c dynamic.c"
$!
$!- pass 3 - program XSLTPROC
$!
$ libname_3 = ""
$ h_file_3 = ""
$ progname_3 = "XSLTPROC"
$!
$ ! see "xsltproc_SOURCES" in [.xsltproc]makefile.in
$ src_3 = "xsltproc.c"
$!
$!- set up and check logicals -----------------------------------------------
$!
$! XML_LIBDIR - object library directory
$! XML_SRCDIR - top-level build directory of libxml package -- needed for config.h and trio.h
$! LIBXML - source directory containing .h files for libxml package
$!
$ if f$trnlnm("XML_LIBDIR").eqs.""
$ then
$ on error then continue
$ globfile = f$search("[--...]libxml.olb")
$ if globfile.eqs.""
$ then
$ write sys$output ""
$ write sys$output " You need to define the XML_LIBDIR logical name to"
$ write sys$output " point to the directory containing your object"
$ write sys$output " libraries. This should already contain LIBXML.OLB"
$ write sys$output " from the libxml package, and will be the directory"
$ write sys$output " the new LIBXSLT.OLB library will be placed in"
$ write sys$output ""
$ exit
$ else
$ srcdir = f$parse(globfile,,,"DEVICE") + f$parse(globfile,,,"DIRECTORY")
$ define/process XML_LIBDIR "''srcdir'"
$ write sys$output "Defining XML_LIBDIR as ""''srcdir'"""
$ endif
$ endif
$!
$ if f$trnlnm("libxml").eqs.""
$ then
$ ! look for globals.h in a directory installed paralle to this one
$ on error then continue
$ globfile = f$search("[--...]globals.h")
$ if globfile.eqs.""
$ then
$ write sys$output ""
$ write sys$output " You need to define a LIBXML logical directory to"
$ write sys$output " point to the directory containing the .h files"
$ write sys$output " for the libxml package"
$ write sys$output ""
$ exit
$ else
$ srcdir = f$element(0,"]",globfile)+ "]"
$ define/process LIBXML "''srcdir'"
$ write sys$output "Defining LIBXML as ""''srcdir'"""
$ endif
$ endif
$!
$ if f$trnlnm("XML_SRCDIR").eqs.""
$ then
$ globfile = f$search("[--...]globals.c")
$ if globfile.eqs.""
$ then
$ write sys$output "Can't locate globals.c. You need to manually define a XML_SRCDIR logical"
$ exit
$ else
$ srcdir = f$parse(globfile,,,"DEVICE") + f$parse(globfile,,,"DIRECTORY")
$ define/process XML_SRCDIR "''srcdir'"
$ write sys$output "Defining XML_SRCDIR as ""''srcdir'"""
$ endif
$ endif
$!
$!- set up some working logicals -------------------
$!
$ pass_no = 1
$ set_pass_logical:
$!
$ if pass_no.le.num_passes
$ then
$!
$ Libname = libname_'pass_no'
$ progname = progname_'pass_no'
$ if libname.nes.""
$ then
$ logname = "''libname'_SRCDIR"
$ else
$ logname = "''progname'_SRCDIR"
$ endif
$ findfile = f$element(0," ",src_'pass_no')
$!
$!--- set up a source directory logical
$!
$ if f$trnlnm("''logname'").eqs.""
$ then
$ ! look for the target file in a parallel subdirectory
$ globfile = f$search("[-...]''findfile'")
$ if globfile.eqs.""
$ then
$ write sys$output "Can't locate ''findfile'. You need to manually define a ''logname' logical"
$ exit
$ else
$ srcdir = f$element(0,"]",globfile)+ "]"
$ define/process 'logname' "''srcdir'"
$ write sys$output "Defining ''logname' as ""''srcdir'"""
$ endif
$ endif
$!
$!--- if it's a library, set up a logical pointing to the .h files
$!
$ if libname.nes.""
$ then
$ if f$trnlnm("''libname'").eqs.""
$ then
$ ! look for the target .h file in a parallel subdirectory
$ h_file = h_file_'pass_no'
$ globfile = f$search("[-...]''h_file'")
$ if globfile.eqs.""
$ then
$ write sys$output "Can't locate ''h_file'. You need to manually define a ''libname' logical"
$ exit
$ else
$ includedir = f$element(0,"]",globfile)+ "]"
$ define/process 'libname' "''includedir'"
$ write sys$output "Defining ''libname' as ""''includedir'"""
$ endif
$ endif
$ endif
$!
$ pass_no = pass_no +1
$ goto set_pass_logical
$!
$ endif ! for each pass
$!
$!- set up error handling (such as it is) -------------------------------------
$!
$ exit_status = 1
$ saved_default = f$environment("default")
$ on error then goto ERROR_OUT
$ on control_y then goto ERROR_OUT
$!
$ goto start_here
$ start_here: ! move this line to debug/rerun parts of this command file
$!
$!- compile modules into the library ------------------------------------------
$!
$!
$ pass_no = 1 ! make three passes, one for each library, one for XSLTPROC
$ pass_loop:
$!
$ if pass_no.le.num_passes
$ then
$ Libname = libname_'pass_no'
$ progname = progname_'pass_no'
$ if libname.nes.""
$ then
$ logname = "''libname'_SRCDIR"
$ pass_description = "the XML_LIBDIR:''libname'.OLB object library"
$ else
$ logname = "''progname'_SRCDIR"
$ pass_description = "the programs in ''progname'"
$ endif
$ src = src_'pass_no'
$!
$!- create the library if need
$!
$ if libname.nes.""
$ then
$ if f$search("XML_LIBDIR:''libname'.OLB").eqs.""
$ then
$ write sys$output "Creating new object library XML_LIBDIR:''libname'.OLB..."
$ library/create XML_LIBDIR:'libname'.OLB
$ endif
$ endif
$!
$!- move to the source directory
$!
$ set def 'logname'
$!
$!- define the library and link commands (link command not used as is)
$!
$ if libname.nes.""
$ then
$ lib_command = "LIBRARY/REPLACE XML_LIBDIR:''libname'.OLB"
$ link_command = ""
$ else
$ lib_command = ""
$ link_command = "LINK"
$ endif
$!
$ write sys$output ""
$ write sys$output "Building ''pass_description'
$ write sys$output ""
$!
$ s_no = 0
$ src = f$edit(src,"COMPRESS")
$!
$ source_loop:
$!
$ next_source = f$element (S_no," ",src)
$ if next_source.nes."" .and. next_source.nes." "
$ then
$ call build 'next_source'
$ s_no = s_no + 1
$ goto source_loop
$ endif
$!
$ pass_no = pass_no + 1
$ goto pass_loop
$!
$ endif ! for each pass
$!
$!- Th-th-th-th-th-that's all folks! ------------------------------------------
$!
$EXIT_OUT:
$!
$ set def 'saved_default
$ exit 'exit_status
$!
$
$ERROR_OUT:
$ exit_status = $status
$ write sys$output "''f$message(exit_status)'"
$ goto EXIT_OUT
$!
$!- the BUILD subroutine. Compile then insert into library or link as required
$!
$BUILD: subroutine
$ on warning then goto EXIT_BUILD
$ source_file = p1
$ name = f$element(0,".",source_file)
$ object_file = f$fao("XML_LIBDIR:!AS.OBJ",name)
$!
$!- compile
$ write sys$output "Compiling ",p1,p2,"..."
$ cc_command /object='object_file 'source_file' 'p2'
$!
$!- insert into library if command defined
$!
$ if lib_command.nes.""
$ then
$ lib_command 'object_file'
$ delete/nolog 'object_file';*
$ endif
$!
$!- link module if command defined
$!
$ if link_command.nes.""
$ then
$ text = f$element(0,".",p1) ! lose the ".c"
$ write sys$output "Linking ",text,"..."
$ dbgopts = ""
$ if debug then dbgopts = "/DEBUG"
$ link_command'dbgopts' 'object_file',-
XML_LIBDIR:libexslt/lib,-
XML_LIBDIR:libxslt/lib,-
XML_LIBDIR:libxml/library
$ endif
$!
$EXIT_BUILD:
$ exit $status
$!
$endsubroutine

View File

@@ -0,0 +1,10 @@
$! Compiling with VAXC is said to work, but it requires the usual cruft
$! (vaxcrtl and all), and to avoid hair we don't supply said cruft here.
$ CC/DECC/PREFIX=all VMSBACKUP.C/DEFINE=(HAVE_MT_IOCTLS=0,HAVE_UNIXIO_H=1)
$ CC/DECC/PREFIX=all DCLMAIN.C
$! Probably we don't want match as it probably doesn't implement VMS-style
$! matching, but I haven't looking into the issues yet.
$ CC/DECC/PREFIX=all match
$ LINK/exe=VMSBACKUP.EXE -
vmsbackup.obj,dclmain.obj,match.obj,sys$input/opt
identification="VMSBACKUP4.1.1"

View File

@@ -0,0 +1,13 @@
$ORIGIN 0.0.0.c.2.1.0.3.0.0.2.1.e.f.f.3.ip6.arpa.
$TTL 60
@ IN SOA ns root (
2002042901 ; SERIAL
7200 ; REFRESH
600 ; RETRY
36000000 ; EXPIRE
120 ; MINIMUM
)
NS ns.example.com.
c.a.7.e.d.7.e.f.f.f.0.2.8.0.a.0 PTR sip01.example.com.

View File

@@ -0,0 +1,12 @@
$TTL 3d
@ IN SOA root.localhost. root.sneaky.net. (
2015042907 ; serial
3d ; refresh
1h ; retry
12d ; expire
2h ; negative response TTL
)
IN NS root.localhost.
IN NS localhost. ; secondary name server is preferably externally maintained
www IN A 3.141.59.26

View File

@@ -0,0 +1,26 @@
#! /usr/bin/env escript
% Licensed under the Apache License, Version 2.0 (the "License"); you may not
% use this file except in compliance with the License. You may obtain a copy of
% the License at
%
% http://www.apache.org/licenses/LICENSE-2.0
%
% Unless required by applicable law or agreed to in writing, software
% distributed under the License is distributed on an "AS IS" BASIS, WITHOUT
% WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the
% License for the specific language governing permissions and limitations under
% the License.
loop() ->
loop(io:read("")).
loop({ok, _}) ->
loop(io:read(""));
loop(eof) ->
stop;
loop({error, Reason}) ->
throw({error, Reason}).
main([]) ->
loop().

View File

@@ -0,0 +1,856 @@
Nonterminals
grammar expr_list
expr container_expr block_expr access_expr
no_parens_expr no_parens_zero_expr no_parens_one_expr no_parens_one_ambig_expr
bracket_expr bracket_at_expr bracket_arg matched_expr unmatched_expr max_expr
unmatched_op_expr matched_op_expr no_parens_op_expr no_parens_many_expr
comp_op_eol at_op_eol unary_op_eol and_op_eol or_op_eol capture_op_eol
add_op_eol mult_op_eol two_op_eol three_op_eol pipe_op_eol stab_op_eol
arrow_op_eol match_op_eol when_op_eol in_op_eol in_match_op_eol
type_op_eol rel_op_eol
open_paren close_paren empty_paren eoe
list list_args open_bracket close_bracket
tuple open_curly close_curly
bit_string open_bit close_bit
map map_op map_close map_args map_expr struct_op
assoc_op_eol assoc_expr assoc_base assoc_update assoc_update_kw assoc
container_args_base container_args
call_args_parens_expr call_args_parens_base call_args_parens parens_call
call_args_no_parens_one call_args_no_parens_ambig call_args_no_parens_expr
call_args_no_parens_comma_expr call_args_no_parens_all call_args_no_parens_many
call_args_no_parens_many_strict
stab stab_eoe stab_expr stab_op_eol_and_expr stab_parens_many
kw_eol kw_base kw call_args_no_parens_kw_expr call_args_no_parens_kw
dot_op dot_alias dot_alias_container
dot_identifier dot_op_identifier dot_do_identifier
dot_paren_identifier dot_bracket_identifier
do_block fn_eoe do_eoe end_eoe block_eoe block_item block_list
.
Terminals
identifier kw_identifier kw_identifier_safe kw_identifier_unsafe bracket_identifier
paren_identifier do_identifier block_identifier
fn 'end' aliases
number atom atom_safe atom_unsafe bin_string list_string sigil
dot_call_op op_identifier
comp_op at_op unary_op and_op or_op arrow_op match_op in_op in_match_op
type_op dual_op add_op mult_op two_op three_op pipe_op stab_op when_op assoc_op
capture_op rel_op
'true' 'false' 'nil' 'do' eol ';' ',' '.'
'(' ')' '[' ']' '{' '}' '<<' '>>' '%{}' '%'
.
Rootsymbol grammar.
%% Two shift/reduce conflicts coming from call_args_parens.
Expect 2.
%% Changes in ops and precedence should be reflected on lib/elixir/lib/macro.ex
%% Note though the operator => in practice has lower precedence than all others,
%% its entry in the table is only to support the %{user | foo => bar} syntax.
Left 5 do.
Right 10 stab_op_eol. %% ->
Left 20 ','.
Nonassoc 30 capture_op_eol. %% &
Left 40 in_match_op_eol. %% <-, \\ (allowed in matches along =)
Right 50 when_op_eol. %% when
Right 60 type_op_eol. %% ::
Right 70 pipe_op_eol. %% |
Right 80 assoc_op_eol. %% =>
Right 90 match_op_eol. %% =
Left 130 or_op_eol. %% ||, |||, or
Left 140 and_op_eol. %% &&, &&&, and
Left 150 comp_op_eol. %% ==, !=, =~, ===, !==
Left 160 rel_op_eol. %% <, >, <=, >=
Left 170 arrow_op_eol. %% |>, <<<, >>>, ~>>, <<~, ~>, <~, <~>, <|>
Left 180 in_op_eol. %% in
Left 190 three_op_eol. %% ^^^
Right 200 two_op_eol. %% ++, --, .., <>
Left 210 add_op_eol. %% +, -
Left 220 mult_op_eol. %% *, /
Nonassoc 300 unary_op_eol. %% +, -, !, ^, not, ~~~
Left 310 dot_call_op.
Left 310 dot_op. %% .
Nonassoc 320 at_op_eol. %% @
Nonassoc 330 dot_identifier.
%%% MAIN FLOW OF EXPRESSIONS
grammar -> eoe : nil.
grammar -> expr_list : to_block('$1').
grammar -> eoe expr_list : to_block('$2').
grammar -> expr_list eoe : to_block('$1').
grammar -> eoe expr_list eoe : to_block('$2').
grammar -> '$empty' : nil.
% Note expressions are on reverse order
expr_list -> expr : ['$1'].
expr_list -> expr_list eoe expr : ['$3'|'$1'].
expr -> matched_expr : '$1'.
expr -> no_parens_expr : '$1'.
expr -> unmatched_expr : '$1'.
%% In Elixir we have three main call syntaxes: with parentheses,
%% without parentheses and with do blocks. They are represented
%% in the AST as matched, no_parens and unmatched.
%%
%% Calls without parentheses are further divided according to how
%% problematic they are:
%%
%% (a) no_parens_one: a call with one unproblematic argument
%% (e.g. `f a` or `f g a` and similar) (includes unary operators)
%%
%% (b) no_parens_many: a call with several arguments (e.g. `f a, b`)
%%
%% (c) no_parens_one_ambig: a call with one argument which is
%% itself a no_parens_many or no_parens_one_ambig (e.g. `f g a, b`
%% or `f g h a, b` and similar)
%%
%% Note, in particular, that no_parens_one_ambig expressions are
%% ambiguous and are interpreted such that the outer function has
%% arity 1 (e.g. `f g a, b` is interpreted as `f(g(a, b))` rather
%% than `f(g(a), b)`). Hence the name, no_parens_one_ambig.
%%
%% The distinction is required because we can't, for example, have
%% a function call with a do block as argument inside another do
%% block call, unless there are parentheses:
%%
%% if if true do true else false end do #=> invalid
%% if(if true do true else false end) do #=> valid
%%
%% Similarly, it is not possible to nest calls without parentheses
%% if their arity is more than 1:
%%
%% foo a, bar b, c #=> invalid
%% foo(a, bar b, c) #=> invalid
%% foo bar a, b #=> valid
%% foo a, bar(b, c) #=> valid
%%
%% So the different grammar rules need to take into account
%% if calls without parentheses are do blocks in particular
%% segments and act accordingly.
matched_expr -> matched_expr matched_op_expr : build_op(element(1, '$2'), '$1', element(2, '$2')).
matched_expr -> unary_op_eol matched_expr : build_unary_op('$1', '$2').
matched_expr -> at_op_eol matched_expr : build_unary_op('$1', '$2').
matched_expr -> capture_op_eol matched_expr : build_unary_op('$1', '$2').
matched_expr -> no_parens_one_expr : '$1'.
matched_expr -> no_parens_zero_expr : '$1'.
matched_expr -> access_expr : '$1'.
matched_expr -> access_expr kw_identifier : throw_invalid_kw_identifier('$2').
unmatched_expr -> matched_expr unmatched_op_expr : build_op(element(1, '$2'), '$1', element(2, '$2')).
unmatched_expr -> unmatched_expr matched_op_expr : build_op(element(1, '$2'), '$1', element(2, '$2')).
unmatched_expr -> unmatched_expr unmatched_op_expr : build_op(element(1, '$2'), '$1', element(2, '$2')).
unmatched_expr -> unmatched_expr no_parens_op_expr : build_op(element(1, '$2'), '$1', element(2, '$2')).
unmatched_expr -> unary_op_eol expr : build_unary_op('$1', '$2').
unmatched_expr -> at_op_eol expr : build_unary_op('$1', '$2').
unmatched_expr -> capture_op_eol expr : build_unary_op('$1', '$2').
unmatched_expr -> block_expr : '$1'.
no_parens_expr -> matched_expr no_parens_op_expr : build_op(element(1, '$2'), '$1', element(2, '$2')).
no_parens_expr -> unary_op_eol no_parens_expr : build_unary_op('$1', '$2').
no_parens_expr -> at_op_eol no_parens_expr : build_unary_op('$1', '$2').
no_parens_expr -> capture_op_eol no_parens_expr : build_unary_op('$1', '$2').
no_parens_expr -> no_parens_one_ambig_expr : '$1'.
no_parens_expr -> no_parens_many_expr : '$1'.
block_expr -> parens_call call_args_parens do_block : build_identifier('$1', '$2' ++ '$3').
block_expr -> parens_call call_args_parens call_args_parens do_block : build_nested_parens('$1', '$2', '$3' ++ '$4').
block_expr -> dot_do_identifier do_block : build_identifier('$1', '$2').
block_expr -> dot_identifier call_args_no_parens_all do_block : build_identifier('$1', '$2' ++ '$3').
matched_op_expr -> match_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> add_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> mult_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> two_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> three_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> and_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> or_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> in_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> in_match_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> type_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> when_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> pipe_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> comp_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> rel_op_eol matched_expr : {'$1', '$2'}.
matched_op_expr -> arrow_op_eol matched_expr : {'$1', '$2'}.
%% Warn for no parens subset
matched_op_expr -> arrow_op_eol no_parens_one_expr : warn_pipe('$1', '$2'), {'$1', '$2'}.
unmatched_op_expr -> match_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> add_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> mult_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> two_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> three_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> and_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> or_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> in_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> in_match_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> type_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> when_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> pipe_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> comp_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> rel_op_eol unmatched_expr : {'$1', '$2'}.
unmatched_op_expr -> arrow_op_eol unmatched_expr : {'$1', '$2'}.
no_parens_op_expr -> match_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> add_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> mult_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> two_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> three_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> and_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> or_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> in_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> in_match_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> type_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> when_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> pipe_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> comp_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> rel_op_eol no_parens_expr : {'$1', '$2'}.
no_parens_op_expr -> arrow_op_eol no_parens_expr : {'$1', '$2'}.
%% Warn for no parens subset
no_parens_op_expr -> arrow_op_eol no_parens_one_ambig_expr : warn_pipe('$1', '$2'), {'$1', '$2'}.
no_parens_op_expr -> arrow_op_eol no_parens_many_expr : warn_pipe('$1', '$2'), {'$1', '$2'}.
%% Allow when (and only when) with keywords
no_parens_op_expr -> when_op_eol call_args_no_parens_kw : {'$1', '$2'}.
no_parens_one_ambig_expr -> dot_op_identifier call_args_no_parens_ambig : build_identifier('$1', '$2').
no_parens_one_ambig_expr -> dot_identifier call_args_no_parens_ambig : build_identifier('$1', '$2').
no_parens_many_expr -> dot_op_identifier call_args_no_parens_many_strict : build_identifier('$1', '$2').
no_parens_many_expr -> dot_identifier call_args_no_parens_many_strict : build_identifier('$1', '$2').
no_parens_one_expr -> dot_op_identifier call_args_no_parens_one : build_identifier('$1', '$2').
no_parens_one_expr -> dot_identifier call_args_no_parens_one : build_identifier('$1', '$2').
no_parens_zero_expr -> dot_do_identifier : build_identifier('$1', nil).
no_parens_zero_expr -> dot_identifier : build_identifier('$1', nil).
%% From this point on, we just have constructs that can be
%% used with the access syntax. Notice that (dot_)identifier
%% is not included in this list simply because the tokenizer
%% marks identifiers followed by brackets as bracket_identifier.
access_expr -> bracket_at_expr : '$1'.
access_expr -> bracket_expr : '$1'.
access_expr -> at_op_eol number : build_unary_op('$1', ?exprs('$2')).
access_expr -> unary_op_eol number : build_unary_op('$1', ?exprs('$2')).
access_expr -> capture_op_eol number : build_unary_op('$1', ?exprs('$2')).
access_expr -> fn_eoe stab end_eoe : build_fn('$1', reverse('$2')).
access_expr -> open_paren stab close_paren : build_stab(reverse('$2')).
access_expr -> open_paren stab ';' close_paren : build_stab(reverse('$2')).
access_expr -> open_paren ';' stab ';' close_paren : build_stab(reverse('$3')).
access_expr -> open_paren ';' stab close_paren : build_stab(reverse('$3')).
access_expr -> open_paren ';' close_paren : build_stab([]).
access_expr -> empty_paren : nil.
access_expr -> number : ?exprs('$1').
access_expr -> list : element(1, '$1').
access_expr -> map : '$1'.
access_expr -> tuple : '$1'.
access_expr -> 'true' : ?id('$1').
access_expr -> 'false' : ?id('$1').
access_expr -> 'nil' : ?id('$1').
access_expr -> bin_string : build_bin_string('$1').
access_expr -> list_string : build_list_string('$1').
access_expr -> bit_string : '$1'.
access_expr -> sigil : build_sigil('$1').
access_expr -> max_expr : '$1'.
%% Aliases and properly formed calls. Used by map_expr.
max_expr -> atom : ?exprs('$1').
max_expr -> atom_safe : build_quoted_atom('$1', true).
max_expr -> atom_unsafe : build_quoted_atom('$1', false).
max_expr -> parens_call call_args_parens : build_identifier('$1', '$2').
max_expr -> parens_call call_args_parens call_args_parens : build_nested_parens('$1', '$2', '$3').
max_expr -> dot_alias : '$1'.
bracket_arg -> open_bracket kw close_bracket : build_list('$1', '$2').
bracket_arg -> open_bracket container_expr close_bracket : build_list('$1', '$2').
bracket_arg -> open_bracket container_expr ',' close_bracket : build_list('$1', '$2').
bracket_expr -> dot_bracket_identifier bracket_arg : build_access(build_identifier('$1', nil), '$2').
bracket_expr -> access_expr bracket_arg : build_access('$1', '$2').
bracket_at_expr -> at_op_eol dot_bracket_identifier bracket_arg :
build_access(build_unary_op('$1', build_identifier('$2', nil)), '$3').
bracket_at_expr -> at_op_eol access_expr bracket_arg :
build_access(build_unary_op('$1', '$2'), '$3').
%% Blocks
do_block -> do_eoe 'end' : [[{do, nil}]].
do_block -> do_eoe stab end_eoe : [[{do, build_stab(reverse('$2'))}]].
do_block -> do_eoe block_list 'end' : [[{do, nil}|'$2']].
do_block -> do_eoe stab_eoe block_list 'end' : [[{do, build_stab(reverse('$2'))}|'$3']].
eoe -> eol : '$1'.
eoe -> ';' : '$1'.
eoe -> eol ';' : '$1'.
fn_eoe -> 'fn' : '$1'.
fn_eoe -> 'fn' eoe : '$1'.
do_eoe -> 'do' : '$1'.
do_eoe -> 'do' eoe : '$1'.
end_eoe -> 'end' : '$1'.
end_eoe -> eoe 'end' : '$2'.
block_eoe -> block_identifier : '$1'.
block_eoe -> block_identifier eoe : '$1'.
stab -> stab_expr : ['$1'].
stab -> stab eoe stab_expr : ['$3'|'$1'].
stab_eoe -> stab : '$1'.
stab_eoe -> stab eoe : '$1'.
%% Here, `element(1, Token)` is the stab operator,
%% while `element(2, Token)` is the expression.
stab_expr -> expr :
'$1'.
stab_expr -> stab_op_eol_and_expr :
build_op(element(1, '$1'), [], element(2, '$1')).
stab_expr -> empty_paren stab_op_eol_and_expr :
build_op(element(1, '$2'), [], element(2, '$2')).
stab_expr -> call_args_no_parens_all stab_op_eol_and_expr :
build_op(element(1, '$2'), unwrap_when(unwrap_splice('$1')), element(2, '$2')).
stab_expr -> stab_parens_many stab_op_eol_and_expr :
build_op(element(1, '$2'), unwrap_splice('$1'), element(2, '$2')).
stab_expr -> stab_parens_many when_op expr stab_op_eol_and_expr :
build_op(element(1, '$4'), [{'when', meta_from_token('$2'), unwrap_splice('$1') ++ ['$3']}], element(2, '$4')).
stab_op_eol_and_expr -> stab_op_eol expr : {'$1', '$2'}.
stab_op_eol_and_expr -> stab_op_eol : warn_empty_stab_clause('$1'), {'$1', nil}.
block_item -> block_eoe stab_eoe : {?exprs('$1'), build_stab(reverse('$2'))}.
block_item -> block_eoe : {?exprs('$1'), nil}.
block_list -> block_item : ['$1'].
block_list -> block_item block_list : ['$1'|'$2'].
%% Helpers
open_paren -> '(' : '$1'.
open_paren -> '(' eol : '$1'.
close_paren -> ')' : '$1'.
close_paren -> eol ')' : '$2'.
empty_paren -> open_paren ')' : '$1'.
open_bracket -> '[' : '$1'.
open_bracket -> '[' eol : '$1'.
close_bracket -> ']' : '$1'.
close_bracket -> eol ']' : '$2'.
open_bit -> '<<' : '$1'.
open_bit -> '<<' eol : '$1'.
close_bit -> '>>' : '$1'.
close_bit -> eol '>>' : '$2'.
open_curly -> '{' : '$1'.
open_curly -> '{' eol : '$1'.
close_curly -> '}' : '$1'.
close_curly -> eol '}' : '$2'.
% Operators
add_op_eol -> add_op : '$1'.
add_op_eol -> add_op eol : '$1'.
add_op_eol -> dual_op : '$1'.
add_op_eol -> dual_op eol : '$1'.
mult_op_eol -> mult_op : '$1'.
mult_op_eol -> mult_op eol : '$1'.
two_op_eol -> two_op : '$1'.
two_op_eol -> two_op eol : '$1'.
three_op_eol -> three_op : '$1'.
three_op_eol -> three_op eol : '$1'.
pipe_op_eol -> pipe_op : '$1'.
pipe_op_eol -> pipe_op eol : '$1'.
capture_op_eol -> capture_op : '$1'.
capture_op_eol -> capture_op eol : '$1'.
unary_op_eol -> unary_op : '$1'.
unary_op_eol -> unary_op eol : '$1'.
unary_op_eol -> dual_op : '$1'.
unary_op_eol -> dual_op eol : '$1'.
match_op_eol -> match_op : '$1'.
match_op_eol -> match_op eol : '$1'.
and_op_eol -> and_op : '$1'.
and_op_eol -> and_op eol : '$1'.
or_op_eol -> or_op : '$1'.
or_op_eol -> or_op eol : '$1'.
in_op_eol -> in_op : '$1'.
in_op_eol -> in_op eol : '$1'.
in_match_op_eol -> in_match_op : '$1'.
in_match_op_eol -> in_match_op eol : '$1'.
type_op_eol -> type_op : '$1'.
type_op_eol -> type_op eol : '$1'.
when_op_eol -> when_op : '$1'.
when_op_eol -> when_op eol : '$1'.
stab_op_eol -> stab_op : '$1'.
stab_op_eol -> stab_op eol : '$1'.
at_op_eol -> at_op : '$1'.
at_op_eol -> at_op eol : '$1'.
comp_op_eol -> comp_op : '$1'.
comp_op_eol -> comp_op eol : '$1'.
rel_op_eol -> rel_op : '$1'.
rel_op_eol -> rel_op eol : '$1'.
arrow_op_eol -> arrow_op : '$1'.
arrow_op_eol -> arrow_op eol : '$1'.
% Dot operator
dot_op -> '.' : '$1'.
dot_op -> '.' eol : '$1'.
dot_identifier -> identifier : '$1'.
dot_identifier -> matched_expr dot_op identifier : build_dot('$2', '$1', '$3').
dot_alias -> aliases : {'__aliases__', meta_from_token('$1', 0), ?exprs('$1')}.
dot_alias -> matched_expr dot_op aliases : build_dot_alias('$2', '$1', '$3').
dot_alias -> matched_expr dot_op dot_alias_container : build_dot_container('$2', '$1', '$3').
dot_alias_container -> open_curly '}' : [].
dot_alias_container -> open_curly container_args close_curly : '$2'.
dot_op_identifier -> op_identifier : '$1'.
dot_op_identifier -> matched_expr dot_op op_identifier : build_dot('$2', '$1', '$3').
dot_do_identifier -> do_identifier : '$1'.
dot_do_identifier -> matched_expr dot_op do_identifier : build_dot('$2', '$1', '$3').
dot_bracket_identifier -> bracket_identifier : '$1'.
dot_bracket_identifier -> matched_expr dot_op bracket_identifier : build_dot('$2', '$1', '$3').
dot_paren_identifier -> paren_identifier : '$1'.
dot_paren_identifier -> matched_expr dot_op paren_identifier : build_dot('$2', '$1', '$3').
parens_call -> dot_paren_identifier : '$1'.
parens_call -> matched_expr dot_call_op : {'.', meta_from_token('$2'), ['$1']}. % Fun/local calls
% Function calls with no parentheses
call_args_no_parens_expr -> matched_expr : '$1'.
call_args_no_parens_expr -> no_parens_expr : throw_no_parens_many_strict('$1').
call_args_no_parens_comma_expr -> matched_expr ',' call_args_no_parens_expr : ['$3', '$1'].
call_args_no_parens_comma_expr -> call_args_no_parens_comma_expr ',' call_args_no_parens_expr : ['$3'|'$1'].
call_args_no_parens_all -> call_args_no_parens_one : '$1'.
call_args_no_parens_all -> call_args_no_parens_ambig : '$1'.
call_args_no_parens_all -> call_args_no_parens_many : '$1'.
call_args_no_parens_one -> call_args_no_parens_kw : ['$1'].
call_args_no_parens_one -> matched_expr : ['$1'].
call_args_no_parens_ambig -> no_parens_expr : ['$1'].
call_args_no_parens_many -> matched_expr ',' call_args_no_parens_kw : ['$1', '$3'].
call_args_no_parens_many -> call_args_no_parens_comma_expr : reverse('$1').
call_args_no_parens_many -> call_args_no_parens_comma_expr ',' call_args_no_parens_kw : reverse(['$3'|'$1']).
call_args_no_parens_many_strict -> call_args_no_parens_many : '$1'.
call_args_no_parens_many_strict -> open_paren call_args_no_parens_kw close_paren : throw_no_parens_strict('$1').
call_args_no_parens_many_strict -> open_paren call_args_no_parens_many close_paren : throw_no_parens_strict('$1').
stab_parens_many -> open_paren call_args_no_parens_kw close_paren : ['$2'].
stab_parens_many -> open_paren call_args_no_parens_many close_paren : '$2'.
% Containers
container_expr -> matched_expr : '$1'.
container_expr -> unmatched_expr : '$1'.
container_expr -> no_parens_expr : throw_no_parens_container_strict('$1').
container_args_base -> container_expr : ['$1'].
container_args_base -> container_args_base ',' container_expr : ['$3'|'$1'].
container_args -> container_args_base : lists:reverse('$1').
container_args -> container_args_base ',' : lists:reverse('$1').
container_args -> container_args_base ',' kw : lists:reverse(['$3'|'$1']).
% Function calls with parentheses
call_args_parens_expr -> matched_expr : '$1'.
call_args_parens_expr -> unmatched_expr : '$1'.
call_args_parens_expr -> no_parens_expr : throw_no_parens_many_strict('$1').
call_args_parens_base -> call_args_parens_expr : ['$1'].
call_args_parens_base -> call_args_parens_base ',' call_args_parens_expr : ['$3'|'$1'].
call_args_parens -> empty_paren : [].
call_args_parens -> open_paren no_parens_expr close_paren : ['$2'].
call_args_parens -> open_paren kw close_paren : ['$2'].
call_args_parens -> open_paren call_args_parens_base close_paren : reverse('$2').
call_args_parens -> open_paren call_args_parens_base ',' kw close_paren : reverse(['$4'|'$2']).
% KV
kw_eol -> kw_identifier : ?exprs('$1').
kw_eol -> kw_identifier eol : ?exprs('$1').
kw_eol -> kw_identifier_safe : build_quoted_atom('$1', true).
kw_eol -> kw_identifier_safe eol : build_quoted_atom('$1', true).
kw_eol -> kw_identifier_unsafe : build_quoted_atom('$1', false).
kw_eol -> kw_identifier_unsafe eol : build_quoted_atom('$1', false).
kw_base -> kw_eol container_expr : [{'$1', '$2'}].
kw_base -> kw_base ',' kw_eol container_expr : [{'$3', '$4'}|'$1'].
kw -> kw_base : reverse('$1').
kw -> kw_base ',' : reverse('$1').
call_args_no_parens_kw_expr -> kw_eol matched_expr : {'$1', '$2'}.
call_args_no_parens_kw_expr -> kw_eol no_parens_expr : {'$1', '$2'}.
call_args_no_parens_kw -> call_args_no_parens_kw_expr : ['$1'].
call_args_no_parens_kw -> call_args_no_parens_kw_expr ',' call_args_no_parens_kw : ['$1'|'$3'].
% Lists
list_args -> kw : '$1'.
list_args -> container_args_base : reverse('$1').
list_args -> container_args_base ',' : reverse('$1').
list_args -> container_args_base ',' kw : reverse('$1', '$3').
list -> open_bracket ']' : build_list('$1', []).
list -> open_bracket list_args close_bracket : build_list('$1', '$2').
% Tuple
tuple -> open_curly '}' : build_tuple('$1', []).
tuple -> open_curly container_args close_curly : build_tuple('$1', '$2').
% Bitstrings
bit_string -> open_bit '>>' : build_bit('$1', []).
bit_string -> open_bit container_args close_bit : build_bit('$1', '$2').
% Map and structs
%% Allow unquote/@something/aliases inside maps and structs.
map_expr -> max_expr : '$1'.
map_expr -> dot_identifier : build_identifier('$1', nil).
map_expr -> at_op_eol map_expr : build_unary_op('$1', '$2').
assoc_op_eol -> assoc_op : '$1'.
assoc_op_eol -> assoc_op eol : '$1'.
assoc_expr -> matched_expr assoc_op_eol matched_expr : {'$1', '$3'}.
assoc_expr -> unmatched_expr assoc_op_eol unmatched_expr : {'$1', '$3'}.
assoc_expr -> matched_expr assoc_op_eol unmatched_expr : {'$1', '$3'}.
assoc_expr -> unmatched_expr assoc_op_eol matched_expr : {'$1', '$3'}.
assoc_expr -> map_expr : '$1'.
assoc_update -> matched_expr pipe_op_eol assoc_expr : {'$2', '$1', ['$3']}.
assoc_update -> unmatched_expr pipe_op_eol assoc_expr : {'$2', '$1', ['$3']}.
assoc_update_kw -> matched_expr pipe_op_eol kw : {'$2', '$1', '$3'}.
assoc_update_kw -> unmatched_expr pipe_op_eol kw : {'$2', '$1', '$3'}.
assoc_base -> assoc_expr : ['$1'].
assoc_base -> assoc_base ',' assoc_expr : ['$3'|'$1'].
assoc -> assoc_base : reverse('$1').
assoc -> assoc_base ',' : reverse('$1').
map_op -> '%{}' : '$1'.
map_op -> '%{}' eol : '$1'.
map_close -> kw close_curly : '$1'.
map_close -> assoc close_curly : '$1'.
map_close -> assoc_base ',' kw close_curly : reverse('$1', '$3').
map_args -> open_curly '}' : build_map('$1', []).
map_args -> open_curly map_close : build_map('$1', '$2').
map_args -> open_curly assoc_update close_curly : build_map_update('$1', '$2', []).
map_args -> open_curly assoc_update ',' close_curly : build_map_update('$1', '$2', []).
map_args -> open_curly assoc_update ',' map_close : build_map_update('$1', '$2', '$4').
map_args -> open_curly assoc_update_kw close_curly : build_map_update('$1', '$2', []).
struct_op -> '%' : '$1'.
map -> map_op map_args : '$2'.
map -> struct_op map_expr map_args : {'%', meta_from_token('$1'), ['$2', '$3']}.
map -> struct_op map_expr eol map_args : {'%', meta_from_token('$1'), ['$2', '$4']}.
Erlang code.
-define(file(), get(elixir_parser_file)).
-define(id(Token), element(1, Token)).
-define(location(Token), element(2, Token)).
-define(exprs(Token), element(3, Token)).
-define(meta(Node), element(2, Node)).
-define(rearrange_uop(Op), (Op == 'not' orelse Op == '!')).
%% The following directive is needed for (significantly) faster
%% compilation of the generated .erl file by the HiPE compiler
-compile([{hipe, [{regalloc, linear_scan}]}]).
-import(lists, [reverse/1, reverse/2]).
meta_from_token(Token, Counter) -> [{counter, Counter}|meta_from_token(Token)].
meta_from_token(Token) -> meta_from_location(?location(Token)).
meta_from_location({Line, Column, EndColumn})
when is_integer(Line), is_integer(Column), is_integer(EndColumn) -> [{line, Line}].
%% Operators
build_op({_Kind, Location, 'in'}, {UOp, _, [Left]}, Right) when ?rearrange_uop(UOp) ->
{UOp, meta_from_location(Location), [{'in', meta_from_location(Location), [Left, Right]}]};
build_op({_Kind, Location, Op}, Left, Right) ->
{Op, meta_from_location(Location), [Left, Right]}.
build_unary_op({_Kind, Location, Op}, Expr) ->
{Op, meta_from_location(Location), [Expr]}.
build_list(Marker, Args) ->
{Args, ?location(Marker)}.
build_tuple(_Marker, [Left, Right]) ->
{Left, Right};
build_tuple(Marker, Args) ->
{'{}', meta_from_token(Marker), Args}.
build_bit(Marker, Args) ->
{'<<>>', meta_from_token(Marker), Args}.
build_map(Marker, Args) ->
{'%{}', meta_from_token(Marker), Args}.
build_map_update(Marker, {Pipe, Left, Right}, Extra) ->
{'%{}', meta_from_token(Marker), [build_op(Pipe, Left, Right ++ Extra)]}.
%% Blocks
build_block([{Op, _, [_]}]=Exprs) when ?rearrange_uop(Op) -> {'__block__', [], Exprs};
build_block([{unquote_splicing, _, Args}]=Exprs) when
length(Args) =< 2 -> {'__block__', [], Exprs};
build_block([Expr]) -> Expr;
build_block(Exprs) -> {'__block__', [], Exprs}.
%% Dots
build_dot_alias(Dot, {'__aliases__', _, Left}, {'aliases', _, Right}) ->
{'__aliases__', meta_from_token(Dot), Left ++ Right};
build_dot_alias(_Dot, Atom, {'aliases', _, _} = Token) when is_atom(Atom) ->
throw_bad_atom(Token);
build_dot_alias(Dot, Other, {'aliases', _, Right}) ->
{'__aliases__', meta_from_token(Dot), [Other|Right]}.
build_dot_container(Dot, Left, Right) ->
Meta = meta_from_token(Dot),
{{'.', Meta, [Left, '{}']}, Meta, Right}.
build_dot(Dot, Left, Right) ->
{'.', meta_from_token(Dot), [Left, extract_identifier(Right)]}.
extract_identifier({Kind, _, Identifier}) when
Kind == identifier; Kind == bracket_identifier; Kind == paren_identifier;
Kind == do_identifier; Kind == op_identifier ->
Identifier.
%% Identifiers
build_nested_parens(Dot, Args1, Args2) ->
Identifier = build_identifier(Dot, Args1),
Meta = ?meta(Identifier),
{Identifier, Meta, Args2}.
build_identifier({'.', Meta, _} = Dot, Args) ->
FArgs = case Args of
nil -> [];
_ -> Args
end,
{Dot, Meta, FArgs};
build_identifier({op_identifier, Location, Identifier}, [Arg]) ->
{Identifier, [{ambiguous_op, nil}|meta_from_location(Location)], [Arg]};
build_identifier({_, Location, Identifier}, Args) ->
{Identifier, meta_from_location(Location), Args}.
%% Fn
build_fn(Op, [{'->', _, [_, _]}|_] = Stab) ->
{fn, meta_from_token(Op), build_stab(Stab)};
build_fn(Op, _Stab) ->
throw(meta_from_token(Op), "expected clauses to be defined with -> inside: ", "'fn'").
%% Access
build_access(Expr, {List, Location}) ->
Meta = meta_from_location(Location),
{{'.', Meta, ['Elixir.Access', get]}, Meta, [Expr, List]}.
%% Interpolation aware
build_sigil({sigil, Location, Sigil, Parts, Modifiers}) ->
Meta = meta_from_location(Location),
{list_to_atom("sigil_" ++ [Sigil]), Meta, [{'<<>>', Meta, string_parts(Parts)}, Modifiers]}.
build_bin_string({bin_string, _Location, [H]}) when is_binary(H) ->
H;
build_bin_string({bin_string, Location, Args}) ->
{'<<>>', meta_from_location(Location), string_parts(Args)}.
build_list_string({list_string, _Location, [H]}) when is_binary(H) ->
elixir_utils:characters_to_list(H);
build_list_string({list_string, Location, Args}) ->
Meta = meta_from_location(Location),
{{'.', Meta, ['Elixir.String', to_char_list]}, Meta, [{'<<>>', Meta, string_parts(Args)}]}.
build_quoted_atom({_, _Location, [H]}, Safe) when is_binary(H) ->
Op = binary_to_atom_op(Safe), erlang:Op(H, utf8);
build_quoted_atom({_, Location, Args}, Safe) ->
Meta = meta_from_location(Location),
{{'.', Meta, [erlang, binary_to_atom_op(Safe)]}, Meta, [{'<<>>', Meta, string_parts(Args)}, utf8]}.
binary_to_atom_op(true) -> binary_to_existing_atom;
binary_to_atom_op(false) -> binary_to_atom.
string_parts(Parts) ->
[string_part(Part) || Part <- Parts].
string_part(Binary) when is_binary(Binary) ->
Binary;
string_part({Location, Tokens}) ->
Form = string_tokens_parse(Tokens),
Meta = meta_from_location(Location),
{'::', Meta, [{{'.', Meta, ['Elixir.Kernel', to_string]}, Meta, [Form]}, {binary, Meta, nil}]}.
string_tokens_parse(Tokens) ->
case parse(Tokens) of
{ok, Forms} -> Forms;
{error, _} = Error -> throw(Error)
end.
%% Keywords
build_stab([{'->', Meta, [Left, Right]}|T]) ->
build_stab(Meta, T, Left, [Right], []);
build_stab(Else) ->
build_block(Else).
build_stab(Old, [{'->', New, [Left, Right]}|T], Marker, Temp, Acc) ->
H = {'->', Old, [Marker, build_block(reverse(Temp))]},
build_stab(New, T, Left, [Right], [H|Acc]);
build_stab(Meta, [H|T], Marker, Temp, Acc) ->
build_stab(Meta, T, Marker, [H|Temp], Acc);
build_stab(Meta, [], Marker, Temp, Acc) ->
H = {'->', Meta, [Marker, build_block(reverse(Temp))]},
reverse([H|Acc]).
%% Every time the parser sees a (unquote_splicing())
%% it assumes that a block is being spliced, wrapping
%% the splicing in a __block__. But in the stab clause,
%% we can have (unquote_splicing(1, 2, 3)) -> :ok, in such
%% case, we don't actually want the block, since it is
%% an arg style call. unwrap_splice unwraps the splice
%% from such blocks.
unwrap_splice([{'__block__', [], [{unquote_splicing, _, _}] = Splice}]) ->
Splice;
unwrap_splice(Other) -> Other.
unwrap_when(Args) ->
case elixir_utils:split_last(Args) of
{Start, {'when', Meta, [_, _] = End}} ->
[{'when', Meta, Start ++ End}];
{_, _} ->
Args
end.
to_block([One]) -> One;
to_block(Other) -> {'__block__', [], reverse(Other)}.
%% Warnings and errors
throw(Meta, Error, Token) ->
Line =
case lists:keyfind(line, 1, Meta) of
{line, L} -> L;
false -> 0
end,
throw({error, {Line, ?MODULE, [Error, Token]}}).
throw_bad_atom(Token) ->
throw(meta_from_token(Token), "atom cannot be followed by an alias. If the '.' was meant to be "
"part of the atom's name, the atom name must be quoted. Syntax error before: ", "'.'").
throw_no_parens_strict(Token) ->
throw(meta_from_token(Token), "unexpected parentheses. If you are making a "
"function call, do not insert spaces between the function name and the "
"opening parentheses. Syntax error before: ", "'('").
throw_no_parens_many_strict(Node) ->
throw(?meta(Node),
"unexpected comma. Parentheses are required to solve ambiguity in nested calls.\n\n"
"This error happens when you have nested function calls without parentheses. "
"For example:\n\n"
" one a, two b, c, d\n\n"
"In the example above, we don't know if the parameters \"c\" and \"d\" apply "
"to the function \"one\" or \"two\". You can solve this by explicitly adding "
"parentheses:\n\n"
" one a, two(b, c, d)\n\n"
"Elixir cannot compile otherwise. Syntax error before: ", "','").
throw_no_parens_container_strict(Node) ->
throw(?meta(Node),
"unexpected comma. Parentheses are required to solve ambiguity inside containers.\n\n"
"This error may happen when you forget a comma in a list or other container:\n\n"
" [a, b c, d]\n\n"
"Or when you have ambiguous calls:\n\n"
" [one, two three, four, five]\n\n"
"In the example above, we don't know if the parameters \"four\" and \"five\" "
"belongs to the list or the function \"two\". You can solve this by explicitly "
"adding parentheses:\n\n"
" [one, two(three, four), five]\n\n"
"Elixir cannot compile otherwise. Syntax error before: ", "','").
throw_invalid_kw_identifier({_, _, do} = Token) ->
throw(meta_from_token(Token), elixir_tokenizer:invalid_do_error("unexpected keyword \"do:\""), "'do:'");
throw_invalid_kw_identifier({_, _, KW} = Token) ->
throw(meta_from_token(Token), "syntax error before: ", "'" ++ atom_to_list(KW) ++ "':").
%% TODO: Make those warnings errors.
warn_empty_stab_clause({stab_op, {Line, _Begin, _End}, '->'}) ->
elixir_errors:warn(Line, ?file(),
"an expression is always required on the right side of ->. "
"Please provide a value after ->").
warn_pipe({arrow_op, {Line, _Begin, _End}, Op}, {_, [_|_], [_|_]}) ->
elixir_errors:warn(Line, ?file(),
io_lib:format(
"you are piping into a function call without parentheses, which may be ambiguous. "
"Please wrap the function you are piping into in parentheses. For example:\n\n"
" foo 1 ~ts bar 2 ~ts baz 3\n\n"
"Should be written as:\n\n"
" foo(1) ~ts bar(2) ~ts baz(3)\n",
[Op, Op, Op, Op]
)
);
warn_pipe(_Token, _) ->
ok.

View File

@@ -0,0 +1,260 @@
%% -*- mode: erlang;erlang-indent-level: 4;indent-tabs-mode: nil -*-
%% ex: ts=4 sw=4 ft=erlang et
%% This is a sample rebar.conf file that shows examples of some of rebar's
%% options.
%% == Core ==
%% Extend list of always recursive commands
{recursive_cmds, []}.
%% Check required ERTS or OTP release version
{require_erts_vsn, ".*"}.
{require_otp_vsn, ".*"}.
{require_min_otp_vsn, ".*"}.
%% Additional library directories to add to the code path
{lib_dirs, []}.
%% == Erlang Compiler ==
%% Erlang files to compile before the rest. Rebar automatically compiles
%% parse_transforms and custom behaviours before anything other than the files
%% in this list.
{erl_first_files, ["src/mymib1.erl", "src/mymib2.erl"]}.
%% Erlang compiler options
{erl_opts, [no_debug_info,
{i, "myinclude"},
{src_dirs, ["src", "src2", "src3"]},
{platform_define,
"(linux|solaris|freebsd|darwin)", 'HAVE_SENDFILE'},
{platform_define, "(linux|freebsd)", 'BACKLOG', 128},
{platform_define, "R13", 'old_inets'}]}.
%% MIB Options?
{mib_opts, []}.
%% SNMP mibs to compile first?
{mib_first_files, []}.
%% leex options
{xrl_opts, []}.
%% leex files to compile first
{xrl_first_files, []}.
%% yecc options
{yrl_opts, []}.
%% yecc files to compile first
{yrl_first_files, []}.
%% == EDoc ==
%% EDoc options
{edoc_opts, []}.
%% == Port Compiler ==
%% Port compilation environment variables. See rebar_port_compiler.erl for
%% more info. Default is `[]'
{port_env, [{"CFLAGS", "$CFLAGS -Ifoo"},
{"freebsd", "LDFLAGS", "$LDFLAGS -lfoo"}]}.
%% port_specs
%% List of filenames or wildcards to be compiled. May also contain a tuple
%% consisting of a regular expression to be applied against the system
%% architecture as a filter.
{port_specs, [{"priv/so_name.so", ["c_src/*.c"]},
{"linux", "priv/hello_linux", ["c_src/hello_linux.c"]},
{"linux", "priv/hello_linux", ["c_src/*.c"], [{env, []}]}]}.
%% == escriptize ==
{escript_name, "application"}.
{escript_incl_apps, []}.
{escript_shebang, "#!/usr/bin/env escript\n"}.
{escript_comment, "%%\n"}.
{escript_emu_args, "%%! -pa application/application/ebin\n"}.
%% == LFE Compiler ==
%% LFE files to compile before the rest
{lfe_first_files, []}.
%% Options for the LFE compiler: reuse {erl_opts, []}
%% == ErlyDTL Compiler ==
%% Options for the ErlyDTL compiler
{erlydtl_opts, []}.
%% == Proto compiler ==
{proto_opts, [
{compiler, protobuffs},
{src_dirs, ["src"]}
]}.
%% Available compilers for protocol buffer files (*.proto):
%% protobuffs (default)
%% gpb
%% Optional src_dirs which is a list of directories where
%% to look for .proto files, default is src
%% Options for the gpb protocol buffer compiler,
%% if selected by the proto_compiler option
{gpb_opts, []}.
%% == EUnit ==
%% Options for eunit:test()
{eunit_opts, []}.
%% Additional compile options for eunit. erl_opts is also used
{eunit_compile_opts, []}.
%% Same as erl_first_files, but used only when running 'eunit'
{eunit_first_files, []}.
%% == Cover ==
%% Whether to enable coverage reporting. Default is `false'
{cover_enabled, false}.
%% Whether to print coverage report to console. Default is `false'
{cover_print_enabled, false}.
%% Whether to export coverage report to file. Default is `false'
{cover_export_enabled, false}.
%% == Common Test ==
%% Override the default "test" directory in which SUITEs are located
{ct_dir, "itest"}.
%% Override the default "logs" directory in which SUITEs are logged
{ct_log_dir, "test/logs"}.
%% Option to pass extra parameters when launching Common Test
{ct_extra_params, "-boot start_sasl -s myapp"}.
%% Option to use short names (i.e., -sname test) when starting ct
{ct_use_short_names, true}.
%% == QuickCheck ==
%% If qc_mod is unspecified, rebar tries to detect Triq or EQC
{qc_opts, [{qc_mod, module()}, Options]}.
%% Additional compile options for qc. erl_opts is also used
{qc_compile_opts, []}.
%% Same as erl_first_files, but used only when running 'qc'
{qc_first_files, []}.
%% == Cleanup ==
%% Which files to cleanup
{clean_files, ["file", "file2"]}.
%% == OTP Applications ==
%% Enable validation of the OTP app module list. Default is 'true'
{validate_app_modules, true}.
%% == Dependencies ==
%% Where to put any downloaded dependencies. Default is "deps"
{deps_dir, "deps"}.
%% What dependencies we have, dependencies can be of 3 forms, an application
%% name as an atom, eg. mochiweb, a name and a version (from the .app file), or
%% an application name, a version and the SCM details on how to fetch it (SCM
%% type, location and revision).
%% Rebar currently supports git, hg, bzr, svn, rsync, fossil, and p4.
{deps, [app_name,
{rebar, "1.0.*"},
{rebar, ".*",
{git, "git://github.com/rebar/rebar.git"}},
{rebar, ".*",
{git, "git://github.com/rebar/rebar.git", "Rev"}},
{rebar, "1.0.*",
{git, "git://github.com/rebar/rebar.git", {branch, "master"}}},
{rebar, "1.0.0",
{git, "git://github.com/rebar/rebar.git", {tag, "1.0.0"}}},
%% Dependencies can be marked as 'raw'. Rebar does not require
%% such dependencies to have a standard Erlang/OTP layout
%% which assumes the presence of either
%% "src/dependency_name.app.src" or "ebin/dependency_name.app"
%% files.
%%
%% 'raw' dependencies can still contain 'rebar.config' and
%% even can have the proper OTP directory layout, but they
%% won't be compiled.
%%
%% Only a subset of rebar commands will be executed on the
%% 'raw' subdirectories: get-deps, update-deps, check-deps,
%% list-deps and delete-deps.
{rebar, "",
{git, "git://github.com/rebar/rebar.git", {branch, "master"}},
[raw]},
{app_name, ".*", {hg, "https://www.example.org/url"}},
{app_name, ".*", {rsync, "Url"}},
{app_name, ".*", {svn, "https://www.example.org/url"}},
{app_name, ".*", {svn, "svn://svn.example.org/url"}},
{app_name, ".*", {bzr, "https://www.example.org/url", "Rev"}},
{app_name, ".*", {fossil, "https://www.example.org/url"}},
{app_name, ".*", {fossil, "https://www.example.org/url", "Vsn"}},
{app_name, ".*", {p4, "//depot/subdir/app_dir"}}]}.
%% == Subdirectories ==
%% Subdirectories?
{sub_dirs, ["dir1", "dir2"]}.
%% == Plugins ==
%% Plugins you wish to include.
%% These can include any module on the code path, including deps.
%% Alternatively, plugins can be placed as source files in the plugin_dir, in
%% which case they will be compiled and loaded dynamically at runtime.
{plugins, [plugin1, plugin2]}.
%% Override the directory in which plugin sources can be found.
%% Defaults to ./plugins
{plugin_dir, "some_other_directory"}.
%% == Pre/Post Command Hooks ==
{pre_hooks, [{clean, "./prepare_package_files.sh"},
{"linux", compile, "c_src/build_linux.sh"},
{compile, "escript generate_headers"},
{compile, "escript check_headers"}]}.
{post_hooks, [{clean, "touch file1.out"},
{"freebsd", compile, "c_src/freebsd_tweaks.sh"},
{eunit, "touch file2.out"},
{compile, "touch postcompile.out"}]}.
%% == xref ==
{xref_warnings, false}.
%% optional extra paths to include in xref:set_library_path/2.
%% specified relative location of rebar.config.
%% e.g. {xref_extra_paths,["../gtknode/src"]}
{xref_extra_paths,[]}.
%% xref checks to run
{xref_checks, [undefined_function_calls, undefined_functions,
locals_not_used, exports_not_used,
deprecated_function_calls, deprecated_functions]}.
%% Optional custom xref queries (xref manual has details) specified as
%% {xref_queries, [{query_string(), expected_query_result()},...]}
%% The following for example removes all references to mod:*foo/4
%% functions from undefined external function calls as those are in a
%% generated module
{xref_queries,
[{"(XC - UC) || (XU - X - B"
" - (\"mod\":\".*foo\"/\"4\"))",[]}]}.

View File

@@ -0,0 +1,158 @@
%% THIS FILE IS GENERATED. DO NOT EDIT IT MANUALLY %%
{sub_dirs,["rel","apps/riak"]}.
{require_otp_vsn,"R16|17"}.
{cover_enabled,true}.
{lib_dirs,["apps/riak"]}.
{erl_opts,[debug_info,fail_on_warning]}.
{eunit_opts,[verbose]}.
{erlydtl_opts,[{compiler_options,[report,return,debug_info]}]}.
{deps,[{rebar_lock_deps_plugin,".*",
{git,"git://github.com/seth/rebar_lock_deps_plugin.git",
"7a5835029c42b8138325405237ea7e8516a84800"}},
{node_package,".*",
{git,"git://github.com/basho/node_package.git",
"a829631eccebe3c1d7657a0075584f55bf342977"}},
{goldrush,".*",
{git,"git://github.com/DeadZen/goldrush.git",
"71e63212f12c25827e0c1b4198d37d5d018a7fec"}},
{lager,".*",
{git,"git://github.com/basho/lager.git",
"b6b6cebcb27ccff8acc59ae775acebc2f52e4926"}},
{syslog,".*",
{git,"git://github.com/Vagabond/erlang-syslog.git",
"918c9b453e0811b24f2c99b35b712b0ef9f29c7e"}},
{lager_syslog,".*",
{git,"git://github.com/basho/lager_syslog.git",
"fa2e7e3daee0d0a59dadb820fd3381eac4a65770"}},
{cluster_info,".*",
{git,"git://github.com/basho/cluster_info.git",
"e231144ca32dc83317be3360a4a259c73826b08a"}},
{sidejob,".*",
{git,"git://github.com/basho/sidejob.git",
"c5aabba2d7daa80c340e110902bbcfcb552ccdcf"}},
{erlang_js,".*",
{git,"git://github.com/basho/erlang_js.git",
"07467d899ab90a2b719ad19ab0be0048c1c8d873"}},
{meck,".*",
{git,"git://github.com/basho/meck.git",
"dde759050eff19a1a80fd854d7375174b191665d"}},
{getopt,".*",
{git,"git://github.com/jcomellas/getopt.git",
"659a28f4145bc9843598972854299dc4ea77e4cb"}},
{neotoma,".*",
{git,"git://github.com/seancribbs/neotoma.git",
"760928ec8870da02eb11bccb501e2700925d06c6"}},
{cuttlefish,".*",
{git,"git://github.com/basho/cuttlefish.git",
"c92c8325aeaea6b6ba7516bbd434f8e408f87d60"}},
{bitcask,".*",
{git,"git://github.com/basho/bitcask.git",
"c74d0c43fdefdd435f7621ddf1fc2995b5bd123c"}},
{eper,".*",
{git,"git://github.com/basho/eper.git",
"7222ecaebceb5422e74a9c1503043bbc6036f6b7"}},
{edown,".*",
{git,"git://github.com/uwiger/edown.git",
"d62ec85281e451a46ba30045917c119d65b72a84"}},
{sext,".*",
{git,"git://github.com/basho/sext.git",
"846b9cc22456287a572efd4c924203d77778670f"}},
{poolboy,".*",
{git,"git://github.com/basho/poolboy.git",
"8bb45fbc715c5f493642a1cc572ec7017d0d5fa3"}},
{basho_stats,".*",
{git,"git://github.com/basho/basho_stats.git",
"19c532af235ae675439d491b329c55c2f9b02deb"}},
{riak_sysmon,".*",
{git,"git://github.com/basho/riak_sysmon.git",
"26a58bcaba96d07df885f7b3db4d4306f995ce14"}},
{eleveldb,".*",
{git,"git://github.com/basho/eleveldb.git",
"0e4e4e7cf3ddc26523a77f853ea9409c1707b26c"}},
{riak_ensemble,".*",
{git,"git://github.com/basho/riak_ensemble",
"78dc8f623353a212ca3cf12236d1e9ac824bde16"}},
{pbkdf2,".*",
{git,"git://github.com/basho/erlang-pbkdf2.git",
"7076584f5377e98600a7e2cb81980b2992fb2f71"}},
{parse_trans,".*",
{git,"git://github.com/uwiger/parse_trans.git",
"82cc00264aa1bad8fc5c0739b7541feb4a843432"}},
{bear,".*",
{git,"git://github.com/basho/bear.git",
"da820a13c607c3f816ee8b83c587266da5389761"}},
{folsom,".*",
{git,"git://github.com/basho/folsom.git",
"72944523b6467c9f7add5f1c96dd5020424a2681"}},
{setup,".*",
{git,"git://github.com/uwiger/setup.git",
"51ee7c9f64d2bbe9dcbb58c278e8fbfd4d0ca5e2"}},
{exometer_core,".*",
{git,"git://github.com/basho/exometer_core.git",
"b47a5d65d9500c2b8f6ccc50e34005503589ef77"}},
{clique,".*",
{git,"git://github.com/basho/clique.git",
"3af4db8ea0f74aca42f6713446dcd5915c795a74"}},
{riak_core,".*",
{git,"git://github.com/basho/riak_core.git",
"044c4e7f8dbfe8c49c45f2f7090adff4cd5aba50"}},
{riak_pipe,".*",
{git,"git://github.com/basho/riak_pipe.git",
"3c0abc7ba301d57940c5a9c5de368b70429c28ff"}},
{protobuffs,".*",
{git,"git://github.com/basho/erlang_protobuffs.git",
"f88fc3c6881687432ddd5546b3c7b08009dfb26f"}},
{riak_pb,".*",
{git,"git://github.com/basho/riak_pb.git",
"78c50efa698f33f7d6ab1c7f5fa4666ec03b46b4"}},
{mochiweb,".*",
{git,"git://github.com/basho/mochiweb.git",
"ade2a9b29a11034eb550c1d79b4f991bf5ca05ba"}},
{webmachine,".*",
{git,"git://github.com/basho/webmachine.git",
"7677c240f4a7ed020f4bab48278224966bb42311"}},
{riak_api,".*",
{git,"git://github.com/basho/riak_api.git",
"2781e66796903bc6847bffcf71a6ba7a05d69275"}},
{riak_dt,".*",
{git,"git://github.com/basho/riak_dt.git",
"f7981d4ad7407ddc085f133f204dd71bf9d50c56"}},
{eunit_formatters,".*",
{git,"git://github.com/seancribbs/eunit_formatters",
"96b6ced4d45ba641cbf2c8a8ae9b350dd300bc10"}},
{riak_kv,".*",
{git,"git://github.com/basho/riak_kv.git",
"404619cb57574cd43e2dc0dc0453884ec6732a99"}},
{merge_index,".*",
{git,"git://github.com/basho/merge_index.git",
"b701dde5c28956c3b629411e5ff7e50cbb5cb4b3"}},
{riak_search,".*",
{git,"git://github.com/basho/riak_search.git",
"8fe4a8c020a74c52ee877bf6dd410824b4f79f8b"}},
{erlydtl,".*",
{git,"git://github.com/evanmiller/erlydtl.git",
"d20b53f04837a1053ed18987f645cb60eae82453"}},
{riak_control,".*",
{git,"git://github.com/basho/riak_control.git",
"09073ce672260e1ec0ba3999fabed7f319624ba1"}},
{riaknostic,".*",
{git,"git://github.com/basho/riaknostic.git",
"101d95bddff4b70afcd1dd5442b8c6651887e0a4"}},
{kvc,".*",
{git,"git://github.com/etrepum/kvc.git",
"5565fe51857747662410cc3c06362ebcf48a2f04"}},
{ibrowse,".*",
{git,"git://github.com/cmullaparthi/ibrowse.git",
"e8ae353c16d4f0897abb9f80025b52925b974dd1"}},
{yokozuna,".*",
{git,"git://github.com/basho/yokozuna.git",
"5868266b11f131d14c85495e50f899f3fe8158ba"}},
{canola,".*",
{git,"git://github.com/basho/canola.git",
"9bdfee88fce20b3a01b7003696b53eb21913d6fb"}},
{riak_auth_mods,".*",
{git,"git://github.com/basho/riak_auth_mods.git",
"31b8b30e6c215418522eaa615264ae9769a87410"}}]}.
{plugins,[rebar_lock_deps_plugin]}.

View File

@@ -0,0 +1,16 @@
[{<<"goldrush">>,
{git,"git://github.com/DeadZen/goldrush.git",
{ref,"71e63212f12c25827e0c1b4198d37d5d018a7fec"}},
1},
{<<"riak_dt">>,
{git,"git://github.com/helium/riak_dt.git",
{ref,"15d66cb26c2028c1ad1271c359b1d5da213825c3"}},
0},
{<<"lager">>,
{git,"git://github.com/basho/lager.git",
{ref,"d33ccf3b69de09a628fe38b4d7981bb8671b8a4f"}},
0},
{<<"eleveldb">>,
{git,"git://github.com/helium/eleveldb.git",
{ref,"29a5360dc0365b3330dd0cd45b0b8166f3b854be"}},
0}].

256
samples/Erlang/lfe_scan.xrl Normal file
View File

@@ -0,0 +1,256 @@
%% Copyright (c) 2008-2013 Robert Virding
%%
%% Licensed under the Apache License, Version 2.0 (the "License");
%% you may not use this file except in compliance with the License.
%% You may obtain a copy of the License at
%%
%% http://www.apache.org/licenses/LICENSE-2.0
%%
%% Unless required by applicable law or agreed to in writing, software
%% distributed under the License is distributed on an "AS IS" BASIS,
%% WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
%% See the License for the specific language governing permissions and
%% limitations under the License.
%% File : lfe_scan.xrl
%% Author : Robert Virding
%% Purpose : Token definitions for Lisp Flavoured Erlang.
Definitions.
B = [01]
O = [0-7]
D = [0-9]
H = [0-9a-fA-F]
B36 = [0-9a-zA-Z]
U = [A-Z]
L = [a-z]
A = ({U}|{L})
DEL = [][()}{";\000-\s]
SYM = [^][()}{";\000-\s\177-\237]
SSYM = [^][()}{"|;#`',\000-\s\177-\237]
WS = ([\000-\s]|;[^\n]*)
Rules.
%% Bracketed Comments using #| foo |#
#{D}*\|[^\|]*\|+([^#\|][^\|]*\|+)*# :
block_comment(string:substr(TokenChars, 3)).
%% Separators
' : {token,{'\'',TokenLine}}.
` : {token,{'`',TokenLine}}.
, : {token,{',',TokenLine}}.
,@ : {token,{',@',TokenLine}}.
\. : {token,{'.',TokenLine}}.
[][()}{] : {token,{list_to_atom(TokenChars),TokenLine}}.
#{D}*[bB]\( : {token,{'#B(',TokenLine}}.
#{D}*[mM]\( : {token,{'#M(',TokenLine}}.
#{D}*\( : {token,{'#(',TokenLine}}.
#{D}*\. : {token,{'#.',TokenLine}}.
#{D}*` : {token,{'#`',TokenLine}}.
#{D}*; : {token,{'#;',TokenLine}}.
#{D}*, : {token,{'#,',TokenLine}}.
#{D}*,@ : {token,{'#,@',TokenLine}}.
%% Characters
#{D}*\\(x{H}+|.) : char_token(skip_past(TokenChars, $\\, $\\), TokenLine).
%% Based numbers
#{D}*\*{SYM}+ : base_token(skip_past(TokenChars, $*, $*), 2, TokenLine).
#{D}*[bB]{SYM}+ : base_token(skip_past(TokenChars, $b, $B), 2, TokenLine).
#{D}*[oO]{SYM}+ : base_token(skip_past(TokenChars, $o, $O), 8, TokenLine).
#{D}*[dD]{SYM}+ : base_token(skip_past(TokenChars, $d, $D), 10, TokenLine).
#{D}*[xX]{SYM}+ : base_token(skip_past(TokenChars, $x, $X), 16, TokenLine).
#{D}*[rR]{SYM}+ :
%% Scan over digit chars to get base.
{Base,[_|Ds]} = base1(tl(TokenChars), 10, 0),
base_token(Ds, Base, TokenLine).
%% String
"(\\x{H}+;|\\.|[^"\\])*" :
%% Strip quotes.
S = string:substr(TokenChars, 2, TokenLen - 2),
{token,{string,TokenLine,chars(S)}}.
%% Binary string
#"(\\x{H}+;|\\.|[^"\\])*" :
%% Strip quotes.
S = string:substr(TokenChars, 3, TokenLen - 3),
Bin = unicode:characters_to_binary(chars(S), utf8, utf8),
{token,{binary,TokenLine,Bin}}.
%% Symbols
\|(\\x{H}+;|\\.|[^|\\])*\| :
%% Strip quotes.
S = string:substr(TokenChars, 2, TokenLen - 2),
symbol_token(chars(S), TokenLine).
%% Funs
#'{SSYM}{SYM}*/{D}+ :
%% Strip sharpsign single-quote.
FunStr = string:substr(TokenChars,3),
{token,{'#\'',TokenLine,FunStr}}.
%% Atoms
[+-]?{D}+ :
case catch {ok,list_to_integer(TokenChars)} of
{ok,I} -> {token,{number,TokenLine,I}};
_ -> {error,"illegal integer"}
end.
[+-]?{D}+\.{D}+([eE][+-]?{D}+)? :
case catch {ok,list_to_float(TokenChars)} of
{ok,F} -> {token,{number,TokenLine,F}};
_ -> {error,"illegal float"}
end.
{SSYM}{SYM}* :
symbol_token(TokenChars, TokenLine).
{WS}+ : skip_token.
Erlang code.
%% Copyright (c) 2008-2013 Robert Virding
%%
%% Licensed under the Apache License, Version 2.0 (the "License");
%% you may not use this file except in compliance with the License.
%% You may obtain a copy of the License at
%%
%% http://www.apache.org/licenses/LICENSE-2.0
%%
%% Unless required by applicable law or agreed to in writing, software
%% distributed under the License is distributed on an "AS IS" BASIS,
%% WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
%% See the License for the specific language governing permissions and
%% limitations under the License.
%% File : lfe_scan.erl
%% Author : Robert Virding
%% Purpose : Token definitions for Lisp Flavoured Erlang.
-export([start_symbol_char/1,symbol_char/1]).
-import(string, [substr/2,substr/3]).
%% start_symbol_char(Char) -> true | false.
%% symbol_char(Char) -> true | false.
%% Define start symbol chars and symbol chars.
start_symbol_char($#) -> false;
start_symbol_char($`) -> false;
start_symbol_char($') -> false; %'
start_symbol_char($,) -> false;
start_symbol_char($|) -> false; %Symbol quote character
start_symbol_char(C) -> symbol_char(C).
symbol_char($() -> false;
symbol_char($)) -> false;
symbol_char($[) -> false;
symbol_char($]) -> false;
symbol_char(${) -> false;
symbol_char($}) -> false;
symbol_char($") -> false;
symbol_char($;) -> false;
symbol_char(C) -> ((C > $\s) and (C =< $~)) orelse (C > $\240).
%% symbol_token(Chars, Line) -> {token,{symbol,Line,Symbol}} | {error,E}.
%% Build a symbol from list of legal characters, else error.
symbol_token(Cs, L) ->
case catch {ok,list_to_atom(Cs)} of
{ok,S} -> {token,{symbol,L,S}};
_ -> {error,"illegal symbol"}
end.
%% base_token(Chars, Base, Line) -> Integer.
%% Convert a string of Base characters into a number. We only allow
%% base betqeen 2 and 36, and an optional sign character first.
base_token(_, B, _) when B < 2; B > 36 ->
{error,"illegal number base"};
base_token([$+|Cs], B, L) -> base_token(Cs, B, +1, L);
base_token([$-|Cs], B, L) -> base_token(Cs, B, -1, L);
base_token(Cs, B, L) -> base_token(Cs, B, +1, L).
base_token(Cs, B, S, L) ->
case base1(Cs, B, 0) of
{N,[]} -> {token,{number,L,S*N}};
{_,_} -> {error,"illegal based number"}
end.
base1([C|Cs], Base, SoFar) when C >= $0, C =< $9, C < Base + $0 ->
Next = SoFar * Base + (C - $0),
base1(Cs, Base, Next);
base1([C|Cs], Base, SoFar) when C >= $a, C =< $z, C < Base + $a - 10 ->
Next = SoFar * Base + (C - $a + 10),
base1(Cs, Base, Next);
base1([C|Cs], Base, SoFar) when C >= $A, C =< $Z, C < Base + $A - 10 ->
Next = SoFar * Base + (C - $A + 10),
base1(Cs, Base, Next);
base1([C|Cs], _Base, SoFar) -> {SoFar,[C|Cs]};
base1([], _Base, N) -> {N,[]}.
-define(IS_UNICODE(C), ((C >= 0) and (C =< 16#10FFFF))).
%% char_token(InputChars, Line) -> {token,{number,L,N}} | {error,E}.
%% Convert an input string into the corresponding character. For a
%% sequence of hex characters we check resultant is code is in the
%% unicode range.
char_token([$x,C|Cs], L) ->
case base1([C|Cs], 16, 0) of
{N,[]} when ?IS_UNICODE(N) -> {token,{number,L,N}};
_ -> {error,"illegal character"}
end;
char_token([C], L) -> {token,{number,L,C}}.
%% chars(InputChars) -> Chars.
%% Convert an input string into the corresponding string characters.
%% We know that the input string is correct.
chars([$\\,$x,C|Cs0]) ->
case hex_char(C) of
true ->
case base1([C|Cs0], 16, 0) of
{N,[$;|Cs1]} -> [N|chars(Cs1)];
_Other -> [escape_char($x)|chars([C|Cs0])]
end;
false -> [escape_char($x)|chars([C|Cs0])]
end;
chars([$\\,C|Cs]) -> [escape_char(C)|chars(Cs)];
chars([C|Cs]) -> [C|chars(Cs)];
chars([]) -> [].
hex_char(C) when C >= $0, C =< $9 -> true;
hex_char(C) when C >= $a, C =< $f -> true;
hex_char(C) when C >= $A, C =< $F -> true;
hex_char(_) -> false.
escape_char($b) -> $\b; %\b = BS
escape_char($t) -> $\t; %\t = TAB
escape_char($n) -> $\n; %\n = LF
escape_char($v) -> $\v; %\v = VT
escape_char($f) -> $\f; %\f = FF
escape_char($r) -> $\r; %\r = CR
escape_char($e) -> $\e; %\e = ESC
escape_char($s) -> $\s; %\s = SPC
escape_char($d) -> $\d; %\d = DEL
escape_char(C) -> C.
%% Block Comment:
%% Provide a sensible error when people attempt to include nested
%% comments because currently the parser cannot process them without
%% a rebuild. But simply exploding on a '#|' is not going to be that
%% helpful.
block_comment(TokenChars) ->
%% Check we're not opening another comment block.
case string:str(TokenChars, "#|") of
0 -> skip_token; %% No nesting found
_ -> {error, "illegal nested block comment"}
end.
%% skip_until(String, Char1, Char2) -> String.
%% skip_past(String, Char1, Char2) -> String.
%% skip_until([C|_]=Cs, C1, C2) when C =:= C1 ; C =:= C2 -> Cs;
%% skip_until([_|Cs], C1, C2) -> skip_until(Cs, C1, C2);
%% skip_until([], _, _) -> [].
skip_past([C|Cs], C1, C2) when C =:= C1 ; C =:= C2 -> Cs;
skip_past([_|Cs], C1, C2) -> skip_past(Cs, C1, C2);
skip_past([], _, _) -> [].

View File

@@ -119,4 +119,3 @@ execute_overlay([{copy, In, Out} | Rest], Vars, BaseDir, TargetDir) ->
exit_code(ExitCode) -> exit_code(ExitCode) ->
erlang:halt(ExitCode, [{flush, true}]). erlang:halt(ExitCode, [{flush, true}]).

104
samples/Erlang/single-context.es Executable file
View File

@@ -0,0 +1,104 @@
#! /usr/bin/env escript
% This file is part of Emonk released under the MIT license.
% See the LICENSE file for more information.
main([]) ->
start(64, 1000);
main([N]) ->
start(list_to_integer(N), 1000);
main([N, M]) ->
start(list_to_integer(N), list_to_integer(M)).
start(N, M) ->
code:add_pathz("test"),
code:add_pathz("ebin"),
{ok, Ctx} = emonk:create_ctx(),
{ok, undefined} = emonk:eval(Ctx, js()),
run(Ctx, N, M),
wait(N).
run(_, 0, _) ->
ok;
run(Ctx, N, M) ->
Self = self(),
Pid = spawn(fun() -> do_js(Self, Ctx, M) end),
io:format("Spawned: ~p~n", [Pid]),
run(Ctx, N-1, M).
wait(0) ->
ok;
wait(N) ->
receive
{finished, Pid} -> ok
end,
io:format("Finished: ~p~n", [Pid]),
wait(N-1).
do_js(Parent, _, 0) ->
Parent ! {finished, self()};
do_js(Parent, Ctx, M) ->
io:format("Running: ~p~n", [M]),
Test = random_test(),
{ok, [Resp]} = emonk:call(Ctx, <<"f">>, [Test]),
Sorted = sort(Resp),
true = Test == Sorted,
do_js(Parent, Ctx, M-1).
js() ->
<<"var f = function(x) {return [x];};">>.
random_test() ->
Tests = [
null,
true,
false,
1,
-1,
3.1416,
-3.1416,
12.0e10,
1.234E+10,
-1.234E-10,
10.0,
123.456,
10.0,
<<"foo">>,
<<"foo", 5, "bar">>,
<<"">>,
<<"\n\n\n">>,
<<"\" \b\f\r\n\t\"">>,
{[]},
{[{<<"foo">>, <<"bar">>}]},
{[{<<"foo">>, <<"bar">>}, {<<"baz">>, 123}]},
[],
[[]],
[1, <<"foo">>],
{[{<<"foo">>, [123]}]},
{[{<<"foo">>, [1, 2, 3]}]},
{[{<<"foo">>, {[{<<"bar">>, true}]}}]},
{[
{<<"foo">>, []},
{<<"bar">>, {[{<<"baz">>, true}]}}, {<<"alice">>, <<"bob">>}
]},
[-123, <<"foo">>, {[{<<"bar">>, []}]}, null]
],
{_, [Test | _]} = lists:split(random:uniform(length(Tests)) - 1, Tests),
sort(Test).
sort({Props}) ->
objsort(Props, []);
sort(List) when is_list(List) ->
lstsort(List, []);
sort(Other) ->
Other.
objsort([], Acc) ->
{lists:sort(Acc)};
objsort([{K,V} | Rest], Acc) ->
objsort(Rest, [{K, sort(V)} | Acc]).
lstsort([], Acc) ->
lists:reverse(Acc);
lstsort([Val | Rest], Acc) ->
lstsort(Rest, [sort(Val) | Acc]).

View File

@@ -0,0 +1,54 @@
typedef engine isEngineMessage;
typedef turn isTurnMessage;
typedef connect isConnectMessage;
typedef disconnect isDisconnectMessage;
ClientMessage(char* data) => ();
ParseMessage(char* data) => (int type, int client, char* data);
ReadMessage(int type, int client, char* data) => ();
ParseEngine(int type, int client, char* data) => (int client, int direction);
DoEngine(int client, int direction) => ();
ParseTurn(int type, int client, char* data) => (int client, int direction);
DoTurn(int client, int direction) => ();
ParseConnect(int type, int client, char* data)
=> (int client, char* host, int port);
DoConnect(int client, char* host, int port) => ();
ParseDisconnect(int type, int client, char* data) => (int client);
DoDisconnect(int client) => ();
UpdateBoard(ClientList clients) => (ClientList clients);
SendData(ClientList clients) => ();
DoUpdate(ClientList clients) => ();
DataTimer() => (ClientList clients);
GetClients() => (ClientList clients);
Wait(ClientList clients) => (ClientList clients);
Listen () => (char* data);
source Listen => ClientMessage;
source DataTimer => DoUpdate;
DataTimer = GetClients -> Wait;
DoUpdate = UpdateBoard -> SendData;
ClientMessage=ParseMessage -> ReadMessage;
ReadMessage:[engine, _, _] = ParseEngine -> DoEngine;
ReadMessage:[turn, _, _] = ParseTurn -> DoTurn;
ReadMessage:[connect, _, _] = ParseConnect -> DoConnect;
ReadMessage:[disconnect, _, _] = ParseDisconnect -> DoDisconnect;
atomic GetClients:{client_lock};
atomic DoConnect:{client_lock};
atomic DoDisconnect:{client_lock};

View File

@@ -0,0 +1,44 @@
typedef xml TestXML;
typedef html TestHTML;
typedef inCache TestInCache;
Page (int socket) => ();
ReadRequest (int socket) => (int socket, bool close, image_tag *request);
CheckCache (int socket, bool close, image_tag *request)
=> (int socket, bool close, image_tag *request);
Handler (int socket, bool close, image_tag *request)
=> (int socket, bool close, image_tag *request);
Complete (int socket, bool close, image_tag *request) => ();
ReadInFromDisk (int socket, bool close, image_tag *request)
=> (int socket, bool close, image_tag *request, __u8 *rgb_data);
Write (int socket, bool close, image_tag *request)
=> (int socket, bool close, image_tag *request);
Compress(int socket, bool close, image_tag *request, __u8 *rgb_data)
=> (int socket, bool close, image_tag *request);
StoreInCache(int socket, bool close, image_tag *request)
=> (int socket, bool close, image_tag *request);
Listen ()
=> (int socket);
source Listen => Page;
Handler:[_, _, inCache]=;
Handler:[_, _, _]=ReadInFromDisk -> Compress -> StoreInCache;
Page = ReadRequest -> CheckCache-> Handler -> Write -> Complete;
atomic CheckCache:{cache};
atomic StoreInCache:{cache};
atomic Complete:{cache};
handle error ReadInFromDisk => FourOhFor;

151
samples/FLUX/mbittorrent.fx Normal file
View File

@@ -0,0 +1,151 @@
typedef choke TestChoke;
typedef unchoke TestUnchoke;
typedef interested TestInterested;
typedef uninterested TestUninterested;
typedef request TestRequest;
typedef cancel TestCancel;
typedef piece TestPiece;
typedef bitfield TestBitfield;
typedef have TestHave;
typedef piececomplete TestPieceComplete;
CheckinWithTracker (torrent_data_t *tdata)
=> ();
SendRequestToTracker (torrent_data_t *tdata)
=> (torrent_data_t *tdata, int socket);
GetTrackerResponse (torrent_data_t *tdata, int socket)
=> ();
UpdateChokeList (torrent_data_t *tdata)
=> ();
PickChoked (torrent_data_t *tdata)
=> (torrent_data_t *tdata, chokelist_t clist);
SendChokeUnchoke (torrent_data_t *tdata, chokelist_t clist)
=> ();
SetupConnection (torrent_data_t *tdata, int socket)
=> ();
Handshake (torrent_data_t *tdata, int socket)
=> (torrent_data_t *tdata, client_data_t *client);
SendBitfield (torrent_data_t *tdata, client_data_t *client)
=> ();
Message (torrent_data_t *tdata, client_data_t *client)
=> ();
ReadMessage (torrent_data_t *tdata, client_data_t *client)
=> (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload);
HandleMessage (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (client_data_t *client);
MessageDone (client_data_t *client)
=> ();
CompletePiece (torrent_data_t *tdata, client_data_t *client, int piece)
=> (torrent_data_t *tdata, client_data_t *client);
VerifyPiece (torrent_data_t *tdata, client_data_t *client, int piece)
=> (torrent_data_t *tdata, client_data_t *client, int piece);
SendHave (torrent_data_t *tdata, client_data_t *client, int piece)
=> (torrent_data_t *tdata, client_data_t *client);
SendUninterested (torrent_data_t *tdata, client_data_t *client)
=> (torrent_data_t *tdata, client_data_t *client);
Choke (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (client_data_t *client);
Cancel (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (client_data_t *client);
Interested (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (client_data_t *client);
Uninterested (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (client_data_t *client);
Bitfield (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (client_data_t *client);
Unchoke (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (torrent_data_t *tdata, client_data_t *client);
SendRequest (torrent_data_t *tdata, client_data_t *client)
=> (client_data_t *client);
Have (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (torrent_data_t *tdata, client_data_t *client);
Piece (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (torrent_data_t *tdata, client_data_t *client, int piece);
Request (torrent_data_t *tdata, client_data_t *client, int type, int length, char *payload)
=> (client_data_t *client);
SendKeepAlives (torrent_data_t *tdata)
=> ();
GetClients ()
=> (int maxfd, fd_set *fds);
SelectSockets (int maxfd, fd_set *fds)
=> (fd_set *fds);
CheckSockets (fd_set *fds)
=> (torrent_data_t *tdata, client_data_t *client);
TrackerTimer ()
=> (torrent_data_t *tdata);
ChokeTimer ()
=> (torrent_data_t *tdata);
Connect ()
=> (torrent_data_t *tdata, int socket);
KeepAliveTimer ()
=> (torrent_data_t *tdata);
Listen ()
=> (torrent_data_t *tdata, client_data_t *client);
source TrackerTimer => CheckinWithTracker;
source ChokeTimer => UpdateChokeList;
source Connect => SetupConnection;
source Listen => Message;
source KeepAliveTimer => SendKeepAlives;
Listen = GetClients -> SelectSockets -> CheckSockets;
CheckinWithTracker = SendRequestToTracker -> GetTrackerResponse;
UpdateChokeList = PickChoked -> SendChokeUnchoke;
SetupConnection = Handshake -> SendBitfield;
Message = ReadMessage -> HandleMessage -> MessageDone;
CompletePiece:[_, _, piececomplete] = VerifyPiece -> SendHave -> SendUninterested;
HandleMessage:[_, _, choke, _, _] = Choke;
HandleMessage:[_, _, unchoke, _, _] = Unchoke -> SendRequest;
HandleMessage:[_, _, interested, _, _] = Interested;
HandleMessage:[_, _, uninterested, _, _] = Uninterested;
HandleMessage:[_, _, request, _, _] = Request;
HandleMessage:[_, _, cancel, _, _] = Cancel;
HandleMessage:[_, _, piece, _, _] = Piece -> CompletePiece -> SendRequest;
HandleMessage:[_, _, bitfield, _, _] = Bitfield;
HandleMessage:[_, _, have, _, _] = Have -> SendRequest;
atomic GetClients:{BigLock};
atomic CheckSockets:{BigLock};
atomic Message:{BigLock};
atomic CheckinWithTracker:{BigLock};
atomic UpdateChokeList:{BigLock};
atomic SetupConnection:{BigLock};
atomic SendKeepAlives:{BigLock};

38
samples/FLUX/test.fx Normal file
View File

@@ -0,0 +1,38 @@
// concrete node signatures
Listen ()
=> (int socket);
ReadRequest (int socket)
=> (int socket, bool close, image_tag *request);
CheckCache (int socket, bool close, image_tag *request)
=> (int socket, bool close, image_tag *request);
// omitted for space:
// ReadInFromDisk, StoreInCache
Compress (int socket, bool close, image_tag *request, __u8 *rgb_data)
=> (int socket, bool close, image_tag *request);
Write (int socket, bool close, image_tag *request)
=> (int socket, bool close, image_tag *request);
Complete (int socket, bool close, image_tag *request) => ();
// source node
source Listen => Image;
// abstract node
Image = ReadRequest -> CheckCache -> Handler -> Write -> Complete;
// predicate type & dispatch
typedef hit TestInCache;
Handler:[_, _, hit] = ;
Handler:[_, _, _] =
ReadInFromDisk -> Compress -> StoreInCache;
// error handler
handle error ReadInFromDisk => FourOhFor;
// atomicity constraints
atomic CheckCache:{cache};
atomic StoreInCache:{cache};
atomic Complete:{cache};

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,919 @@
ACCEPTABLE LEFT PRIMERS
1-based # self self hair- qual-
# sequence start ln N GC% Tm any_th end_th pin lity
0 tgctagctaggcgatgctag 411 20 0 55.00 60.028 23.16 23.16 38.59 0.028
1 actgatacgcgatgctagct 476 20 0 50.00 59.957 17.69 1.35 0.00 0.043
2 gatcgatgctagctaggcga 405 20 0 55.00 60.100 16.30 16.30 0.00 0.100
3 tcgatcgatgctagctaggc 403 20 0 55.00 60.100 18.63 8.45 0.00 0.100
4 tagctgatcgatcgtagcgg 565 20 0 55.00 60.101 25.02 17.36 0.00 0.101
5 gctgactgatcgatcgatgc 113 20 0 55.00 59.826 24.08 17.09 35.21 0.174
6 tatcatctctgcgcgatcga 361 20 0 50.00 59.747 22.07 1.72 38.48 0.253
7 agctaggcgatgctagctag 415 20 0 55.00 59.742 17.46 17.46 41.54 0.258
8 ctagctaggcgatgctagct 413 20 0 55.00 59.742 18.68 17.35 43.53 0.258
9 ggcgatctagctagctgact 583 20 0 55.00 59.671 17.44 7.44 37.58 0.329
10 tcgatgctagctaggcgatg 407 20 0 55.00 60.382 14.03 0.00 0.00 0.382
11 gctgatcgatcgatgctagc 398 20 0 55.00 59.618 25.97 24.79 35.21 0.382
12 gctagctgatcgatcgatgc 394 20 0 55.00 59.618 24.08 21.09 35.21 0.382
13 atcatctctgcgcgatcgat 362 20 0 50.00 60.382 22.07 5.02 38.48 0.382
14 gactgatacgcgatgctagc 475 20 0 55.00 59.551 8.61 8.61 0.00 0.449
15 atcgatgctagctaggcgat 406 20 0 50.00 59.452 18.43 18.43 0.00 0.548
16 gctagctgactgatacgcga 468 20 0 55.00 60.589 16.29 0.00 0.00 0.589
17 agctagctgactgatacgcg 467 20 0 55.00 60.590 17.99 3.89 0.00 0.590
18 atgctagctaggcgatgcta 410 20 0 50.00 59.375 10.59 8.91 0.00 0.625
19 ctatcatctctgcgcgatcg 360 20 0 55.00 59.347 12.19 12.19 39.07 0.653
20 gatgctagctaggcgatgct 409 20 0 55.00 60.668 7.01 7.53 0.00 0.668
21 gctactatcatctctgcgcg 356 20 0 55.00 59.273 0.00 0.00 0.00 0.727
22 cgtagcggcgatctagctag 577 20 0 60.00 60.791 15.64 15.64 37.58 0.791
23 cggcgatctagctagctgac 582 20 0 60.00 61.003 14.84 7.25 38.70 1.003
24 gctagctgatcgatcgtagc 563 20 0 55.00 58.995 23.70 23.70 0.00 1.005
25 gatcgatcgatgtgcggcta 81 20 0 55.00 61.006 19.16 0.00 41.65 1.006
26 atcgatcgatgtgcggctag 82 20 0 55.00 61.008 29.65 0.00 41.65 1.008
27 gctgactgatacgcgatgc 472 19 0 57.89 60.025 0.00 0.00 0.00 1.025
28 agctagctgatcatcgatgct 190 21 0 47.62 60.035 17.99 11.09 0.00 1.035
29 gctagctagctgactgatcga 105 21 0 52.38 60.037 34.38 0.00 46.11 1.037
30 tcatctctgcgcgatcgat 363 19 0 52.63 59.946 22.07 0.12 38.48 1.054
31 atcatctctgcgcgatcga 362 19 0 52.63 59.946 22.07 1.72 38.48 1.054
32 atcgatcgatgtgcggcta 82 19 0 52.63 59.945 29.65 0.00 41.65 1.055
33 gtagcggcgatctagctagc 578 20 0 60.00 61.071 16.97 7.15 39.86 1.071
34 gctagctgactgatcgatcg 109 20 0 55.00 58.924 16.84 13.89 0.00 1.076
35 gctgatcgatcgatgtgcg 78 19 0 57.89 60.097 29.87 18.15 42.69 1.097
36 tatcatctctgcgcgatcgat 361 21 0 47.62 60.172 22.07 11.47 38.48 1.172
37 gctagctagctgatcgatcga 390 21 0 52.38 60.172 34.38 22.52 46.11 1.172
38 gctagctagctgatcgatcga 70 21 0 52.38 60.172 34.38 22.52 46.11 1.172
39 catctctgcgcgatcgatg 364 19 0 57.89 59.810 13.74 13.74 38.48 1.190
40 tcgtagcggcgatctagcta 576 20 0 55.00 61.231 11.55 9.27 36.40 1.231
41 actgatacgcgatgctagcta 476 21 0 47.62 59.765 17.69 3.08 0.00 1.235
42 actgatcgatcgatgctagct 117 21 0 47.62 59.763 23.29 11.70 35.21 1.237
43 agctagctgatcgatcgatgt 73 21 0 47.62 59.763 17.99 2.62 35.21 1.237
44 tagcggcgatctagctagct 579 20 0 55.00 61.243 23.74 23.74 46.60 1.243
45 cgtagcggcgatctagcta 577 19 0 57.89 59.729 11.55 9.27 37.58 1.271
46 ctagctgatcgatcgtagcg 564 20 0 55.00 58.727 25.02 15.05 0.00 1.273
47 tagcggcgatctagctagc 579 19 0 57.89 59.725 16.97 9.14 39.86 1.275
48 catcgatcgatgcatgcatg 442 20 0 50.00 58.722 37.80 23.31 44.93 1.278
49 tcatctctgcgcgatcgatg 363 20 0 55.00 61.279 18.01 18.01 38.48 1.279
50 gctagctagctgatcgatcg 559 20 0 55.00 58.714 34.38 11.90 46.11 1.286
51 gctagctagctgatcgatcg 390 20 0 55.00 58.714 34.38 11.90 46.11 1.286
52 gctagctagctgatcgatcg 70 20 0 55.00 58.714 34.38 11.90 46.11 1.286
53 agcatcggattagctagctga 3 21 0 47.62 59.689 28.29 20.88 0.00 1.311
54 agctgatcgatcgtagcgg 566 19 0 57.89 60.315 25.02 17.36 0.00 1.315
55 cggcgatctagctagctga 582 19 0 57.89 59.650 21.57 16.66 38.70 1.350
56 ctagctgatcgatcgatgtgc 75 21 0 52.38 59.643 31.83 30.04 35.21 1.357
57 gctagctgatcgatcgatgtg 74 21 0 52.38 59.643 12.06 6.93 35.21 1.357
58 gctagctaggcgatgctagc 412 20 0 60.00 61.357 30.41 30.41 46.19 1.357
59 tagctagctgactgatacgcg 466 21 0 52.38 60.373 28.29 3.89 0.00 1.373
60 gctagctgactgatcgatcga 109 21 0 52.38 60.374 22.52 22.52 0.00 1.374
61 agctagctgactgatcgatcg 108 21 0 52.38 60.374 17.99 13.89 0.00 1.374
62 cgatcgatgctagctaggcg 404 20 0 60.00 61.409 15.59 9.14 0.00 1.409
63 gctagctagctgactgatcg 105 20 0 55.00 58.563 34.38 1.84 46.11 1.437
64 atgctagctaggcgatgct 410 19 0 52.63 59.561 10.59 7.53 0.00 1.439
65 agctagctgatcgatcgtagc 562 21 0 52.38 60.441 26.87 26.87 0.00 1.441
66 gctagctagctgatcgatcgt 559 21 0 52.38 60.441 34.38 2.65 46.11 1.441
67 tagctaggcgatgctagctag 414 21 0 52.38 59.559 18.42 17.46 42.44 1.441
68 ctagctaggcgatgctagcta 413 21 0 52.38 59.559 18.69 17.64 42.44 1.441
69 tagctgatcgatcgatgtgc 76 20 0 50.00 58.558 31.83 30.04 35.21 1.442
70 gatgctagctaggcgatgcta 409 21 0 52.38 60.444 9.82 8.91 0.00 1.444
71 atgctagctaggcgatgctag 410 21 0 52.38 60.444 23.16 23.16 38.59 1.444
72 gctagctgatcatcgatgct 191 20 0 50.00 58.539 16.29 12.14 0.00 1.461
73 agctagctgatcatcgatgc 190 20 0 50.00 58.539 21.42 9.22 0.00 1.461
74 gctgactgatacgcgatgct 472 20 0 55.00 61.494 2.33 0.00 0.00 1.494
75 agctgactgatacgcgatgc 471 20 0 55.00 61.494 3.47 0.00 0.00 1.494
76 ggcgatctagctagctgacta 583 21 0 52.38 59.491 17.44 5.40 37.58 1.509
77 gatcgatgctagctaggcgat 405 21 0 52.38 60.510 21.61 21.61 0.00 1.510
78 atcgatcgatgctagctaggc 402 21 0 52.38 60.510 29.65 8.45 33.56 1.510
79 ctgatcgatcgatgtgcgg 79 19 0 57.89 59.447 15.54 5.83 41.65 1.553
80 agctgatcgatcgatgtgcg 77 20 0 55.00 61.556 31.92 20.26 42.69 1.556
81 cgatcatcgatgctagctagc 548 21 0 52.38 59.444 34.89 34.89 46.99 1.556
82 tagctaggcgatgctagcta 414 20 0 50.00 58.433 19.37 17.81 42.44 1.567
83 agctagctactgatcgatgct 303 21 0 47.62 59.415 17.56 11.51 0.00 1.585
84 tcgatcgatgtgcggctag 83 19 0 57.89 60.606 18.63 0.00 41.65 1.606
85 gactgatcgatcgatgctagc 116 21 0 52.38 59.378 15.86 8.45 35.21 1.622
86 agctagctgactgatcgatca 260 21 0 47.62 59.347 26.99 26.99 35.44 1.653
87 ctgactgatacgcgatgctag 473 21 0 52.38 59.312 1.70 0.00 0.00 1.688
88 ctagctgactgatacgcgatg 469 21 0 52.38 59.312 0.00 0.00 0.00 1.688
89 gctactatcatctctgcgcga 356 21 0 52.38 60.707 2.71 2.71 0.00 1.707
90 agctactatcatctctgcgcg 355 21 0 52.38 60.709 0.00 0.00 0.00 1.709
91 actatcatctctgcgcgatc 359 20 0 50.00 58.270 4.99 0.00 0.00 1.730
92 actgatcgatcgatgctagc 117 20 0 50.00 58.270 23.29 13.61 35.21 1.730
93 gctagctgatcgatcgatgt 74 20 0 50.00 58.270 14.29 2.62 35.21 1.730
94 ctatcatctctgcgcgatcga 360 21 0 52.38 60.771 22.07 1.72 38.48 1.771
95 atcgatgctagctaggcgatg 406 21 0 52.38 60.779 21.16 4.37 0.00 1.779
96 tgactgatacgcgatgctag 474 20 0 50.00 58.207 1.70 0.00 0.00 1.793
97 ctgactgatacgcgatgcta 473 20 0 50.00 58.207 2.33 0.00 0.00 1.793
98 tagctgactgatacgcgatg 470 20 0 50.00 58.207 0.00 0.00 0.00 1.793
99 ctgactgatcgatcgatgct 114 20 0 50.00 58.197 26.44 12.40 35.21 1.803
100 agctgactgatcgatcgatg 112 20 0 50.00 58.197 23.05 13.21 35.21 1.803
101 tcggattagctagctgatgc 7 20 0 50.00 58.176 17.46 17.46 40.05 1.824
102 gcatcggattagctagctga 4 20 0 50.00 58.176 28.29 20.88 0.00 1.824
103 agcatcggattagctagctg 3 20 0 50.00 58.171 28.29 10.80 0.00 1.829
104 gatgctagctaggcgatgc 409 19 0 57.89 59.141 4.18 0.00 0.00 1.859
105 ctgatacgcgatgctagctag 477 21 0 52.38 59.113 17.46 17.46 0.00 1.887
106 gctagctgactgatacgcg 468 19 0 57.89 59.086 8.21 3.89 0.00 1.914
107 ctctgcgcgatcgatgctag 367 20 0 60.00 61.946 21.94 18.16 38.48 1.946
108 tctgcgcgatcgatgctag 368 19 0 57.89 60.966 21.94 18.16 38.48 1.966
109 ctctgcgcgatcgatgcta 367 19 0 57.89 60.966 26.61 17.10 38.48 1.966
110 cgatgctagctaggcgatgc 408 20 0 60.00 61.968 11.09 0.00 0.00 1.968
111 gactgatacgcgatgctagct 475 21 0 52.38 60.975 17.69 1.35 0.00 1.975
112 gctagctgactgatacgcgat 468 21 0 52.38 60.975 8.21 0.00 0.00 1.975
113 tgatacgcgatgctagctag 478 20 0 50.00 57.994 17.46 17.46 0.00 2.006
114 ctgatacgcgatgctagcta 477 20 0 50.00 57.994 17.69 3.08 0.00 2.006
115 cgcgatcgatgctagctagc 372 20 0 60.00 62.011 34.89 34.89 43.67 2.011
116 gcgcgatcgatgctagctag 371 20 0 60.00 62.011 21.66 17.46 38.48 2.011
117 ctgatcgatcgatgctagct 399 20 0 50.00 57.983 19.70 2.01 35.21 2.017
118 agctgatcgatcgatgctag 397 20 0 50.00 57.983 27.33 18.05 34.69 2.017
119 ctagctgatcgatcgatgct 395 20 0 50.00 57.983 33.87 33.38 38.16 2.017
120 agctagctgatcgatcgatg 393 20 0 50.00 57.983 21.99 11.03 35.21 2.017
121 ctgatcgatcgatgctagct 118 20 0 50.00 57.983 19.70 2.01 35.21 2.017
122 agctagctgatcgatcgatg 73 20 0 50.00 57.983 21.99 11.03 35.21 2.017
123 catcggattagctagctgatgc 5 22 0 50.00 59.982 24.41 24.41 40.05 2.018
124 gcatcggattagctagctgatg 4 22 0 50.00 59.982 27.81 27.81 33.28 2.018
125 tcgatgctagctaggcgat 407 19 0 52.63 58.964 14.03 3.01 0.00 2.036
126 atcgatgctagctaggcga 406 19 0 52.63 58.964 16.30 16.30 0.00 2.036
127 actatcatctctgcgcgatcg 359 21 0 52.38 61.037 12.19 12.19 39.07 2.037
128 gcgcgatcgatgctagcta 371 19 0 57.89 61.037 21.66 3.08 38.48 2.037
129 gctgatcgatcgatgctagct 398 21 0 52.38 61.044 27.88 12.70 35.21 2.044
130 agctgatcgatcgatgctagc 397 21 0 52.38 61.044 27.33 27.90 34.69 2.044
131 gctagctgatcgatcgatgct 394 21 0 52.38 61.044 33.87 33.38 38.16 2.044
132 agctagctgatcgatcgatgc 393 21 0 52.38 61.044 24.08 21.09 35.21 2.044
133 cgcgatcgatgctagctag 372 19 0 57.89 58.947 22.07 17.46 38.48 2.053
134 tcgtagcggcgatctagc 576 18 0 61.11 59.936 4.70 0.00 36.40 2.064
135 cgtagcggcgatctagct 577 18 0 61.11 59.935 11.03 11.03 37.58 2.065
136 gcggcgatctagctagct 581 18 0 61.11 59.933 23.74 23.74 38.05 2.067
137 agcggcgatctagctagc 580 18 0 61.11 59.933 16.97 7.15 39.86 2.067
138 ctagctgactgatacgcgat 469 20 0 50.00 57.918 1.43 0.00 0.00 2.082
139 ctagctgatcgatcgtagcgg 564 21 0 57.14 61.096 20.31 16.15 0.00 2.096
140 agctactatcatctctgcgc 355 20 0 50.00 57.898 0.00 0.00 0.00 2.102
141 gctagctactgatcgatgct 304 20 0 50.00 57.898 11.51 11.51 0.00 2.102
142 agctagctactgatcgatgc 303 20 0 50.00 57.898 17.56 1.76 0.00 2.102
143 agcatcggattagctagctgat 3 22 0 45.45 60.108 17.84 15.13 0.00 2.108
144 tgctagctaggcgatgcta 411 19 0 52.63 58.881 17.69 8.91 0.00 2.119
145 aagcatcggattagctagctg 2 21 0 47.62 58.879 28.29 10.80 0.00 2.121
146 tctgcgcgatcgatgcta 368 18 0 55.56 59.857 26.61 16.13 38.48 2.143
147 cgatgctagctaggcgatg 408 19 0 57.89 58.856 11.09 0.00 0.00 2.144
148 agctagctgatcatcgatgcta 190 22 0 45.45 59.845 17.99 13.09 0.00 2.155
149 tagctagctgatcatcgatgct 189 22 0 45.45 59.845 16.29 15.30 0.00 2.155
150 atcgatcgatgtgcggct 82 18 0 55.56 60.166 29.65 4.36 41.65 2.166
151 gctagctgactgatcgatca 261 20 0 50.00 57.829 26.99 26.99 35.44 2.171
152 tagctagctgactgatcgatcg 107 22 0 50.00 60.174 28.29 13.89 0.00 2.174
153 agctgatcatcatcgatgct 515 20 0 45.00 57.788 11.25 0.72 40.32 2.212
154 agctagctgactgatcgatcat 260 22 0 45.45 59.778 26.67 18.02 36.62 2.222
155 tgactgatacgcgatgctagc 474 21 0 52.38 61.238 8.61 8.61 0.00 2.238
156 gctgactgatacgcgatgcta 472 21 0 52.38 61.238 2.33 0.00 0.00 2.238
157 tagctgactgatacgcgatgc 470 21 0 52.38 61.238 3.47 0.00 0.00 2.238
158 tagctagctgatcgatcgtagc 561 22 0 50.00 60.238 26.87 26.87 0.00 2.238
159 gctagctagctgatcgatcgta 559 22 0 50.00 60.238 34.38 3.07 46.11 2.238
160 tgatcgatcgatgctagctagg 400 22 0 50.00 60.239 26.44 6.29 35.21 2.239
161 gctgactgatcgatcgatgct 113 21 0 52.38 61.244 26.44 12.40 35.21 2.244
162 agctgactgatcgatcgatgc 112 21 0 52.38 61.244 24.08 19.43 35.21 2.244
163 gatcgatcgatgtgcggct 81 19 0 57.89 61.263 19.16 0.00 41.65 2.263
164 gctgatcatcgatgctactagc 195 22 0 50.00 59.727 18.08 16.44 45.61 2.273
165 gctagctgatcatcgatgctac 191 22 0 50.00 59.727 9.57 5.47 0.00 2.273
166 gatcgatcgatgtgcggc 81 18 0 61.11 59.714 18.10 0.95 41.65 2.286
167 ctagctagctgactgatacgc 465 21 0 52.38 58.703 14.90 0.00 0.00 2.297
168 tagctgatcgatcgatgtgcg 76 21 0 52.38 61.299 31.92 20.26 42.69 2.299
169 agctgatcgatcgatgtgc 77 19 0 52.63 58.698 31.83 30.04 35.21 2.302
170 gctgatcatcatcgatgctagc 516 22 0 50.00 60.302 10.80 10.34 40.32 2.302
171 gctagctgatcatcatcgatgc 512 22 0 50.00 60.302 21.42 7.40 40.32 2.302
172 aagcatcggattagctagctga 2 22 0 45.45 60.306 28.29 20.88 0.00 2.306
173 gatcgatcgtagcggcga 570 18 0 61.11 60.318 13.01 8.51 45.59 2.318
174 atcggattagctagctgatgc 6 21 0 47.62 58.673 17.46 17.46 40.05 2.327
175 gcatcggattagctagctgat 4 21 0 47.62 58.673 17.84 15.13 0.00 2.327
176 gcggcgatctagctagctg 581 19 0 63.16 61.329 17.07 8.17 38.05 2.329
177 tgctagtgatgcatgctagt 24 20 0 45.00 57.636 24.96 11.17 35.89 2.364
178 ctactatcatctctgcgcga 357 20 0 50.00 57.636 2.71 2.71 0.00 2.364
179 actagctagctgactgatacgc 464 22 0 50.00 60.368 21.52 0.00 0.00 2.368
180 gctagctagctgatcatcga 187 20 0 50.00 57.613 34.38 0.24 46.11 2.387
181 tctctgcgcgatcgatgcta 366 20 0 55.00 62.413 26.61 17.10 38.48 2.413
182 tgatcgatcgatgctagctagt 119 22 0 45.45 59.586 26.44 5.69 35.21 2.414
183 actgatcgatcgatgctagcta 117 22 0 45.45 59.586 23.29 7.65 35.21 2.414
184 tagctagctgatcgatcgatgt 72 22 0 45.45 59.586 14.29 2.62 35.21 2.414
185 agctaggcgatgctagcta 415 19 0 52.63 58.572 17.69 3.08 41.54 2.428
186 tagctaggcgatgctagct 414 19 0 52.63 58.572 17.35 17.35 43.53 2.428
187 gatcgatcgatgctagctagg 401 21 0 52.38 58.567 23.89 6.29 35.21 2.433
188 gctagctagctgactgatcgat 105 22 0 50.00 60.434 34.38 0.00 46.11 2.434
189 gatcgatgctagctaggcg 405 19 0 57.89 58.563 15.59 9.02 0.00 2.437
190 cgatcgatgctagctaggc 404 19 0 57.89 58.563 14.87 8.45 0.00 2.437
191 tagctagctgactgatacgc 466 20 0 50.00 57.549 28.29 0.00 0.00 2.451
192 agctagctgactgatcgatc 260 20 0 50.00 57.536 19.32 19.32 0.00 2.464
193 agctagctgactgatcgatc 108 20 0 50.00 57.536 19.32 19.32 0.00 2.464
194 aaagcatcggattagctagctg 1 22 0 45.45 59.524 28.29 10.80 0.00 2.476
195 gctgactgatcgatcatcatgc 265 22 0 50.00 60.493 25.66 25.12 41.77 2.493
196 tagctactatcatctctgcgcg 354 22 0 50.00 60.495 0.00 0.00 0.00 2.495
197 ctgatcgatcgatgtgcggc 79 20 0 60.00 62.497 15.54 4.15 41.65 2.497
198 gctgatcgatcgatgtgcgg 78 20 0 60.00 62.497 29.87 22.23 41.65 2.497
199 tcgtagcggcgatctagct 576 19 0 57.89 61.503 11.03 11.03 36.40 2.503
200 agcggcgatctagctagct 580 19 0 57.89 61.519 23.74 23.74 42.96 2.519
201 ctagctagctgatcatcgatgc 188 22 0 50.00 59.470 21.42 9.22 0.00 2.530
202 gctagctagctgatcatcgatg 187 22 0 50.00 59.470 34.38 20.23 46.11 2.530
203 tcatctctgcgcgatcga 363 18 0 55.56 59.468 22.07 0.00 38.48 2.532
204 tcgatcgatgtgcggcta 83 18 0 55.56 59.465 18.63 0.00 41.65 2.535
205 tgatcgatcgatgtgcggc 80 19 0 57.89 61.549 21.27 8.44 41.65 2.549
206 ctagctaggcgatgctagctag 413 22 0 54.55 60.561 22.99 22.99 46.84 2.561
207 gctagctagctgatcgatcgat 390 22 0 50.00 60.561 34.38 30.53 46.11 2.561
208 gctagctagctgatcgatcgat 70 22 0 50.00 60.561 34.38 30.53 46.11 2.561
209 ctgcgcgatcgatgctag 369 18 0 61.11 59.415 19.79 13.97 38.48 2.585
210 aagcatcggattagctagct 2 20 0 45.00 57.413 23.74 23.74 0.00 2.587
211 gctagctgatcatcgatgcta 191 21 0 47.62 58.410 16.61 13.09 0.00 2.590
212 tagctagctgatcatcgatgc 189 21 0 47.62 58.410 21.42 9.22 0.00 2.590
213 actgatacgcgatgctagc 476 19 0 52.63 58.407 8.61 8.61 0.00 2.593
214 gctagctgactgatcgatcatc 261 22 0 50.00 59.406 23.93 21.92 36.62 2.594
215 atcgatcgatgctagctagg 402 20 0 50.00 57.396 29.65 6.29 33.56 2.604
216 atctctgcgcgatcgatgc 365 19 0 57.89 61.618 22.01 22.01 38.48 2.618
217 tgatcgatcgtagcggcg 569 18 0 61.11 60.621 20.58 0.86 0.00 2.621
218 atcatctctgcgcgatcgatg 362 21 0 52.38 61.633 18.01 18.01 38.48 2.633
219 agctagctgatcgatcgtag 562 20 0 50.00 57.344 17.99 16.86 0.00 2.656
220 ctagctagctgatcgatcgt 560 20 0 50.00 57.344 16.40 2.65 0.00 2.656
221 gctagctgactgatcgatcat 261 21 0 47.62 58.339 26.67 18.02 36.62 2.661
222 ctgatcgatcgtagcggcg 568 19 0 63.16 61.664 14.21 0.86 0.00 2.664
223 ctgactgatacgcgatgct 473 19 0 52.63 58.330 2.33 0.00 0.00 2.670
224 agctgactgatacgcgatg 471 19 0 52.63 58.330 0.00 0.00 0.00 2.670
225 gctagctgatcgatcgtagcg 563 21 0 57.14 61.676 24.18 16.49 0.00 2.676
226 ctagctgactgatcgatcga 110 20 0 50.00 57.276 22.52 22.52 0.00 2.724
227 agctagctactgatcgatgcta 303 22 0 45.45 59.252 17.56 12.23 0.00 2.748
228 tagctagctactgatcgatgct 302 22 0 45.45 59.252 27.80 11.51 0.00 2.748
229 gactgatacgcgatgctagcta 475 22 0 50.00 60.751 17.69 3.08 0.00 2.751
230 actgatacgcgatgctagctag 476 22 0 50.00 60.752 17.46 17.46 0.00 2.752
231 gactgatcgatcgatgctagct 116 22 0 50.00 60.753 18.04 9.56 35.21 2.753
232 gctagctgactgatcgatcgat 109 22 0 50.00 60.753 30.53 30.53 37.90 2.753
233 tgcgcgatcgatgctagcta 370 20 0 55.00 62.756 26.61 9.85 38.48 2.756
234 gcggcgatctagctagctga 581 20 0 60.00 62.765 21.57 16.66 38.70 2.765
235 agcggcgatctagctagctg 580 20 0 60.00 62.771 17.07 8.17 44.87 2.771
236 ctactatcatctctgcgcgatc 357 22 0 50.00 59.220 4.99 0.00 0.00 2.780
237 tatcatctctgcgcgatcg 361 19 0 52.63 58.199 12.19 12.19 39.07 2.801
238 tactatcatctctgcgcgatcg 358 22 0 50.00 60.811 12.19 12.19 39.07 2.811
239 tagctagctgactgatcgatca 259 22 0 45.45 59.187 28.29 26.99 35.44 2.813
240 gctgatcgatcgatgctagcta 398 22 0 50.00 60.816 27.88 12.57 35.21 2.816
241 tagctgatcgatcgatgctagc 396 22 0 50.00 60.816 30.84 27.90 36.80 2.816
242 gctagctgatcgatcgatgcta 394 22 0 50.00 60.816 34.11 32.56 36.80 2.816
243 tagctagctgatcgatcgatgc 392 22 0 50.00 60.816 24.08 21.09 35.21 2.816
244 gctaggcgatgctagctag 416 19 0 57.89 58.179 17.46 17.46 35.42 2.821
245 ctagctaggcgatgctagc 413 19 0 57.89 58.179 18.68 9.44 36.95 2.821
246 gctagctaggcgatgctag 412 19 0 57.89 58.179 23.16 23.16 38.59 2.821
247 catctctgcgcgatcgatgc 364 20 0 60.00 62.823 22.01 22.01 38.48 2.823
248 aaagcatcggattagctagct 1 21 0 42.86 58.168 23.74 23.74 0.00 2.832
249 ctgactgatcgatcgatgctag 114 22 0 50.00 59.155 22.81 19.44 35.21 2.845
250 ctagctgactgatcgatcgatg 110 22 0 50.00 59.155 23.05 13.21 35.21 2.845
251 tactatcatctctgcgcgatc 358 21 0 47.62 58.155 4.99 0.00 0.00 2.845
252 gctagctactgatcgatgctac 304 22 0 50.00 59.151 8.57 4.26 0.00 2.849
253 ctactatcatctctgcgcgat 357 21 0 47.62 58.150 4.99 2.52 0.00 2.850
254 agctgatcatcgatgctact 194 20 0 45.00 57.134 17.14 8.95 0.00 2.866
255 gctagctagctgatcatcgat 187 21 0 47.62 58.132 34.38 0.00 46.11 2.868
256 ctgatacgcgatgctagct 477 19 0 52.63 58.107 17.69 1.35 0.00 2.893
257 ggcgatctagctagctgac 583 19 0 57.89 58.106 14.84 7.25 37.58 2.894
258 tgactgatcgatcgatgctag 115 21 0 47.62 58.084 22.81 19.44 35.21 2.916
259 ctgactgatcgatcgatgcta 114 21 0 47.62 58.084 26.44 14.64 35.21 2.916
260 tagctgactgatcgatcgatg 111 21 0 47.62 58.084 23.05 13.21 35.21 2.916
261 actgatcgatcatcatgctagc 269 22 0 45.45 59.071 26.67 8.61 41.77 2.929
262 agctgactgatcgatcatca 264 20 0 45.00 57.064 26.49 26.49 39.98 2.936
263 ctagctagctgatcgatcga 391 20 0 50.00 57.060 22.52 22.52 0.00 2.940
264 ctagctagctgatcgatcga 71 20 0 50.00 57.060 22.52 22.52 0.00 2.940
265 gatcgatcgatgtgcggctag 81 21 0 57.14 61.947 19.16 0.00 41.65 2.947
266 tgctagctaggcgatgct 411 18 0 55.56 59.050 17.69 7.53 0.00 2.950
267 gctgatcgatcgtagcggc 567 19 0 63.16 61.960 20.49 19.38 0.00 2.960
268 cgatcgatgtgcggctag 84 18 0 61.11 59.032 10.82 0.00 41.65 2.968
269 tgatcgatcgatgtgcggct 80 20 0 55.00 62.987 22.21 0.00 41.65 2.987
270 ctgactgatcgatcatcatgct 266 22 0 45.45 59.004 20.99 6.82 41.77 2.996
271 agctgactgatcgatcatcatg 264 22 0 45.45 59.004 22.70 19.51 41.77 2.996
272 agctagctgactgatacgcga 467 21 0 52.38 62.000 17.99 0.00 0.00 3.000
273 tgactgatcgatcgatgctagc 115 22 0 50.00 61.008 18.17 12.52 35.21 3.008
274 gctgactgatcgatcgatgcta 113 22 0 50.00 61.008 26.44 14.64 35.21 3.008
275 tagctgactgatcgatcgatgc 111 22 0 50.00 61.008 24.08 19.43 35.21 3.008
276 agctagctgatcgatcgatgtg 73 22 0 50.00 61.010 17.99 6.93 35.21 3.010
277 ctgatcgatcgatgctagctag 399 22 0 50.00 58.963 19.70 17.46 35.21 3.037
278 ctagctgatcgatcgatgctag 395 22 0 50.00 58.963 37.86 37.86 43.17 3.037
279 ctagctagctgatcgatcgatg 391 22 0 50.00 58.963 21.99 11.03 35.21 3.037
280 ctgatcgatcgatgctagctag 118 22 0 50.00 58.963 19.70 17.46 35.21 3.037
281 ctagctagctgatcgatcgatg 71 22 0 50.00 58.963 21.99 11.03 35.21 3.037
282 gactgatcgatcatcatgctagc 268 23 0 47.83 60.053 24.51 9.03 41.77 3.053
283 gctagtgatgcatgctagtagtg 25 23 0 47.83 59.929 24.96 10.54 0.00 3.071
284 gctactatcatctctgcgcgat 356 22 0 50.00 61.073 4.99 2.52 0.00 3.073
285 gtagcggcgatctagctag 578 19 0 57.89 57.903 15.64 15.64 37.58 3.097
286 tgactgatcgatcatcatgct 267 21 0 42.86 57.900 26.79 12.28 41.77 3.100
287 ctagctactatcatctctgcgc 353 22 0 50.00 58.892 0.00 0.00 0.00 3.108
288 gctagctactatcatctctgcg 352 22 0 50.00 58.892 8.21 0.00 0.00 3.108
289 ctagctagctactgatcgatgc 301 22 0 50.00 58.892 14.00 1.76 0.00 3.108
290 gctagctagctactgatcgatg 300 22 0 50.00 58.892 34.38 7.78 46.11 3.108
291 catcgatcgatgctagtatgct 325 22 0 45.45 58.885 37.80 10.02 44.93 3.115
292 tgatcgatcgatgctagctag 400 21 0 47.62 57.879 26.44 17.46 35.21 3.121
293 ctgatcgatcgatgctagcta 399 21 0 47.62 57.879 19.70 3.77 35.21 3.121
294 tagctgatcgatcgatgctag 396 21 0 47.62 57.879 34.03 27.12 36.80 3.121
295 ctagctgatcgatcgatgcta 395 21 0 47.62 57.879 34.11 32.56 36.80 3.121
296 tagctagctgatcgatcgatg 392 21 0 47.62 57.879 21.99 11.03 35.21 3.121
297 tgatcgatcgatgctagctag 119 21 0 47.62 57.879 26.44 17.46 35.21 3.121
298 ctgatcgatcgatgctagcta 118 21 0 47.62 57.879 19.70 3.77 35.21 3.121
299 tagctagctgatcgatcgatg 72 21 0 47.62 57.879 21.99 11.03 35.21 3.121
300 gatcgatcgatgctagctagt 120 21 0 47.62 57.878 23.89 3.56 35.21 3.122
301 ctatcatctctgcgcgatcgat 360 22 0 50.00 61.132 22.07 11.47 38.48 3.132
302 tgatcgatcgtagcggcga 569 19 0 57.89 62.144 20.58 8.51 45.59 3.144
303 tcgtagcggcgatctagctag 576 21 0 57.14 62.173 15.64 15.64 36.40 3.173
304 tactagctagctgactgatacgc 463 23 0 47.83 60.176 13.17 0.00 0.00 3.176
305 ctgatcatcatcgatgctagct 517 22 0 45.45 58.807 17.69 1.76 40.32 3.193
306 agctgatcatcatcgatgctag 515 22 0 45.45 58.807 5.93 2.76 40.32 3.193
307 ctagctgatcatcatcgatgct 513 22 0 45.45 58.807 14.14 8.34 40.32 3.193
308 agctagctgatcatcatcgatg 511 22 0 45.45 58.807 20.23 20.23 41.48 3.193
309 ctgatcgatcatcatgctagct 270 22 0 45.45 58.807 26.67 0.00 41.77 3.193
310 ctagctgactgatcgatcgat 110 21 0 47.62 57.806 30.53 30.53 37.90 3.194
311 ttagctagctgactgatcgatca 258 23 0 43.48 59.798 28.29 26.99 35.44 3.202
312 tagctactatcatctctgcgc 354 21 0 47.62 57.798 0.00 0.00 0.00 3.202
313 gctagctactgatcgatgcta 304 21 0 47.62 57.798 12.99 12.23 0.00 3.202
314 tagctagctactgatcgatgc 302 21 0 47.62 57.798 27.80 1.76 0.00 3.202
315 tctctgcgcgatcgatgc 366 18 0 61.11 61.229 22.01 22.01 38.48 3.229
316 ctctgcgcgatcgatgct 367 18 0 61.11 61.232 26.61 0.00 38.48 3.232
317 agctagctactatcatctctgcg 351 23 0 47.83 60.238 17.56 0.00 0.00 3.238
318 ctagctagctactgatcgatgct 301 23 0 47.83 60.238 14.00 11.51 0.00 3.238
319 ctgatcgatcgtagcggc 568 18 0 61.11 58.727 14.21 0.00 0.00 3.273
320 gctgatcgatcgtagcgg 567 18 0 61.11 58.727 20.49 15.03 0.00 3.273
321 agctaggcgatgctagct 415 18 0 55.56 58.725 17.69 13.00 39.84 3.275
322 tgctagtgatgcatgctagtagt 24 23 0 43.48 60.302 24.96 12.98 35.89 3.302
323 gcgcgatcgatgctagct 371 18 0 61.11 61.306 21.66 1.35 38.48 3.306
324 tgatcatcatcgatgctagct 518 21 0 42.86 57.691 17.69 1.76 40.32 3.309
325 agctgatcatcatcgatgcta 515 21 0 42.86 57.691 0.24 0.00 40.32 3.309
326 tagctgatcatcatcgatgct 514 21 0 42.86 57.691 14.14 8.34 40.32 3.309
327 tgatcgatcatcatgctagct 271 21 0 42.86 57.691 27.48 0.00 37.38 3.309
328 ctagctagctgactgatacgcg 465 22 0 54.55 61.313 14.90 3.89 0.00 3.313
329 tgctagtgatgcatgctagtag 24 22 0 45.45 58.673 24.96 19.76 35.89 3.327
330 gctagtgatgcatgctagtagt 25 22 0 45.45 58.672 24.96 12.98 0.00 3.328
331 tagctagctgatcatcgatgcta 189 23 0 43.48 59.671 17.82 15.89 0.00 3.329
332 agctagctgactgatacgc 467 19 0 52.63 57.642 17.99 0.00 0.00 3.358
333 tatcatctctgcgcgatcgatg 361 22 0 50.00 61.383 18.01 18.01 38.48 3.383
334 agctgactgatcgatcatcat 264 21 0 42.86 57.616 26.31 18.90 41.77 3.384
335 actagctagctgatcatcatcga 508 23 0 43.48 59.607 22.43 0.00 0.00 3.393
336 tagctagctgactgatcgatcat 259 23 0 43.48 59.607 28.29 18.02 36.62 3.393
337 gatgctagctaggcgatgctag 409 22 0 54.55 61.393 23.16 23.16 38.59 3.393
338 cggcgatctagctagctgact 582 21 0 57.14 62.394 17.44 7.44 38.70 3.394
339 ctagctagctgatcgatcgat 391 21 0 47.62 57.600 30.53 30.53 37.90 3.400
340 ctagctagctgatcgatcgat 71 21 0 47.62 57.600 30.53 30.53 37.90 3.400
341 actgatcgatcatcatgctagct 269 23 0 43.48 60.428 26.67 4.70 41.77 3.428
342 ctagctagctgactgatcgatc 106 22 0 50.00 58.567 19.32 19.32 0.00 3.433
343 ctgactgatcgatcatcatgc 266 21 0 47.62 57.562 20.99 12.19 41.77 3.438
344 gctgactgatcgatcatcatg 265 21 0 47.62 57.562 22.70 19.51 41.77 3.438
345 gatcgatcgatgctagctaggc 401 22 0 54.55 61.448 23.89 8.45 35.21 3.448
346 gtgatgcatgctagtagtgatgt 29 23 0 43.48 59.551 11.60 0.00 0.00 3.449
347 tgctagtgatgcatgctagta 24 21 0 42.86 57.546 24.96 21.25 35.89 3.454
348 tagcggcgatctagctagctg 579 21 0 57.14 62.457 18.98 9.30 45.57 3.457
349 gtagcggcgatctagctagct 578 21 0 57.14 62.458 23.74 23.74 46.60 3.458
350 tagctgatcgatcgtagcg 565 19 0 52.63 57.539 25.02 11.96 0.00 3.461
351 gctagctagctactgatcgat 300 21 0 47.62 57.517 34.38 0.00 46.11 3.483
352 agctagctactgatcgatgctac 303 23 0 47.83 60.487 17.56 7.81 0.00 3.487
353 atcgatcgatgctagtatgct 326 21 0 42.86 57.502 29.65 2.17 33.56 3.498
354 agctactgatcgatgctacatc 307 22 0 45.45 58.484 7.41 0.00 37.97 3.516
355 agtgatgcatgctagtagtga 28 21 0 42.86 57.471 0.00 0.00 0.00 3.529
356 gactgatcgatcgatgctagcta 116 23 0 47.83 60.546 18.04 4.19 35.21 3.546
357 ctgatcgatcgatgctagctagt 118 23 0 47.83 60.547 22.18 3.56 35.21 3.547
358 actgatcgatcgatgctagctag 117 23 0 47.83 60.547 23.29 17.46 35.21 3.547
359 ctagctagctgatcgatcgatgt 71 23 0 47.83 60.547 14.29 2.62 35.21 3.547
360 catcgatcgatgctagtatgc 325 21 0 47.62 57.452 37.80 0.00 44.93 3.548
361 tagctagctgactgatcgatc 259 21 0 47.62 57.451 28.29 19.32 0.00 3.549
362 tagctagctgactgatcgatc 107 21 0 47.62 57.451 28.29 19.32 0.00 3.549
363 ctagctagctgactgatcgat 106 21 0 47.62 57.445 14.90 0.00 0.00 3.555
364 tcgatgctagctaggcga 407 18 0 55.56 58.427 15.59 13.52 0.00 3.573
365 tgatcgatcgatgctagctagta 119 23 0 43.48 59.424 26.44 18.77 35.21 3.576
366 ctgcgcgatcgatgctagc 369 19 0 63.16 62.586 20.26 12.12 38.48 3.586
367 agctagctgatcatcatcgat 511 21 0 42.86 57.405 17.99 0.00 0.00 3.595
368 tgcgcgatcgatgctagc 370 18 0 61.11 61.605 26.61 17.77 38.48 3.605
369 ctagctagctgatcgatcgtag 560 22 0 50.00 58.387 16.86 16.86 0.00 3.613
370 actagctagctgactgatacg 464 21 0 47.62 57.384 21.52 2.77 0.00 3.616
371 ctagctgactgatacgcga 469 19 0 52.63 57.370 16.29 0.00 0.00 3.630
372 gctactagctagctgactgat 461 21 0 47.62 57.360 15.96 3.00 44.92 3.640
373 ctgatcatcatcgatgctagc 517 21 0 47.62 57.358 8.61 8.61 40.32 3.642
374 gctgatcatcatcgatgctag 516 21 0 47.62 57.358 5.93 2.76 40.32 3.642
375 ctagctgatcatcatcgatgc 513 21 0 47.62 57.358 21.42 7.40 40.32 3.642
376 gctagctgatcatcatcgatg 512 21 0 47.62 57.358 20.23 20.23 41.48 3.642
377 ctgatcgatcatcatgctagc 270 21 0 47.62 57.358 26.67 8.61 41.77 3.642
378 agctactgatcgatgctacat 307 21 0 42.86 57.344 7.41 0.00 0.00 3.656
379 tgatcgatcgatgtgcggcta 80 21 0 52.38 62.663 22.21 0.24 41.65 3.663
380 atctctgcgcgatcgatg 365 18 0 55.56 58.327 12.03 4.19 38.48 3.673
381 catctctgcgcgatcgat 364 18 0 55.56 58.327 22.07 1.26 38.48 3.673
382 atcatctctgcgcgatcg 362 18 0 55.56 58.327 12.19 12.19 39.07 3.673
383 aagcatcggattagctagctgat 2 23 0 43.48 60.682 17.84 15.13 0.00 3.682
384 agtgatgcatgctagtagtgatg 28 23 0 43.48 59.299 7.49 7.49 0.00 3.701
385 gatcgatgctagctaggcgatg 405 22 0 54.55 61.702 24.26 6.24 0.00 3.702
386 atctctgcgcgatcgatgcta 365 21 0 52.38 62.723 26.61 17.10 38.48 3.723
387 tagctagctgactgatacgcga 466 22 0 50.00 61.730 28.29 0.00 0.00 3.730
388 tagctagctgatcgatcgtag 561 21 0 47.62 57.269 16.86 16.86 0.00 3.731
389 ctagctagctgatcgatcgta 560 21 0 47.62 57.269 11.68 3.07 0.00 3.731
390 tcgatcgatgctagctagtag 122 21 0 47.62 57.269 18.63 2.63 0.00 3.731
391 gctagctactgatcgatgctaca 304 23 0 47.83 60.734 11.21 0.06 0.00 3.734
392 agctagctgactgatcgatcatc 260 23 0 47.83 60.736 23.93 21.92 36.62 3.736
393 agctagctgactgatcgatcga 108 22 0 50.00 61.737 22.52 22.52 0.00 3.737
394 tctctgcgcgatcgatgct 366 19 0 57.89 62.740 26.61 0.00 38.48 3.740
395 tgatgcatgctagtagtgatgt 30 22 0 40.91 58.256 11.60 0.00 0.00 3.744
396 tgatcgatcgatgtgcgg 80 18 0 55.56 58.244 21.27 0.00 41.65 3.756
397 cgatcgatgctagctaggcga 404 21 0 57.14 62.770 16.30 16.30 0.00 3.770
398 tcgatcgatgctagctaggcg 403 21 0 57.14 62.770 18.63 11.67 0.00 3.770
399 atcgatcgatgcatgcatg 443 19 0 47.37 57.226 29.65 23.31 37.30 3.774
400 catcgatcgatgcatgcat 442 19 0 47.37 57.226 37.80 33.45 44.93 3.774
401 actagctagctgatcatcatcg 508 22 0 45.45 58.219 22.43 3.40 0.00 3.781
402 ctgatcatcgatgctactagct 196 22 0 45.45 58.219 10.86 0.00 45.92 3.781
403 agctgatcatcgatgctactag 194 22 0 45.45 58.219 13.67 9.68 0.00 3.781
404 ctagctgatcatcgatgctact 192 22 0 45.45 58.219 14.85 7.80 0.00 3.781
405 tttagctagctgactgatcga 257 21 0 42.86 57.216 0.38 0.00 0.00 3.784
406 tagctagctgatcgatcgatgtg 72 23 0 47.83 60.793 10.14 4.94 35.21 3.793
407 gctagctagctgatcatcatct 146 22 0 45.45 58.203 34.38 0.00 46.11 3.797
408 ctagctagctgatcatcgatgct 188 23 0 47.83 60.799 16.29 15.30 0.00 3.799
409 agctagctactatcatcgatcga 429 23 0 43.48 59.170 22.52 22.52 0.00 3.830
410 ttagctagctgactgatcgatc 258 22 0 45.45 58.159 28.29 19.32 0.00 3.841
411 ctagctgactgatcgatcatca 262 22 0 45.45 58.155 26.49 26.49 39.98 3.845
412 aaagcatcggattagctagctga 1 23 0 43.48 60.870 28.29 20.88 0.00 3.870
413 agctgactgatacgcgatgct 471 21 0 52.38 62.876 7.57 2.13 0.00 3.876
414 tagctagctactgatcgatgcta 302 23 0 43.48 59.102 27.80 12.23 0.00 3.898
415 tcatcatcgatgctagctagt 521 21 0 42.86 57.067 22.18 3.56 40.32 3.933
416 tcgatcatcatgctagctact 274 21 0 42.86 57.067 0.00 0.00 0.00 3.933
417 tgatcatcgatgctactagct 197 21 0 42.86 57.067 17.14 0.00 45.92 3.933
418 agctgatcatcgatgctacta 194 21 0 42.86 57.067 17.14 4.89 0.00 3.933
419 tagctgatcatcgatgctact 193 21 0 42.86 57.067 14.85 7.80 0.00 3.933
420 tcgatcgatgctagtatgctag 327 22 0 45.45 58.044 18.63 13.77 46.09 3.956
421 gcgatctagctagctgact 584 19 0 52.63 57.034 17.44 7.44 0.00 3.966
422 gctactgatcgatgctacatc 308 21 0 47.62 57.028 2.44 0.00 37.97 3.972
423 cggcgatctagctagctg 582 18 0 61.11 58.018 17.07 8.17 37.58 3.982
424 gctagctgactgatcgatcatca 261 23 0 47.83 60.983 26.49 26.49 39.98 3.983
425 actatcatctctgcgcgat 359 19 0 47.37 57.015 4.99 2.52 0.00 3.985
426 catcggattagctagctgatg 5 21 0 47.62 57.003 23.69 23.29 0.00 3.997
427 tagctgactgatcgatcatca 263 21 0 42.86 57.000 26.49 26.49 39.98 4.000
428 actagctagctgatcatcatcgat 508 24 0 41.67 59.995 22.43 0.00 0.00 4.005
429 agtgatgcatgctagtagtgat 28 22 0 40.91 57.984 0.00 0.00 0.00 4.016
430 ctagctagctgatcatcatcga 509 22 0 45.45 57.958 11.68 0.00 0.00 4.042
431 gctgatcatcgatgctactagct 195 23 0 47.83 61.046 20.91 5.24 45.92 4.046
432 agctgatcatcgatgctactagc 194 23 0 47.83 61.046 20.78 20.78 45.61 4.046
433 gctagctgatcatcgatgctact 191 23 0 47.83 61.046 12.59 8.92 0.00 4.046
434 agctagctgatcatcgatgctac 190 23 0 47.83 61.046 17.99 7.99 0.00 4.046
435 tagctagctactatcatctctgcg 350 24 0 45.83 60.058 27.80 0.00 0.00 4.058
436 ctagctagctactgatcgatgcta 301 24 0 45.83 60.058 14.00 12.23 0.00 4.058
437 agctactatcatctctgcgcga 355 22 0 50.00 62.058 2.71 2.71 0.00 4.058
438 gctatttagctagctgactgatcg 253 24 0 45.83 60.060 7.27 0.00 46.11 4.060
439 tgatcgatcatcatgctagctac 271 23 0 43.48 58.931 27.48 0.00 37.38 4.069
440 gtgatgcatgctagtagtgatg 29 22 0 45.45 57.921 7.49 7.49 0.00 4.079
441 ctagctagctgactgatcgatcg 106 23 0 52.17 61.091 16.84 13.89 0.00 4.091
442 ctagctactgatcgatgctaca 305 22 0 45.45 57.898 13.79 1.61 0.00 4.102
443 cggcgatctagctagctgacta 582 22 0 54.55 62.109 17.44 5.40 38.70 4.109
444 atgctagctaggcgatgc 410 18 0 55.56 57.890 10.59 0.00 0.00 4.110
445 ctgatcgatcatcatgctagctac 270 24 0 45.83 59.882 26.67 0.00 41.77 4.118
446 gctactagctagctgatcatca 505 22 0 45.45 57.879 14.37 0.00 44.92 4.121
447 gctactagctagctgatcatca 208 22 0 45.45 57.879 14.37 0.00 44.92 4.121
448 ctgactgatacgcgatgctagc 473 22 0 54.55 62.128 8.61 8.61 0.00 4.128
449 gctgactgatacgcgatgctag 472 22 0 54.55 62.128 1.70 0.00 0.00 4.128
450 ctagctgactgatacgcgatgc 469 22 0 54.55 62.128 3.47 0.00 0.00 4.128
451 gctagctgactgatacgcgatg 468 22 0 54.55 62.128 8.21 0.00 0.00 4.128
452 tgactgatcgatcatcatgctag 267 23 0 43.48 58.866 26.79 18.40 41.77 4.134
453 ctgactgatcgatcatcatgcta 266 23 0 43.48 58.866 20.99 8.89 41.77 4.134
454 tagctgactgatcgatcatcatg 263 23 0 43.48 58.866 22.70 19.51 41.77 4.134
455 ctagctagctgatcgatcgtagc 560 23 0 52.17 61.151 26.87 26.87 0.00 4.151
456 gctagctagctgatcgatcgtag 559 23 0 52.17 61.151 34.38 16.86 46.11 4.151
457 ctgatcgatcgatgctagctagg 399 23 0 52.17 61.158 22.67 6.29 35.21 4.158
458 gatcgatcgatgctagctagtag 120 23 0 47.83 58.829 23.89 2.63 35.21 4.171
459 ttagctagctgactgatcgatcat 258 24 0 41.67 60.177 28.29 18.02 36.62 4.177
460 ctgactgatcgatcatcatgctag 266 24 0 45.83 59.822 20.99 12.80 41.77 4.178
461 ctagctgactgatcgatcatcatg 262 24 0 45.83 59.822 22.70 19.51 41.77 4.178
462 ctagctgatcgatcgatgtgcg 75 22 0 54.55 62.180 31.92 20.85 42.69 4.180
463 tttagctagctgactgatcgatc 257 23 0 43.48 58.807 19.32 19.32 0.00 4.193
464 tgactgatcgatcatcatgcta 267 22 0 40.91 57.803 26.79 13.11 41.77 4.197
465 gctagctactatcatcgatcga 430 22 0 45.45 57.783 22.52 22.52 0.00 4.217
466 gatcgatcgatgctagctagta 120 22 0 45.45 57.783 23.89 18.77 35.21 4.217
467 agctagctactatcatcgatcg 429 22 0 45.45 57.777 17.56 9.87 0.00 4.223
468 atcgatcgatgctagctagtag 121 22 0 45.45 57.777 29.65 2.63 33.56 4.223
469 tgatcatcatcgatgctagctagt 518 24 0 41.67 60.238 22.18 3.56 40.32 4.238
470 tgatcgatcatcatgctagctact 271 24 0 41.67 60.238 27.48 0.00 37.38 4.238
471 actgatcgatcatcatgctagcta 269 24 0 41.67 60.238 26.67 2.76 41.77 4.238
472 catcgatcgatgctagtatgcta 325 23 0 43.48 58.753 37.80 6.23 44.93 4.247
473 tttagctagctgactgatcgat 257 22 0 40.91 57.736 0.38 0.00 0.00 4.264
474 atttagctagctgactgatcga 256 22 0 40.91 57.736 4.16 0.00 0.00 4.264
475 cgcgatcgatgctagcta 372 18 0 55.56 57.717 22.07 3.08 38.48 4.283
476 catcgatcgatgctagtatgctag 325 24 0 45.83 59.708 37.80 16.01 44.93 4.292
477 tagctagctactgatcgatgctac 302 24 0 45.83 60.297 27.80 7.81 0.00 4.297
478 agcatcggattagctagctgatg 3 23 0 47.83 61.299 27.81 27.81 33.28 4.299
479 agctagctgactgatacgcgat 467 22 0 50.00 62.317 17.99 0.00 0.00 4.317
480 tgatcatcatcgatgctagctag 518 23 0 43.48 58.678 17.46 17.46 40.32 4.322
481 ctgatcatcatcgatgctagcta 517 23 0 43.48 58.678 17.69 2.41 40.32 4.322
482 tagctgatcatcatcgatgctag 514 23 0 43.48 58.678 9.90 2.76 40.32 4.322
483 ctagctgatcatcatcgatgcta 513 23 0 43.48 58.678 14.58 9.63 40.32 4.322
484 tagctagctgatcatcatcgatg 510 23 0 43.48 58.678 20.23 20.23 41.48 4.322
485 ctgatcgatcatcatgctagcta 270 23 0 43.48 58.678 26.67 2.76 41.77 4.322
486 gatcatcatcgatgctagctagt 519 23 0 43.48 58.677 22.18 3.56 40.32 4.323
487 gatcgatcatcatgctagctact 272 23 0 43.48 58.677 21.11 0.00 0.00 4.323
488 gctagctagctgactgatcgatc 105 23 0 52.17 61.341 34.38 19.32 46.11 4.341
489 tgatcgatcgatgctagctagtag 119 24 0 45.83 60.356 26.44 2.63 35.21 4.356
490 ctgatcgatcgatgctagctagta 118 24 0 45.83 60.356 22.18 18.77 35.21 4.356
491 ctgatcatcatcgatgctagctag 517 24 0 45.83 59.644 17.46 17.46 40.32 4.356
492 ctagctgatcatcatcgatgctag 513 24 0 45.83 59.644 19.54 18.30 42.07 4.356
493 ctagctagctgatcatcatcgatg 509 24 0 45.83 59.644 20.23 20.23 41.48 4.356
494 tttagctagctgactgatcgatca 257 24 0 41.67 60.358 26.99 26.99 35.44 4.358
495 actatcatctctgcgcgatcga 359 22 0 50.00 62.365 22.07 1.72 38.48 4.365
496 agctgatcgatcgtagcg 566 18 0 55.56 57.634 25.02 11.96 0.00 4.366
497 gctactagctagctgactgatac 461 23 0 47.83 58.626 15.96 1.42 44.92 4.374
498 agctgatcgatcgatgctagct 397 22 0 50.00 62.388 30.32 30.32 38.42 4.388
499 agctagctgatcgatcgatgct 393 22 0 50.00 62.388 33.87 33.38 38.16 4.388
500 ctagctgactgatcgatcatcat 262 23 0 43.48 58.612 26.31 20.43 41.77 4.388
501 agctagctactatcatctctgc 351 22 0 45.45 57.608 17.56 0.00 0.00 4.392
502 ctagctactatcatctctgcgcg 353 23 0 52.17 61.393 0.00 0.00 0.00 4.393
503 tgatcatcatcgatgctagcta 518 22 0 40.91 57.602 17.69 3.08 40.32 4.398
504 tagctgatcatcatcgatgcta 514 22 0 40.91 57.602 15.95 9.16 40.32 4.398
505 tgatcgatcatcatgctagcta 271 22 0 40.91 57.602 27.48 3.08 37.38 4.398
506 atcatcatcgatgctagctagt 520 22 0 40.91 57.595 22.18 3.56 40.32 4.405
507 atcgatcatcatgctagctact 273 22 0 40.91 57.595 0.00 0.00 0.00 4.405
508 agctagctactatcatcgatcgat 429 24 0 41.67 59.573 25.37 25.37 35.13 4.427
509 gctagctgatcgatcgatgtgc 74 22 0 54.55 62.443 31.83 30.04 35.21 4.443
510 tagctgactgatcgatcatcat 263 22 0 40.91 57.531 26.31 20.43 41.77 4.469
511 tagctagctgactgatcgatcga 107 23 0 47.83 61.487 28.29 22.52 0.00 4.487
512 atcgatcgatgctagtatgctag 326 23 0 43.48 58.501 29.65 13.77 46.09 4.499
513 ctagtgatgcatgctagtagtga 26 23 0 43.48 58.483 20.00 1.46 0.00 4.517
514 tagctagctgactgatcgatcatc 259 24 0 45.83 60.536 28.29 21.92 36.62 4.536
515 tactagctagctgatcatcatcga 507 24 0 41.67 59.449 0.00 0.00 0.00 4.551
516 gctagctagctactatcatcga 426 22 0 45.45 57.437 34.38 0.00 46.11 4.563
517 tgactgatacgcgatgctagct 474 22 0 50.00 62.569 17.69 1.35 0.00 4.569
518 agctgactgatacgcgatgcta 471 22 0 50.00 62.569 7.57 0.00 0.00 4.569
519 tagctgactgatacgcgatgct 470 22 0 50.00 62.569 10.87 8.44 0.00 4.569
520 atcgatcgatgctagtatgcta 326 22 0 40.91 57.423 29.65 0.00 33.56 4.577
521 ctagctagctgatcatcatcgat 509 23 0 43.48 58.422 11.68 0.00 0.00 4.578
522 agctgactgatcgatcgatgct 112 22 0 50.00 62.580 26.44 23.13 35.21 4.580
523 ctagctagctgatcatcgatgcta 188 24 0 45.83 60.596 16.78 15.81 0.00 4.596
524 gtgatgcatgctagtagtgatgta 29 24 0 41.67 59.398 11.60 8.84 0.00 4.602
525 gctgatcatcatcgatgctagct 516 23 0 47.83 61.603 20.15 8.14 40.32 4.603
526 agctgatcatcatcgatgctagc 515 23 0 47.83 61.603 20.04 19.26 40.32 4.603
527 gctagctgatcatcatcgatgct 512 23 0 47.83 61.603 14.14 8.34 40.32 4.603
528 agctagctgatcatcatcgatgc 511 23 0 47.83 61.603 21.42 7.40 40.32 4.603
529 tagtgatgcatgctagtagtga 27 22 0 40.91 57.391 0.01 0.00 0.00 4.609
530 ctactagctagctgactgatacg 462 23 0 47.83 58.387 3.12 0.00 0.00 4.613
531 tagctactgatcgatgctacatc 306 23 0 43.48 58.368 13.79 0.00 37.97 4.632
532 gactgatacgcgatgctagctag 475 23 0 52.17 61.633 17.46 17.46 0.00 4.633
533 ctagctactgatcgatgctacat 305 23 0 43.48 58.364 13.79 0.09 0.00 4.636
534 gctagctactatcatctctgcgc 352 23 0 52.17 61.644 8.21 0.00 0.00 4.644
535 gctagctagctactgatcgatgc 300 23 0 52.17 61.644 34.38 12.71 46.11 4.644
536 gctactagctagctgatcatcat 505 23 0 43.48 58.350 14.37 0.00 44.92 4.650
537 gctactagctagctgatcatcat 208 23 0 43.48 58.350 14.37 0.00 44.92 4.650
538 ctagctactgatcgatgctacatc 305 24 0 45.83 59.349 13.79 0.00 37.97 4.651
539 gctactagctagctgatcatcatc 505 24 0 45.83 59.343 14.37 0.00 44.92 4.657
540 gctactagctagctgatcatcatc 208 24 0 45.83 59.343 14.37 0.00 44.92 4.657
541 gctgatcatcatctagctagtagc 154 24 0 45.83 59.343 15.25 15.25 45.79 4.657
542 tagctagctgatcatcatcgat 510 22 0 40.91 57.329 10.14 0.00 0.00 4.671
543 ctactatcatctctgcgcgatcg 357 23 0 52.17 61.686 12.19 12.19 39.07 4.686
544 tactagctagctgactgatacg 463 22 0 45.45 57.310 13.17 0.00 0.00 4.690
545 gctgatcgatcgatgctagctag 398 23 0 52.17 61.697 27.88 18.22 35.21 4.697
546 ctagctgatcgatcgatgctagc 395 23 0 52.17 61.697 38.64 35.38 43.05 4.697
547 gctagctgatcgatcgatgctag 394 23 0 52.17 61.697 41.07 41.07 46.89 4.697
548 ctagctagctgatcgatcgatgc 391 23 0 52.17 61.697 24.08 21.09 35.21 4.697
549 gctagctagctgatcgatcgatg 390 23 0 52.17 61.697 34.38 11.03 46.11 4.697
550 gctagctagctgatcgatcgatg 70 23 0 52.17 61.697 34.38 11.03 46.11 4.697
551 gctactagctagctgactgata 461 22 0 45.45 57.286 15.96 3.69 44.92 4.714
552 gatcgatcatcatgctagctac 272 22 0 45.45 57.284 21.11 0.00 0.00 4.716
553 cgatgctagctaggcgat 408 18 0 55.56 57.277 10.81 3.01 0.00 4.723
554 atcgatgctagctaggcg 406 18 0 55.56 57.277 15.59 9.02 0.00 4.723
555 tagctactgatcgatgctacat 306 22 0 40.91 57.270 13.79 0.09 0.00 4.730
556 gctagctactatcatcgatcgat 430 23 0 43.48 58.251 25.37 25.37 35.13 4.749
557 tgcatgctagtagtgatgtatacg 33 24 0 41.67 59.224 20.79 0.00 0.00 4.776
558 gcatgctagtagtgatgtatacgt 34 24 0 41.67 59.223 11.60 0.00 0.00 4.777
559 atttagctagctgactgatcgatc 256 24 0 41.67 59.219 19.32 19.32 0.00 4.781
560 gactgatcgatcatcatgctag 268 22 0 45.45 57.215 24.51 15.87 41.77 4.785
561 atttagctagctgactgatcgat 256 23 0 39.13 58.215 4.16 0.00 0.00 4.785
562 gctgactgatcgatcatcatgct 265 23 0 47.83 61.788 27.72 15.10 41.77 4.788
563 agctgactgatcgatcatcatgc 264 23 0 47.83 61.788 27.74 27.74 41.77 4.788
564 tagctactatcatctctgcgcga 354 23 0 47.83 61.796 2.71 2.71 0.00 4.796
565 gctgatcatcgatgctactagcta 195 24 0 45.83 60.834 20.91 7.37 45.92 4.834
566 tagctgatcatcgatgctactagc 193 24 0 45.83 60.834 20.78 20.78 45.61 4.834
567 gctagctgatcatcgatgctacta 191 24 0 45.83 60.834 11.65 8.83 0.00 4.834
568 tagctagctgatcatcgatgctac 189 24 0 45.83 60.834 17.82 12.06 0.00 4.834
569 tagtgatgcatgctagtagtgatg 27 24 0 41.67 59.155 11.56 7.49 0.00 4.845
570 agtgatgcatgctagtagtgatgt 28 24 0 41.67 60.846 11.60 0.00 0.00 4.846
571 tgatgcatgctagtagtgatgta 30 23 0 39.13 58.147 11.60 8.84 0.00 4.853
572 ctgactgatcgatcgatgctagc 114 23 0 52.17 61.878 18.17 12.52 35.21 4.878
573 gctgactgatcgatcgatgctag 113 23 0 52.17 61.878 22.81 19.44 35.21 4.878
574 ctagctgactgatcgatcgatgc 110 23 0 52.17 61.878 24.08 19.43 35.21 4.878
575 gctagctgactgatcgatcgatg 109 23 0 52.17 61.878 23.05 13.21 35.21 4.878
576 tcatcatcgatgctagctagtag 521 23 0 43.48 58.114 2.81 0.00 40.32 4.886
577 tactagctagctgatcatcatcg 507 23 0 43.48 58.114 0.00 0.00 0.00 4.886
578 tcgatcatcatgctagctactag 274 23 0 43.48 58.114 0.00 0.00 37.62 4.886
579 tgatcatcgatgctactagctag 197 23 0 43.48 58.114 20.04 20.04 45.92 4.886
580 ctgatcatcgatgctactagcta 196 23 0 43.48 58.114 10.86 0.00 45.92 4.886
581 tagctgatcatcgatgctactag 193 23 0 43.48 58.114 13.67 9.68 0.00 4.886
582 ctagctgatcatcgatgctacta 192 23 0 43.48 58.114 11.65 8.83 0.00 4.886
583 ctactagctagctgatcatcatcg 506 24 0 45.83 59.110 1.08 0.00 0.00 4.890
584 ctgatcatcgatgctactagctag 196 24 0 45.83 59.110 20.04 20.04 45.92 4.890
585 ctagctgatcatcgatgctactag 192 24 0 45.83 59.110 15.68 15.68 0.00 4.890
586 gctagctagctgatcatcatctag 146 24 0 45.83 59.102 34.38 13.13 44.71 4.898
587 gctagctagctgatcatcatcta 146 23 0 43.48 58.097 34.38 0.00 46.11 4.903
588 ctagtgatgcatgctagtagtg 26 22 0 45.45 57.072 20.00 3.96 0.00 4.928
589 gctactatcatctctgcgcgatc 356 23 0 52.17 61.936 4.99 0.00 0.00 4.936
590 gctgatcgatcgatgtgc 78 18 0 55.56 57.052 29.71 26.38 35.21 4.948
591 tagctagctactatcatcgatcga 428 24 0 41.67 59.031 27.80 22.52 0.00 4.969
592 agctagctgatcgatcgtagcg 562 22 0 54.55 62.971 27.20 18.31 0.00 4.971
593 tgactgatacgcgatgct 474 18 0 50.00 57.028 2.33 0.00 0.00 4.972
594 gatcatcatcgatgctagctag 519 22 0 45.45 57.019 17.46 17.46 40.32 4.981
595 tcatcatcgatgctagctagta 521 22 0 40.91 57.005 22.18 18.77 40.32 4.995
596 tcgatcatcatgctagctacta 274 22 0 40.91 57.005 0.00 0.00 0.00 4.995
597 tgatcatcgatgctactagcta 197 22 0 40.91 57.005 17.14 1.01 45.92 4.995
598 tagctgatcatcgatgctacta 193 22 0 40.91 57.005 12.62 8.42 0.00 4.995
599 tagctagctgactgatacgcgat 466 23 0 47.83 62.044 28.29 0.00 0.00 5.044
600 ctagctagctactatcatcgatcga 427 25 0 44.00 59.949 27.80 22.52 0.00 5.051
601 agctagctgactgatcgatcgat 108 23 0 47.83 62.053 30.53 30.53 37.90 5.053
602 ctactagctagctgactgatacgc 462 24 0 50.00 61.062 3.61 0.00 0.00 5.062
603 gctactagctagctgactgatacg 461 24 0 50.00 61.062 14.37 0.00 44.92 5.062
604 tgatcatcatcgatgctagctagta 518 25 0 40.00 60.062 22.18 18.77 40.32 5.062
605 tgatcgatcatcatgctagctacta 271 25 0 40.00 60.062 27.48 0.00 37.38 5.062
606 ctagtgatgcatgctagtagtgatg 26 25 0 44.00 60.064 20.00 7.49 0.00 5.064
607 gctagctagctactatcatcgatc 426 24 0 45.83 58.932 34.38 4.20 46.11 5.068
608 gctagctactgatcgatgctacat 304 24 0 45.83 61.072 11.21 0.00 0.00 5.072
609 gctagctagctactatcatcgat 426 23 0 43.48 57.922 34.38 0.00 46.11 5.078
610 ctagtgatgcatgctagtagtgat 26 24 0 41.67 58.911 20.00 4.64 0.00 5.089
611 tactatcatctctgcgcgatcga 358 23 0 47.83 62.092 22.07 1.72 38.48 5.092
612 agctgatcgatcgatgctagcta 397 23 0 47.83 62.111 31.26 14.51 40.03 5.111
613 tagctgatcgatcgatgctagct 396 23 0 47.83 62.111 33.22 33.22 42.08 5.111
614 agctagctgatcgatcgatgcta 393 23 0 47.83 62.111 34.11 32.56 36.80 5.111
615 tagctagctgatcgatcgatgct 392 23 0 47.83 62.111 33.87 33.38 38.16 5.111
616 tagtgatgcatgctagtagtgat 27 23 0 39.13 57.886 11.56 0.00 0.00 5.114
617 tactagctagctgatcatcatcgat 507 25 0 40.00 59.828 0.00 0.00 0.00 5.172
618 gctagctagctgatcatcgatgc 187 23 0 52.17 62.193 34.38 9.22 46.11 5.193
619 gctagtgatgcatgctagtagtga 25 24 0 45.83 61.195 24.96 4.57 0.00 5.195
620 aaagcatcggattagctagctgat 1 24 0 41.67 61.209 17.84 15.13 0.00 5.209
621 gtgatgcatgctagtagtgatgtat 29 25 0 40.00 59.774 1.07 1.07 0.00 5.226
622 ctatcatctctgcgcgatcgatg 360 23 0 52.17 62.227 18.01 18.01 38.48 5.227
623 tgactgatacgcgatgctagcta 474 23 0 47.83 62.287 17.69 3.08 0.00 5.287
624 tagctgactgatacgcgatgcta 470 23 0 47.83 62.287 12.64 9.09 0.00 5.287
625 tgctagtagtgatgtatacgtagct 37 25 0 40.00 59.713 9.37 8.73 0.00 5.287
626 tgactgatcgatcgatgctagct 115 23 0 47.83 62.296 20.19 11.59 35.21 5.296
627 agctgactgatcgatcgatgcta 112 23 0 47.83 62.296 26.44 14.64 35.21 5.296
628 tagctgactgatcgatcgatgct 111 23 0 47.83 62.296 31.98 30.27 35.21 5.296
629 ctagctagctactatcatcgatcg 427 24 0 45.83 58.703 12.49 9.87 0.00 5.297
630 tagctagctactatcatcgatcg 428 23 0 43.48 57.691 27.80 9.87 0.00 5.309
631 gactgatcgatcatcatgctagct 268 24 0 45.83 61.313 24.51 7.81 41.77 5.313
632 gctagctgactgatcgatcatcat 261 24 0 45.83 61.313 26.31 20.43 41.77 5.313
633 ctatttagctagctgactgatcga 254 24 0 41.67 58.679 0.00 0.00 0.00 5.321
634 gcatgctagtagtgatgtatacg 34 23 0 43.48 57.659 11.60 0.00 0.00 5.341
635 tatttagctagctgactgatcga 255 23 0 39.13 57.650 0.00 0.00 0.00 5.350
636 ctactagctagctgatcatcatcga 506 25 0 44.00 60.352 1.08 0.00 0.00 5.352
637 agctactatcatctctgcgcgat 355 23 0 47.83 62.360 4.99 2.52 0.00 5.360
638 gctgatcatcatcgatgctagcta 516 24 0 45.83 61.370 20.15 8.49 40.32 5.370
639 tagctgatcatcatcgatgctagc 514 24 0 45.83 61.370 20.04 19.26 40.32 5.370
640 gctagctgatcatcatcgatgcta 512 24 0 45.83 61.370 14.58 9.63 40.32 5.370
641 tagctagctgatcatcatcgatgc 510 24 0 45.83 61.370 21.42 7.40 40.32 5.370
642 atgcatgctagtagtgatgtatacg 32 25 0 40.00 59.604 11.70 0.00 0.00 5.396
643 tgatgcatgctagtagtgatgtat 30 24 0 37.50 58.592 12.66 12.66 0.00 5.408
644 gactgatcgatcgatgctagctag 116 24 0 50.00 61.409 18.04 17.46 35.21 5.409
645 gctatttagctagctgactgatc 253 23 0 43.48 57.572 7.27 0.00 46.11 5.428
646 tgctagtgatgcatgctagtagtg 24 24 0 45.83 61.434 24.96 10.54 35.89 5.434
647 ctagctagctactatcatctctgc 349 24 0 45.83 58.562 27.80 0.00 0.00 5.438
648 gctagctagctactatcatctctg 348 24 0 45.83 58.562 34.38 6.79 46.11 5.438
649 gatcatcatcgatgctagctagta 519 24 0 41.67 58.557 22.18 18.77 40.32 5.443
650 gatcgatcatcatgctagctacta 272 24 0 41.67 58.557 21.11 0.00 0.00 5.443
651 atcatcatcgatgctagctagtag 520 24 0 41.67 58.554 2.13 0.00 40.32 5.446
652 atcgatcatcatgctagctactag 273 24 0 41.67 58.554 0.00 0.00 37.62 5.446
653 tagctagctactatcatctctgc 350 23 0 43.48 57.527 27.80 0.00 0.00 5.473
654 atcatcatcgatgctagctagta 520 23 0 39.13 57.514 22.18 18.77 40.32 5.486
655 atcgatcatcatgctagctacta 273 23 0 39.13 57.514 0.00 0.00 0.00 5.486
656 gatcatcatcgatgctagctagtag 519 25 0 44.00 59.494 0.21 0.00 40.32 5.506
657 gatcgatcatcatgctagctactag 272 25 0 44.00 59.494 21.11 0.00 37.62 5.506
658 actagctagctgatcatcatctact 211 25 0 40.00 59.471 22.43 6.99 0.00 5.529
659 tgactgatcgatcatcatgctagc 267 24 0 45.83 61.547 26.79 14.13 41.77 5.547
660 gctgactgatcgatcatcatgcta 265 24 0 45.83 61.547 27.72 16.42 41.77 5.547
661 tagctgactgatcgatcatcatgc 263 24 0 45.83 61.547 27.74 27.74 41.77 5.547
662 tgctagtagtgatgtatacgtagc 37 24 0 41.67 58.446 4.93 4.93 0.00 5.554
663 ctagctagctgactgatacgcga 465 23 0 52.17 62.571 14.90 0.00 0.00 5.571
664 tagctagctactatcatcgatcgat 428 25 0 40.00 59.423 27.80 25.37 35.13 5.577
665 gctactagctagctgatcatcatct 208 25 0 44.00 60.585 14.37 0.00 44.92 5.585
666 agctgatcatcatctagctagtagc 153 25 0 44.00 60.585 15.25 15.25 40.45 5.585
667 ctagctagctgatcgatcgatgtg 71 24 0 50.00 61.642 11.68 4.94 35.21 5.642
668 agtgatgcatgctagtagtgatgta 28 25 0 40.00 60.646 11.60 8.84 0.00 5.646
669 tagtgatgcatgctagtagtgatgt 27 25 0 40.00 60.646 11.60 0.00 0.00 5.646
670 actatcatctctgcgcgatcgat 359 23 0 47.83 62.652 22.07 11.47 38.48 5.652
671 ctatttagctagctgactgatcg 254 23 0 43.48 57.339 0.00 0.00 0.00 5.661
672 tagctagctgatcgatcgtagcg 561 23 0 52.17 62.677 27.20 18.31 0.00 5.677
673 gcatcggattagctagctgatgc 4 23 0 52.17 62.687 34.10 34.10 41.15 5.687
674 tgcatgctagtagtgatgtatacgt 33 25 0 40.00 60.700 20.79 0.00 0.00 5.700
675 tttagctagctgactgatcgatcat 257 25 0 40.00 60.702 26.67 18.02 36.62 5.702
676 atttagctagctgactgatcgatca 256 25 0 40.00 60.702 26.99 26.99 35.44 5.702
677 gctagctagctactatcatctct 348 23 0 43.48 57.266 34.38 0.00 46.11 5.734
678 aagcatcggattagctagctgatg 2 24 0 45.83 61.794 27.81 27.81 33.28 5.794
679 agtgatgtatacgtagctagtagc 44 24 0 41.67 58.201 15.25 15.25 45.79 5.799
680 gctagtagtgatgtatacgtagct 38 24 0 41.67 58.201 5.92 5.92 0.00 5.799
681 tagctagctgactgatcgatcgat 107 24 0 45.83 61.800 30.53 30.53 37.90 5.800
682 actagctagctgactgatacgcg 464 23 0 52.17 62.816 21.52 3.89 0.00 5.816
683 actagctagctgatcatcatctac 211 24 0 41.67 58.178 22.43 0.00 0.00 5.822
684 tagctgatcgatcgatgctagcta 396 24 0 45.83 61.857 34.98 33.55 41.05 5.857
685 tagctagctgatcgatcgatgcta 392 24 0 45.83 61.857 34.11 32.56 36.80 5.857
686 tatttagctagctgactgatcgat 255 24 0 37.50 58.112 1.68 0.00 0.00 5.888
687 gcatgctagtagtgatgtatacgta 34 25 0 40.00 59.089 11.60 0.00 0.00 5.911
688 tatttagctagctgactgatcgatc 255 25 0 40.00 59.084 19.32 19.32 0.00 5.916
689 ctatttagctagctgactgatcgat 254 25 0 40.00 59.082 0.00 0.00 0.00 5.918
690 ctagctagctactatcatctctgcg 349 25 0 48.00 60.920 27.80 5.75 0.00 5.920
691 tgatcgatcgatgctagctaggc 400 23 0 52.17 62.955 26.44 12.49 35.21 5.955
692 agctagctactgatcgatgctaca 303 24 0 45.83 61.988 17.56 3.03 0.00 5.988
693 tgactgatcgatcgatgctagcta 115 24 0 45.83 62.034 20.19 11.16 35.21 6.034
694 tagctgactgatcgatcgatgcta 111 24 0 45.83 62.034 33.43 30.74 35.21 6.034
695 catgctagtagtgatgtatacgtagc 35 26 0 42.31 59.961 4.93 4.93 0.00 6.039
696 gcatgctagtagtgatgtatacgtag 34 26 0 42.31 59.961 11.60 0.00 0.00 6.039
697 actgatcgatcgatgctagctagt 117 24 0 45.83 62.039 23.29 15.07 35.21 6.039
698 ctatttagctagctgactgatcgatc 254 26 0 42.31 59.960 19.32 19.32 0.00 6.040
699 ttagctagctgactgatcgatcatc 258 25 0 44.00 61.041 28.29 21.92 36.62 6.041
700 atgctagtagtgatgtatacgtagct 36 26 0 38.46 60.068 9.37 8.73 0.00 6.068
701 ctagctagctgatcatcatctact 212 24 0 41.67 57.930 11.68 6.99 0.00 6.070
702 ctactagctagctgatcatcatct 209 24 0 41.67 57.930 1.08 0.00 0.00 6.070
703 agctgatcatcatctagctagtag 153 24 0 41.67 57.930 7.49 3.73 40.45 6.070
704 ctagctgatcatcatctagctagt 151 24 0 41.67 57.930 21.70 5.56 46.15 6.070
705 tagctactatcatctctgcgcgat 354 24 0 45.83 62.096 4.99 2.52 0.00 6.096
706 gactgatcgatcatcatgctagcta 268 25 0 44.00 61.099 24.51 4.57 41.77 6.099
707 ctgatcatcatcgatgctagctagt 517 25 0 44.00 61.101 22.18 3.56 40.32 6.101
708 actagctagctgatcatcatcgatg 508 25 0 44.00 61.101 22.43 20.23 41.48 6.101
709 ctgatcgatcatcatgctagctact 270 25 0 44.00 61.101 26.67 0.00 41.77 6.101
710 atgctagtagtgatgtatacgtagc 36 25 0 40.00 58.855 4.93 4.93 0.00 6.145
711 ctagctagctactgatcgatgctac 301 25 0 48.00 61.145 14.00 7.81 0.00 6.145
712 gctagctagctactatcatctctgc 348 25 0 48.00 61.152 34.38 11.74 46.11 6.152
713 agctagctgatcatcatctactatca 214 26 0 38.46 59.840 17.99 0.00 0.00 6.160
714 ctgatcgatcgatgctagctagtag 118 25 0 48.00 61.197 19.70 5.49 35.21 6.197
715 agctagctgactgatcgatcatca 260 24 0 45.83 62.232 26.49 26.49 39.98 6.232
716 gctagctagctactatcatcgatcg 426 25 0 48.00 61.252 34.38 9.87 46.11 6.252
717 gctatttagctagctgactgatcga 253 25 0 44.00 61.268 7.27 0.00 46.11 6.268
718 ctagctagctactatcatcgatcgat 427 26 0 42.31 60.291 27.80 25.37 35.13 6.291
719 agctgatcatcgatgctactagct 194 24 0 45.83 62.294 24.11 23.60 45.92 6.294
720 agctagctgatcatcgatgctact 190 24 0 45.83 62.294 17.99 10.88 0.00 6.294
721 ctagctagctgactgatcgatcga 106 24 0 50.00 62.312 22.52 22.52 0.00 6.312
722 actgatcgatcatcatgctagctac 269 25 0 44.00 61.328 26.67 0.00 41.77 6.328
723 tgatgcatgctagtagtgatgtatac 30 26 0 38.46 59.623 9.19 6.43 0.00 6.377
724 gtgatgcatgctagtagtgatgtata 29 26 0 38.46 59.623 4.23 0.00 0.00 6.377
725 tactatcatctctgcgcgatcgat 358 24 0 45.83 62.379 22.07 11.47 38.48 6.379
726 gctagctgatcatcatctactatca 215 25 0 40.00 58.607 8.21 0.00 0.00 6.393
727 gctactagctagctgatcatcatcta 208 26 0 42.31 60.404 14.37 0.00 44.92 6.404
728 tagctgatcatcatctagctagtagc 152 26 0 42.31 60.404 15.25 15.25 41.48 6.404
729 tgctagtagtgatgtatacgtagcta 37 26 0 38.46 59.564 10.00 8.05 0.00 6.436
730 gatgcatgctagtagtgatgtatacg 31 26 0 42.31 60.453 7.40 0.00 0.00 6.453
731 tagtgatgcatgctagtagtgatgta 27 26 0 38.46 60.461 11.60 8.84 0.00 6.461
732 gctagtgatgcatgctagtagtgat 25 25 0 44.00 61.506 24.96 8.51 0.00 6.506
733 tgcatgctagtagtgatgtatacgta 33 26 0 38.46 60.515 20.79 0.00 0.00 6.515
734 tatttagctagctgactgatcgatca 255 26 0 38.46 60.516 26.99 26.99 35.44 6.516
735 tgatgcatgctagtagtgatgtata 30 25 0 36.00 58.479 4.13 0.00 0.00 6.521
736 tactagctagctgactgatacgcg 463 24 0 50.00 62.538 13.17 3.89 0.00 6.538
737 ctagctactatcatctctgcgcga 353 24 0 50.00 62.603 2.71 2.71 0.00 6.603
738 agctagctgatcatcatctactatc 214 25 0 40.00 58.369 17.99 0.00 0.00 6.631
739 agctagctgatcatcatctactat 214 24 0 37.50 57.345 17.99 0.00 0.00 6.655
740 gctactagctagctgatcatcatcg 505 25 0 48.00 61.656 14.37 0.00 44.92 6.656
741 gctgatcatcgatgctactagctag 195 25 0 48.00 61.656 20.91 20.04 45.92 6.656
742 ctagctgatcatcgatgctactagc 192 25 0 48.00 61.656 20.78 20.78 45.61 6.656
743 gctagctgatcatcgatgctactag 191 25 0 48.00 61.656 20.13 20.13 0.00 6.656
744 ctagctagctgatcatcgatgctac 188 25 0 48.00 61.656 17.82 12.06 0.00 6.656
745 actagctagctgatcatcatctacta 211 26 0 38.46 59.328 22.43 8.11 0.00 6.672
746 tactagctagctgatcatcatctact 210 26 0 38.46 59.328 6.99 6.99 0.00 6.672
747 ctactagctagctgatcatcatcgat 506 26 0 42.31 60.681 1.08 0.00 0.00 6.681
748 tagctagctactgatcgatgctaca 302 25 0 44.00 61.746 27.80 5.02 0.00 6.746
749 gtagtgatgtatacgtagctagtagc 42 26 0 42.31 59.249 15.25 15.25 45.79 6.751
750 actgatcgatcgatgctagctagta 117 25 0 44.00 61.797 23.29 18.77 35.21 6.797
751 gatgcatgctagtagtgatgtatac 31 25 0 40.00 58.175 20.79 1.70 0.00 6.825
752 agctgatcatcatcgatgctagct 515 24 0 45.83 62.835 23.00 22.41 41.74 6.835
753 agctagctgatcatcatcgatgct 511 24 0 45.83 62.835 17.99 8.34 40.32 6.835
754 ctagctagctgactgatacgcgat 465 24 0 50.00 62.838 14.90 0.00 0.00 6.838
755 atgcatgctagtagtgatgtatac 32 24 0 37.50 57.161 11.70 0.53 0.00 6.839
756 agctagctactatcatctctgcgc 351 24 0 50.00 62.858 17.56 0.00 0.00 6.858
757 gctagctagctactgatcgatgct 300 24 0 50.00 62.858 34.38 11.51 46.11 6.858
758 ctactatcatctctgcgcgatcga 357 24 0 50.00 62.878 22.07 1.72 38.48 6.878
759 gctagctactgatcgatgctacatc 304 25 0 48.00 61.879 11.21 4.40 37.97 6.879
760 tagtgatgtatacgtagctagtagc 43 25 0 40.00 58.104 15.25 15.25 45.79 6.896
761 gctagtagtgatgtatacgtagcta 38 25 0 40.00 58.104 7.24 5.34 0.00 6.896
762 tgatcatcatcgatgctagctagtag 518 26 0 42.31 60.902 14.93 0.00 40.32 6.902
763 ctgatcatcatcgatgctagctagta 517 26 0 42.31 60.902 22.18 18.77 40.32 6.902
764 tactagctagctgatcatcatcgatg 507 26 0 42.31 60.902 20.23 20.23 41.48 6.902
765 tgatcgatcatcatgctagctactag 271 26 0 42.31 60.902 27.48 0.00 37.38 6.902
766 ctgatcgatcatcatgctagctacta 270 26 0 42.31 60.902 26.67 1.37 41.77 6.902
767 agctgatcgatcgatgctagctag 397 24 0 50.00 62.904 31.26 19.90 40.03 6.904
768 ctagctgatcgatcgatgctagct 395 24 0 50.00 62.904 35.51 33.22 43.05 6.904
769 agctagctgatcgatcgatgctag 393 24 0 50.00 62.904 41.07 41.07 46.89 6.904
770 ctagctagctgatcgatcgatgct 391 24 0 50.00 62.904 33.87 33.38 38.16 6.904
771 tactagctagctgatcatcatctac 210 25 0 40.00 58.081 0.00 0.00 0.00 6.919
772 gctagctgatcatcatctactatc 215 24 0 41.67 57.062 8.21 0.00 0.00 6.938
773 agtgatgcatgctagtagtgatgtat 28 26 0 38.46 60.969 1.07 1.07 0.00 6.969
774 gctagtagtgatgtatacgtagctag 38 26 0 42.31 59.027 8.99 8.99 0.00 6.973
775 tagctagctgactgatcgatcatca 259 25 0 44.00 61.981 28.29 26.49 39.98 6.981
776 ctactagctagctgatcatcatctac 209 26 0 42.31 59.015 1.08 0.00 0.00 6.985
777 agtagtgatgtatacgtagctagt 41 24 0 37.50 57.012 8.68 8.68 0.00 6.988
778 gctagctgatcatcatctactatcat 215 26 0 38.46 59.001 8.21 0.00 0.00 6.999
779 agctgatcatcatctactatcatca 218 25 0 36.00 57.993 0.00 0.00 0.00 7.007
780 atgcatgctagtagtgatgtatacgt 32 26 0 38.46 61.018 11.70 0.00 0.00 7.018
781 atttagctagctgactgatcgatcat 256 26 0 38.46 61.022 26.67 18.02 36.62 7.022
782 agctgatcatcgatgctactagcta 194 25 0 44.00 62.040 24.59 9.79 45.92 7.040
783 tagctgatcatcgatgctactagct 193 25 0 44.00 62.040 27.00 27.00 45.92 7.040
784 agctagctgatcatcgatgctacta 190 25 0 44.00 62.040 17.99 11.59 0.00 7.040
785 tagctagctgatcatcgatgctact 189 25 0 44.00 62.040 17.55 15.53 0.00 7.040
786 atgctagtagtgatgtatacgtagcta 36 27 0 37.04 59.911 10.00 8.05 0.00 7.089
787 gctagctgatcatcatctactatcatc 215 27 0 40.74 59.861 8.21 0.00 0.00 7.139
788 ctagctagctgatcatcatctacta 212 25 0 40.00 57.842 11.68 8.11 0.00 7.158
789 ctactagctagctgatcatcatcta 209 25 0 40.00 57.842 1.08 0.00 0.00 7.158
790 tagctgatcatcatctagctagtag 152 25 0 40.00 57.842 13.40 3.73 41.48 7.158
791 ctagctgatcatcatctagctagta 151 25 0 40.00 57.842 21.70 7.13 46.15 7.158
792 gctgatcatcatcgatgctagctag 516 25 0 48.00 62.165 20.15 17.46 40.32 7.165
793 ctagctgatcatcatcgatgctagc 513 25 0 48.00 62.165 19.27 19.26 41.96 7.165
794 gctagctgatcatcatcgatgctag 512 25 0 48.00 62.165 23.70 23.70 45.51 7.165
795 ctagctagctgatcatcatcgatgc 509 25 0 48.00 62.165 21.42 7.40 40.32 7.165
796 agctagctgatcatcatctactatcat 214 27 0 37.04 60.181 17.99 0.00 0.00 7.181
797 ctactagctagctgatcatcatctact 209 27 0 40.74 60.181 6.99 6.99 0.00 7.181
798 ctagctgatcatcatctagctagtag 151 26 0 42.31 58.789 21.70 10.73 46.15 7.211
799 aaagcatcggattagctagctgatg 1 25 0 44.00 62.249 27.81 27.81 33.28 7.249
800 agctagctactgatcgatgctacat 303 25 0 44.00 62.272 17.56 6.16 0.00 7.272
801 tagctagctgatcatcatctactatca 213 27 0 37.04 59.689 8.31 0.00 0.00 7.311
802 actagctagctgatcatcatctactat 211 27 0 37.04 59.688 22.43 2.36 0.00 7.312
803 ctgactgatcgatcatcatgctagc 266 25 0 48.00 62.333 20.99 8.86 41.77 7.333
804 gctgactgatcgatcatcatgctag 265 25 0 48.00 62.333 27.72 21.73 41.77 7.333
805 ctagctgactgatcgatcatcatgc 262 25 0 48.00 62.333 27.74 27.74 41.77 7.333
806 gctagctgactgatcgatcatcatg 261 25 0 48.00 62.333 22.70 19.51 41.77 7.333
807 tgctagtagtgatgtatacgtagctag 37 27 0 40.74 60.395 8.99 8.99 0.00 7.395
808 agtagtgatgtatacgtagctagtagc 41 27 0 40.74 60.395 15.25 15.25 45.79 7.395
809 gctagtagtgatgtatacgtagctagt 38 27 0 40.74 60.395 15.55 15.55 0.00 7.395
810 ctagtgatgcatgctagtagtgatgt 26 26 0 42.31 61.460 20.00 0.00 0.00 7.460
811 gctgatcatcatctactatcatcatca 219 27 0 37.04 59.533 0.00 0.00 0.00 7.467
812 agctagctgactgatcgatcatcat 260 25 0 44.00 62.507 26.31 20.43 41.77 7.507
813 tttagctagctgactgatcgatcatc 257 26 0 42.31 61.507 23.93 21.92 36.62 7.507
814 catgctagtagtgatgtatacgtag 35 25 0 40.00 57.441 4.74 0.00 0.00 7.559
815 agctgatcatcatcgatgctagcta 515 25 0 44.00 62.561 23.50 10.90 43.19 7.561
816 tagctgatcatcatcgatgctagct 514 25 0 44.00 62.561 26.21 26.21 44.79 7.561
817 agctagctgatcatcatcgatgcta 511 25 0 44.00 62.561 17.99 9.63 40.32 7.561
818 tagctagctgatcatcatcgatgct 510 25 0 44.00 62.561 14.14 10.38 40.32 7.561
819 gctatttagctagctgactgatcgat 253 26 0 42.31 61.564 7.27 0.00 46.11 7.564
820 ctagctagctgactgatcgatcgat 106 25 0 48.00 62.579 30.53 30.53 37.90 7.579
821 agctgatcatcatctactatcatcat 218 26 0 34.62 58.415 0.00 0.00 0.00 7.585
822 tagctagctactatcatctctgcgc 350 25 0 48.00 62.587 27.80 0.00 0.00 7.587
823 gctagctagctactgatcgatgcta 300 25 0 48.00 62.587 34.38 12.23 46.11 7.587
824 tgctagtgatgcatgctagtagtga 24 25 0 44.00 62.622 24.96 13.57 35.89 7.622
825 tagctgatcgatcgatgctagctag 396 25 0 48.00 62.632 33.71 21.46 41.05 7.632
826 ctagctgatcgatcgatgctagcta 395 25 0 48.00 62.632 35.51 32.61 43.05 7.632
827 tagctagctgatcgatcgatgctag 392 25 0 48.00 62.632 41.07 41.07 46.89 7.632
828 ctagctagctgatcgatcgatgcta 391 25 0 48.00 62.632 34.11 32.56 36.80 7.632
829 gtgatgcatgctagtagtgatgtatac 29 27 0 40.74 60.659 9.56 7.17 0.00 7.659
830 agctgatcatcatctactatcatcatc 218 27 0 37.04 59.314 0.00 0.00 0.00 7.686
831 tagctagctgatcatcatctactat 213 25 0 36.00 57.279 8.31 0.00 0.00 7.721
832 tagctagctgatcatcatctactatc 213 26 0 38.46 58.269 8.31 0.00 0.00 7.731
833 tgactgatcgatcatcatgctagct 267 25 0 44.00 62.733 26.79 10.55 41.77 7.733
834 agctgactgatcgatcatcatgcta 264 25 0 44.00 62.733 30.60 18.10 41.77 7.733
835 tagctgactgatcgatcatcatgct 263 25 0 44.00 62.733 32.31 32.31 41.77 7.733
836 ctagctagctgatcatcatctactat 212 26 0 38.46 58.265 9.41 0.00 0.00 7.735
837 agtgatgcatgctagtagtgatgtata 28 27 0 37.04 60.779 4.23 0.00 0.00 7.779
838 tagtgatgcatgctagtagtgatgtat 27 27 0 37.04 60.779 11.56 0.00 0.00 7.779
839 tgactgatcgatcgatgctagctag 115 25 0 48.00 62.800 20.19 17.46 35.21 7.800
840 ctgactgatcgatcgatgctagcta 114 25 0 48.00 62.800 20.19 11.97 35.21 7.800
841 tagctgactgatcgatcgatgctag 111 25 0 48.00 62.800 31.45 26.34 35.21 7.800
842 ctagctgactgatcgatcgatgcta 110 25 0 48.00 62.800 31.54 29.68 35.21 7.800
843 tagctagctgactgatcgatcgatg 107 25 0 48.00 62.800 28.29 13.21 35.21 7.800
844 gactgatcgatcgatgctagctagt 116 25 0 48.00 62.802 22.18 12.64 35.21 7.802
845 tactagctagctgatcatcatctacta 210 27 0 37.04 59.196 8.79 8.11 0.00 7.804
846 tagctgatcatcgatgctactagcta 193 26 0 42.31 61.805 28.86 27.39 45.92 7.805
847 tagctagctgatcatcgatgctacta 189 26 0 42.31 61.805 18.93 16.03 0.00 7.805
848 atgcatgctagtagtgatgtatacgta 32 27 0 37.04 60.828 11.70 0.00 0.00 7.828
849 tatttagctagctgactgatcgatcat 255 27 0 37.04 60.831 26.67 18.02 36.62 7.831
850 ctagctagctgatcatcatctactatc 212 27 0 40.74 59.162 9.41 0.06 0.00 7.838
851 tagctactatcatctctgcgcgatc 354 25 0 48.00 62.854 0.00 0.00 0.00 7.854
852 gctgatcatcatctactatcatcat 219 25 0 36.00 57.142 0.00 0.00 0.00 7.858
853 ctagctactatcatctctgcgcgat 353 25 0 48.00 62.859 4.99 2.52 0.00 7.859
854 gctgatcatcatctactatcatcatc 219 26 0 38.46 58.126 0.00 0.00 0.00 7.874
855 tagctagctactgatcgatgctacat 302 26 0 42.31 62.028 27.80 3.08 0.00 8.028
856 agtagtgatgtatacgtagctagtag 41 26 0 38.46 57.950 9.92 1.30 0.00 8.050
857 ctagtagtgatgtatacgtagctagt 39 26 0 38.46 57.950 15.52 15.52 0.00 8.050
858 catgctagtagtgatgtatacgtagct 35 27 0 40.74 61.089 9.37 8.73 0.00 8.089
859 gactgatcgatcatcatgctagctac 268 26 0 46.15 62.094 24.51 8.36 41.77 8.094
860 tagctgatcatcatctactatcatca 217 26 0 34.62 57.906 0.00 0.00 0.00 8.094
861 ctagctgatcatcatctactatcatca 216 27 0 37.04 58.826 0.00 0.00 0.00 8.174
862 ctagctgatcatcatctagctagtagc 151 27 0 44.44 61.196 21.70 15.25 46.15 8.196
863 tagctagctgactgatcgatcatcat 259 26 0 42.31 62.255 28.29 20.43 41.77 8.255
864 ctagtgatgcatgctagtagtgatgta 26 27 0 40.74 61.255 20.00 8.84 0.00 8.255
865 tgcatgctagtagtgatgtatacgtag 33 27 0 40.74 61.300 20.79 0.00 0.00 8.300
866 ctatttagctagctgactgatcgatca 254 27 0 40.74 61.304 26.99 26.99 35.44 8.304
867 tagctgatcatcatcgatgctagcta 514 26 0 42.31 62.307 28.23 26.63 43.19 8.307
868 tagctagctgatcatcatcgatgcta 510 26 0 42.31 62.307 14.58 11.03 40.32 8.307
869 gctagctagctactatcatcgatcga 426 26 0 46.15 62.381 34.38 22.52 46.11 8.381
870 gctactagctagctgatcatcatctac 208 27 0 44.44 61.407 14.37 0.00 44.92 8.407
871 ttagctagctgactgatcgatcatca 258 26 0 42.31 62.416 28.29 26.49 39.98 8.416
872 tgactgatcgatcatcatgctagcta 267 26 0 42.31 62.472 26.79 11.24 41.77 8.472
873 tagctgactgatcgatcatcatgcta 263 26 0 42.31 62.472 33.83 32.61 41.77 8.472
874 actgatcgatcatcatgctagctact 269 26 0 42.31 62.478 26.67 0.00 41.77 8.478
875 gctagtgatgcatgctagtagtgatg 25 26 0 46.15 62.484 24.96 9.07 0.00 8.484
876 ctagctagctactgatcgatgctaca 301 26 0 46.15 62.503 14.00 5.87 0.00 8.503
877 gactgatcgatcgatgctagctagta 116 26 0 46.15 62.543 22.18 18.77 35.21 8.543
878 actgatcgatcgatgctagctagtag 117 26 0 46.15 62.548 23.29 12.42 35.21 8.548
879 ctagctgatcatcatctactatcatc 216 26 0 38.46 57.395 0.00 0.00 0.00 8.605
880 ctgatcatcatcgatgctagctagtag 517 27 0 44.44 61.665 10.30 1.36 40.32 8.665
881 ctactagctagctgatcatcatcgatg 506 27 0 44.44 61.665 20.23 20.23 41.48 8.665
882 ctgatcgatcatcatgctagctactag 270 27 0 44.44 61.665 26.67 8.14 41.77 8.665
883 tagctgatcatcatctactatcatcat 217 27 0 33.33 58.315 0.00 0.00 0.00 8.685
884 tgatgcatgctagtagtgatgtatacg 30 27 0 40.74 61.778 9.81 0.00 0.00 8.778
885 gatgcatgctagtagtgatgtatacgt 31 27 0 40.74 61.779 7.40 0.00 0.00 8.779
886 gctactagctagctgatcatcatcga 505 26 0 46.15 62.779 14.37 0.00 44.92 8.779
887 agctgatcatcgatgctactagctag 194 26 0 46.15 62.784 24.59 20.04 45.92 8.784
888 ctagctgatcatcgatgctactagct 192 26 0 46.15 62.784 27.00 27.00 45.92 8.784
889 agctagctgatcatcgatgctactag 190 26 0 46.15 62.784 20.13 20.13 0.00 8.784
890 ctagctagctgatcatcgatgctact 188 26 0 46.15 62.784 17.55 15.53 0.00 8.784
891 atttagctagctgactgatcgatcatc 256 27 0 40.74 61.785 23.93 21.92 36.62 8.785
892 tctactatcatcatcatctactagct 230 26 0 34.62 57.155 0.00 0.00 0.00 8.845
893 tgctagtgatgcatgctagtagtgat 24 26 0 42.31 62.874 24.96 8.51 35.89 8.874
894 ctgatcatcatctactatcatcatca 220 26 0 34.62 57.026 0.00 0.00 0.00 8.974
895 agctagctactgatcgatgctacatc 303 26 0 46.15 62.999 17.56 7.89 37.97 8.999
896 tagtagtgatgtatacgtagctagtag 40 27 0 37.04 57.869 16.78 1.30 0.00 9.131
897 ctagtagtgatgtatacgtagctagta 39 27 0 37.04 57.869 16.85 15.97 0.00 9.131
898 actgatcgatcatcatgctagctacta 269 27 0 40.74 62.236 26.67 1.37 41.77 9.236
899 gcatgctagtagtgatgtatacgtagc 34 27 0 44.44 62.283 11.60 4.93 0.00 9.283
900 gctatttagctagctgactgatcgatc 253 27 0 44.44 62.291 19.32 19.32 46.11 9.291
901 atctactatcatcatcatctactagct 229 27 0 33.33 57.592 0.00 0.00 0.00 9.408
902 catctactatcatcatcatctactagc 228 27 0 37.04 57.549 0.00 0.00 0.00 9.451
903 tgatcatcatctactatcatcatcatc 221 27 0 33.33 57.467 0.00 0.00 0.00 9.533
904 tagctgatcatcgatgctactagctag 193 27 0 44.44 62.534 27.70 20.04 45.92 9.534
905 ctagctgatcatcgatgctactagcta 192 27 0 44.44 62.534 27.76 26.73 45.92 9.534
906 tagctagctgatcatcgatgctactag 189 27 0 44.44 62.534 20.13 20.13 0.00 9.534
907 ctagctagctgatcatcgatgctacta 188 27 0 44.44 62.534 17.74 15.95 0.00 9.534
908 ctgatcatcatctactatcatcatcat 220 27 0 33.33 57.462 0.00 0.00 0.00 9.538
909 gctagctagctactatcatcgatcgat 426 27 0 44.44 62.627 34.38 25.37 46.11 9.627
910 ttagctagctgactgatcgatcatcat 258 27 0 40.74 62.665 28.29 20.43 41.77 9.665
911 tagctagctactgatcgatgctacatc 302 27 0 44.44 62.742 27.80 7.89 37.97 9.742
912 ctagctagctactgatcgatgctacat 301 27 0 44.44 62.747 14.00 2.51 0.00 9.747
913 gatcatcatctactatcatcatcatct 222 27 0 33.33 57.242 0.00 0.00 0.00 9.758
914 tttagctagctgactgatcgatcatca 257 27 0 40.74 62.820 26.49 26.49 39.98 9.820
915 tctactatcatcatcatctactagcta 230 27 0 33.33 57.100 0.00 0.00 0.00 9.900

View File

@@ -0,0 +1,31 @@
<#import "layout.ftl" as layout>
<#assign results = [
{
"title": "Example Result",
"description": "Lorem ipsum dolor sit amet, pede id pellentesque, sollicitudin turpis sed in sed sed, libero dictum."
}
] />
<@layout.page title="FreeMarker Example">
<#if results?size == 0>
There were no results.
<#else>
<ul>
<#list results as result>
<li>
<strong>${result.title}</strong>
<p>${result.description}</p>
</li>
</#list>
</ul>
</#if>
<#-- This is a FreeMarker comment -->
<@currentTime />
</@layout.page>
<#macro currentTime>
${.now?string.full}
</#macro>

View File

@@ -0,0 +1,32 @@
<#ftl strip_text=true />
<#macro page title>
<!doctype html>
<html lang="${.lang}">
<head>
<title>${title}</title>
<@metaTags />
</head>
<body>
<#nested />
<@footer />
</body>
</html>
</#macro>
<#---
Default meta tags
-->
<#macro metaTags>
<#compress>
<meta charset="utf-8">
<meta http-equiv="X-UA-Compatible" content="IE=edge">
<meta name="viewport" content="width=device-width,initial-scale=1">
<meta name="format-detection" content="telephone=no">
</#compress>
</#macro>
<#macro footer>
<p>This page is using FreeMarker v${.version}</p>
</#macro>

File diff suppressed because it is too large Load Diff

File diff suppressed because it is too large Load Diff

91
samples/GAS/hello.ms Normal file
View File

@@ -0,0 +1,91 @@
# output(): Hello, world.\n
# mach(): all
# Emit hello world while switching back and forth between arm/thumb.
# ??? Unfinished
.macro invalid
# This is "undefined" but it's not properly decoded yet.
.word 0x07ffffff
# This is stc which isn't recognized yet.
stc 0,cr0,[r0]
.endm
.global _start
_start:
# Run some simple insns to confirm the engine is at least working.
nop
# Skip over output text.
bl skip_output
hello_text:
.asciz "Hello, world.\n"
.p2align 2
skip_output:
# Prime loop.
mov r4, r14
output_next:
# Switch arm->thumb to output next chacter.
# At this point r4 must point to the next character to output.
adr r0, into_thumb + 1
bx r0
into_thumb:
.thumb
# Output a character.
mov r0,#3 @ writec angel call
mov r1,r4
swi 0xab @ ??? Confirm number.
# Switch thumb->arm.
adr r5, back_to_arm
bx r5
.p2align 2
back_to_arm:
.arm
# Load next character, see if done.
add r4,r4,#1
sub r3,r3,r3
ldrb r5,[r4,r3]
teq r5,#0
beq done
# Output a character (in arm mode).
mov r0,#3
mov r1,r4
swi #0x123456
# Load next character, see if done.
add r4,r4,#1
sub r3,r3,r3
ldrb r5,[r4,r3]
teq r5,#0
bne output_next
done:
mov r0,#0x18
ldr r1,exit_code
swi #0x123456
# If that fails, try to die with an invalid insn.
invalid
exit_code:
.word 0x20026

852
samples/Go/embedded.go Normal file

File diff suppressed because one or more lines are too long

View File

@@ -0,0 +1,18 @@
// Autogenerated by Thrift Compiler (1.0.0-dev)
// DO NOT EDIT UNLESS YOU ARE SURE THAT YOU KNOW WHAT YOU ARE DOING
package linguist
import (
"bytes"
"fmt"
"git.apache.org/thrift.git/lib/go/thrift"
)
// (needed to ensure safety because of naive import list construction.)
var _ = thrift.ZERO
var _ = fmt.Printf
var _ = bytes.Equal
func init() {
}

275
samples/Groff/Tcl.n Normal file
View File

@@ -0,0 +1,275 @@
'\"
'\" Copyright (c) 1993 The Regents of the University of California.
'\" Copyright (c) 1994-1996 Sun Microsystems, Inc.
'\"
'\" See the file "license.terms" for information on usage and redistribution
'\" of this file, and for a DISCLAIMER OF ALL WARRANTIES.
'\"
.TH Tcl n "8.6" Tcl "Tcl Built-In Commands"
.so man.macros
.BS
.SH NAME
Tcl \- Tool Command Language
.SH SYNOPSIS
Summary of Tcl language syntax.
.BE
.SH DESCRIPTION
.PP
The following rules define the syntax and semantics of the Tcl language:
.IP "[1] \fBCommands.\fR"
A Tcl script is a string containing one or more commands.
Semi-colons and newlines are command separators unless quoted as
described below.
Close brackets are command terminators during command substitution
(see below) unless quoted.
.IP "[2] \fBEvaluation.\fR"
A command is evaluated in two steps.
First, the Tcl interpreter breaks the command into \fIwords\fR
and performs substitutions as described below.
These substitutions are performed in the same way for all
commands.
Secondly, the first word is used to locate a command procedure to
carry out the command, then all of the words of the command are
passed to the command procedure.
The command procedure is free to interpret each of its words
in any way it likes, such as an integer, variable name, list,
or Tcl script.
Different commands interpret their words differently.
.IP "[3] \fBWords.\fR"
Words of a command are separated by white space (except for
newlines, which are command separators).
.IP "[4] \fBDouble quotes.\fR"
If the first character of a word is double-quote
.PQ \N'34'
then the word is terminated by the next double-quote character.
If semi-colons, close brackets, or white space characters
(including newlines) appear between the quotes then they are treated
as ordinary characters and included in the word.
Command substitution, variable substitution, and backslash substitution
are performed on the characters between the quotes as described below.
The double-quotes are not retained as part of the word.
.IP "[5] \fBArgument expansion.\fR"
If a word starts with the string
.QW {*}
followed by a non-whitespace character, then the leading
.QW {*}
is removed and the rest of the word is parsed and substituted as any other
word. After substitution, the word is parsed as a list (without command or
variable substitutions; backslash substitutions are performed as is normal for
a list and individual internal words may be surrounded by either braces or
double-quote characters), and its words are added to the command being
substituted. For instance,
.QW "cmd a {*}{b [c]} d {*}{$e f {g h}}"
is equivalent to
.QW "cmd a b {[c]} d {$e} f {g h}" .
.IP "[6] \fBBraces.\fR"
If the first character of a word is an open brace
.PQ {
and rule [5] does not apply, then
the word is terminated by the matching close brace
.PQ } "" .
Braces nest within the word: for each additional open
brace there must be an additional close brace (however,
if an open brace or close brace within the word is
quoted with a backslash then it is not counted in locating the
matching close brace).
No substitutions are performed on the characters between the
braces except for backslash-newline substitutions described
below, nor do semi-colons, newlines, close brackets,
or white space receive any special interpretation.
The word will consist of exactly the characters between the
outer braces, not including the braces themselves.
.IP "[7] \fBCommand substitution.\fR"
If a word contains an open bracket
.PQ [
then Tcl performs \fIcommand substitution\fR.
To do this it invokes the Tcl interpreter recursively to process
the characters following the open bracket as a Tcl script.
The script may contain any number of commands and must be terminated
by a close bracket
.PQ ] "" .
The result of the script (i.e. the result of its last command) is
substituted into the word in place of the brackets and all of the
characters between them.
There may be any number of command substitutions in a single word.
Command substitution is not performed on words enclosed in braces.
.IP "[8] \fBVariable substitution.\fR"
If a word contains a dollar-sign
.PQ $
followed by one of the forms
described below, then Tcl performs \fIvariable
substitution\fR: the dollar-sign and the following characters are
replaced in the word by the value of a variable.
Variable substitution may take any of the following forms:
.RS
.TP 15
\fB$\fIname\fR
.
\fIName\fR is the name of a scalar variable; the name is a sequence
of one or more characters that are a letter, digit, underscore,
or namespace separators (two or more colons).
Letters and digits are \fIonly\fR the standard ASCII ones (\fB0\fR\(en\fB9\fR,
\fBA\fR\(en\fBZ\fR and \fBa\fR\(en\fBz\fR).
.TP 15
\fB$\fIname\fB(\fIindex\fB)\fR
.
\fIName\fR gives the name of an array variable and \fIindex\fR gives
the name of an element within that array.
\fIName\fR must contain only letters, digits, underscores, and
namespace separators, and may be an empty string.
Letters and digits are \fIonly\fR the standard ASCII ones (\fB0\fR\(en\fB9\fR,
\fBA\fR\(en\fBZ\fR and \fBa\fR\(en\fBz\fR).
Command substitutions, variable substitutions, and backslash
substitutions are performed on the characters of \fIindex\fR.
.TP 15
\fB${\fIname\fB}\fR
.
\fIName\fR is the name of a scalar variable or array element. It may contain
any characters whatsoever except for close braces. It indicates an array
element if \fIname\fR is in the form
.QW \fIarrayName\fB(\fIindex\fB)\fR
where \fIarrayName\fR does not contain any open parenthesis characters,
.QW \fB(\fR ,
or close brace characters,
.QW \fB}\fR ,
and \fIindex\fR can be any sequence of characters except for close brace
characters. No further
substitutions are performed during the parsing of \fIname\fR.
.PP
There may be any number of variable substitutions in a single word.
Variable substitution is not performed on words enclosed in braces.
.PP
Note that variables may contain character sequences other than those listed
above, but in that case other mechanisms must be used to access them (e.g.,
via the \fBset\fR command's single-argument form).
.RE
.IP "[9] \fBBackslash substitution.\fR"
If a backslash
.PQ \e
appears within a word then \fIbackslash substitution\fR occurs.
In all cases but those described below the backslash is dropped and
the following character is treated as an ordinary
character and included in the word.
This allows characters such as double quotes, close brackets,
and dollar signs to be included in words without triggering
special processing.
The following table lists the backslash sequences that are
handled specially, along with the value that replaces each sequence.
.RS
.TP 7
\e\fBa\fR
Audible alert (bell) (Unicode U+000007).
.TP 7
\e\fBb\fR
Backspace (Unicode U+000008).
.TP 7
\e\fBf\fR
Form feed (Unicode U+00000C).
.TP 7
\e\fBn\fR
Newline (Unicode U+00000A).
.TP 7
\e\fBr\fR
Carriage-return (Unicode U+00000D).
.TP 7
\e\fBt\fR
Tab (Unicode U+000009).
.TP 7
\e\fBv\fR
Vertical tab (Unicode U+00000B).
.TP 7
\e\fB<newline>\fIwhiteSpace\fR
.
A single space character replaces the backslash, newline, and all spaces
and tabs after the newline. This backslash sequence is unique in that it
is replaced in a separate pre-pass before the command is actually parsed.
This means that it will be replaced even when it occurs between braces,
and the resulting space will be treated as a word separator if it is not
in braces or quotes.
.TP 7
\e\e
Backslash
.PQ \e "" .
.TP 7
\e\fIooo\fR
.
The digits \fIooo\fR (one, two, or three of them) give a eight-bit octal
value for the Unicode character that will be inserted, in the range
\fI000\fR\(en\fI377\fR (i.e., the range U+000000\(enU+0000FF).
The parser will stop just before this range overflows, or when
the maximum of three digits is reached. The upper bits of the Unicode
character will be 0.
.TP 7
\e\fBx\fIhh\fR
.
The hexadecimal digits \fIhh\fR (one or two of them) give an eight-bit
hexadecimal value for the Unicode character that will be inserted. The upper
bits of the Unicode character will be 0 (i.e., the character will be in the
range U+000000\(enU+0000FF).
.TP 7
\e\fBu\fIhhhh\fR
.
The hexadecimal digits \fIhhhh\fR (one, two, three, or four of them) give a
sixteen-bit hexadecimal value for the Unicode character that will be
inserted. The upper bits of the Unicode character will be 0 (i.e., the
character will be in the range U+000000\(enU+00FFFF).
.TP 7
\e\fBU\fIhhhhhhhh\fR
.
The hexadecimal digits \fIhhhhhhhh\fR (one up to eight of them) give a
twenty-one-bit hexadecimal value for the Unicode character that will be
inserted, in the range U+000000\(enU+10FFFF. The parser will stop just
before this range overflows, or when the maximum of eight digits
is reached. The upper bits of the Unicode character will be 0.
.RS
.PP
The range U+010000\(enU+10FFFD is reserved for the future.
.RE
.PP
Backslash substitution is not performed on words enclosed in braces,
except for backslash-newline as described above.
.RE
.IP "[10] \fBComments.\fR"
If a hash character
.PQ #
appears at a point where Tcl is
expecting the first character of the first word of a command,
then the hash character and the characters that follow it, up
through the next newline, are treated as a comment and ignored.
The comment character only has significance when it appears
at the beginning of a command.
.IP "[11] \fBOrder of substitution.\fR"
Each character is processed exactly once by the Tcl interpreter
as part of creating the words of a command.
For example, if variable substitution occurs then no further
substitutions are performed on the value of the variable; the
value is inserted into the word verbatim.
If command substitution occurs then the nested command is
processed entirely by the recursive call to the Tcl interpreter;
no substitutions are performed before making the recursive
call and no additional substitutions are performed on the result
of the nested script.
.RS
.PP
Substitutions take place from left to right, and each substitution is
evaluated completely before attempting to evaluate the next. Thus, a
sequence like
.PP
.CS
set y [set x 0][incr x][incr x]
.CE
.PP
will always set the variable \fIy\fR to the value, \fI012\fR.
.RE
.IP "[12] \fBSubstitution and word boundaries.\fR"
Substitutions do not affect the word boundaries of a command,
except for argument expansion as specified in rule [5].
For example, during variable substitution the entire value of
the variable becomes part of a single word, even if the variable's
value contains spaces.
.SH KEYWORDS
backslash, command, comment, script, substitution, variable
'\" Local Variables:
'\" mode: nroff
'\" fill-column: 78
'\" End:

135
samples/Groff/create_view.l Normal file
View File

@@ -0,0 +1,135 @@
.\\" auto-generated by docbook2man-spec $Revision: 1.1.1.1 $
.TH "CREATE VIEW" "" "2005-11-05" "SQL - Language Statements" "SQL Commands"
.SH NAME
CREATE VIEW \- define a new view
.SH SYNOPSIS
.sp
.nf
CREATE [ OR REPLACE ] [ TEMP | TEMPORARY ] VIEW \fIname\fR [ ( \fIcolumn_name\fR [, ...] ) ]
AS \fIquery\fR
.sp
.fi
.SH "DESCRIPTION"
.PP
\fBCREATE VIEW\fR defines a view of a query. The view
is not physically materialized. Instead, the query is run every time
the view is referenced in a query.
.PP
\fBCREATE OR REPLACE VIEW\fR is similar, but if a view
of the same name already exists, it is replaced. You can only replace
a view with a new query that generates the identical set of columns
(i.e., same column names and data types).
.PP
If a schema name is given (for example, CREATE VIEW
myschema.myview ...) then the view is created in the specified
schema. Otherwise it is created in the current schema. Temporary
views exist in a special schema, so a schema name may not be given
when creating a temporary view. The name of the view must be
distinct from the name of any other view, table, sequence, or index
in the same schema.
.SH "PARAMETERS"
.TP
\fBTEMPORARY or TEMP\fR
If specified, the view is created as a temporary view.
Temporary views are automatically dropped at the end of the
current session. Existing
permanent relations with the same name are not visible to the
current session while the temporary view exists, unless they are
referenced with schema-qualified names.
If any of the tables referenced by the view are temporary,
the view is created as a temporary view (whether
TEMPORARY is specified or not).
.TP
\fB\fIname\fB\fR
The name (optionally schema-qualified) of a view to be created.
.TP
\fB\fIcolumn_name\fB\fR
An optional list of names to be used for columns of the view.
If not given, the column names are deduced from the query.
.TP
\fB\fIquery\fB\fR
A query (that is, a \fBSELECT\fR statement) which will
provide the columns and rows of the view.
Refer to SELECT [\fBselect\fR(l)]
for more information about valid queries.
.SH "NOTES"
.PP
Currently, views are read only: the system will not allow an insert,
update, or delete on a view. You can get the effect of an updatable
view by creating rules that rewrite inserts, etc. on the view into
appropriate actions on other tables. For more information see
CREATE RULE [\fBcreate_rule\fR(l)].
.PP
Use the DROP VIEW [\fBdrop_view\fR(l)]
statement to drop views.
.PP
Be careful that the names and types of the view's columns will be
assigned the way you want. For example,
.sp
.nf
CREATE VIEW vista AS SELECT 'Hello World';
.sp
.fi
is bad form in two ways: the column name defaults to ?column?,
and the column data type defaults to \fBunknown\fR. If you want a
string literal in a view's result, use something like
.sp
.nf
CREATE VIEW vista AS SELECT text 'Hello World' AS hello;
.sp
.fi
.PP
Access to tables referenced in the view is determined by permissions of
the view owner. However, functions called in the view are treated the
same as if they had been called directly from the query using the view.
Therefore the user of a view must have permissions to call all functions
used by the view.
.SH "EXAMPLES"
.PP
Create a view consisting of all comedy films:
.sp
.nf
CREATE VIEW comedies AS
SELECT *
FROM films
WHERE kind = 'Comedy';
.sp
.fi
.SH "COMPATIBILITY"
.PP
The SQL standard specifies some additional capabilities for the
\fBCREATE VIEW\fR statement:
.sp
.nf
CREATE VIEW \fIname\fR [ ( \fIcolumn_name\fR [, ...] ) ]
AS \fIquery\fR
[ WITH [ CASCADED | LOCAL ] CHECK OPTION ]
.sp
.fi
.PP
The optional clauses for the full SQL command are:
.TP
\fBCHECK OPTION\fR
This option has to do with updatable views. All
\fBINSERT\fR and \fBUPDATE\fR commands on the view
will be checked to ensure data satisfy the view-defining
condition (that is, the new data would be visible through the
view). If they do not, the update will be rejected.
.TP
\fBLOCAL\fR
Check for integrity on this view.
.TP
\fBCASCADED\fR
Check for integrity on this view and on any dependent
view. CASCADED is assumed if neither
CASCADED nor LOCAL is specified.
.PP
.PP
\fBCREATE OR REPLACE VIEW\fR is a
PostgreSQL language extension.
So is the concept of a temporary view.
.SH "SEE ALSO"
DROP VIEW [\fBdrop_view\fR(l)]

1174
samples/Groff/fsinterface.ms Normal file

File diff suppressed because it is too large Load Diff

46
samples/Groovy/filenames/Jenkinsfile vendored Normal file
View File

@@ -0,0 +1,46 @@
jettyUrl = 'http://localhost:8081/'
def servers
stage 'Dev'
node {
checkout scm
servers = load 'servers.groovy'
mvn '-o clean package'
dir('target') {stash name: 'war', includes: 'x.war'}
}
stage 'QA'
parallel(longerTests: {
runTests(servers, 30)
}, quickerTests: {
runTests(servers, 20)
})
stage name: 'Staging', concurrency: 1
node {
servers.deploy 'staging'
}
input message: "Does ${jettyUrl}staging/ look good?"
stage name: 'Production', concurrency: 1
node {
sh "wget -O - -S ${jettyUrl}staging/"
echo 'Production server looks to be alive'
servers.deploy 'production'
echo "Deployed to ${jettyUrl}production/"
}
def mvn(args) {
sh "${tool 'Maven 3.x'}/bin/mvn ${args}"
}
def runTests(servers, duration) {
node {
checkout scm
servers.runWithServer {id ->
mvn "-o -f sometests test -Durl=${jettyUrl}${id}/ -Dduration=${duration}"
}
}
}

6
samples/HCL/example.hcl Normal file
View File

@@ -0,0 +1,6 @@
consul = "1.2.3.4"
// This is a comment
template "foo" {
bar = "zip"
}

13
samples/HCL/example.tf Normal file
View File

@@ -0,0 +1,13 @@
resource "aws_instance" "web" {
// Copies the myapp.conf file to /etc/myapp.conf
provisioner "file" {
source = "conf/myapp.conf"
destination = "/etc/myapp.conf"
}
// Copies the configs.d folder to /etc/configs.d
provisioner "file" {
source = "conf/configs.d"
destination = "/etc"
}
}

View File

@@ -0,0 +1,27 @@
// Copyright (c) 2012 The Chromium Authors. All rights reserved.
// Use of this source code is governed by a BSD-style license that can be
// found in the LICENSE file.
// To compile these two shaders:
// fxc /E pixelMain /T ps_2_0 accelerated_surface_win.hlsl
// fxc /E vertexMain /T vs_2_0 accelerated_surface_win.hlsl
//
// fxc is in the DirectX SDK.
struct Vertex {
float4 position : POSITION;
float2 texCoord : TEXCOORD0;
};
texture t;
sampler s;
// Passes a position and texture coordinate to the pixel shader.
Vertex vertexMain(Vertex input) {
return input;
};
// Samples a texture at the given texture coordinate and returns the result.
float4 pixelMain(float2 texCoord : TEXCOORD0) : COLOR0 {
return tex2D(s, texCoord);
};

105
samples/HLSL/corridor.fx Normal file
View File

@@ -0,0 +1,105 @@
float4x4 matWorldView : WORLDVIEW;
float4x4 matWorldViewProjection : WORLDVIEWPROJECTION;
struct VS_INPUT {
float4 Position : POSITION0;
float3 Normal : NORMAL;
float3 Tangent : TANGENT;
float3 Binormal : BINORMAL;
float2 TexCoord0 : TEXCOORD0;
float2 TexCoord1 : TEXCOORD1;
};
struct VS_OUTPUT {
float4 Position : POSITION0;
float2 TexCoord0 : TEXCOORD0;
float2 TexCoord1 : TEXCOORD1;
float3x3 TangentToView : TEXCOORD2;
};
VS_OUTPUT vs_main(VS_INPUT input)
{
VS_OUTPUT output;
output.Position = mul(input.Position, matWorldViewProjection);
output.TexCoord0 = input.TexCoord0 * 5;
output.TexCoord1 = input.TexCoord1;
output.TangentToView[0] = mul(float4(input.Tangent, 0), matWorldView).xyz;
output.TangentToView[1] = mul(float4(input.Binormal, 0), matWorldView).xyz;
output.TangentToView[2] = mul(float4(input.Normal, 0), matWorldView).xyz;
return output;
}
struct PS_OUTPUT {
float4 gbuffer0 : COLOR0;
float4 gbuffer1 : COLOR1;
};
texture albedo_tex;
sampler albedo_samp = sampler_state {
Texture = (albedo_tex);
MipFilter = Linear;
MinFilter = Linear;
MagFilter = Linear;
AddressU = Wrap;
AddressV = Wrap;
sRGBTexture = True;
};
texture normal_tex;
sampler normal_samp = sampler_state {
Texture = (normal_tex);
MipFilter = Linear;
MinFilter = Linear;
MagFilter = Linear;
AddressU = Wrap;
AddressV = Wrap;
sRGBTexture = False;
};
texture specular_tex;
sampler specular_samp = sampler_state {
Texture = (specular_tex);
MipFilter = Linear;
MinFilter = Linear;
MagFilter = Linear;
AddressU = Wrap;
AddressV = Wrap;
sRGBTexture = True;
};
texture ao_tex;
sampler ao_samp = sampler_state {
Texture = (ao_tex);
MipFilter = Linear;
MinFilter = Linear;
MagFilter = Linear;
AddressU = Wrap;
AddressV = Wrap;
sRGBTexture = True;
};
PS_OUTPUT ps_main(VS_OUTPUT Input)
{
PS_OUTPUT o;
float3 tangentNormal = normalize(tex2D(normal_samp, Input.TexCoord0).xyz * 2 - 1);
float3 eyeNormal = normalize(mul(tangentNormal, Input.TangentToView));
float3 albedo = tex2D(albedo_samp, Input.TexCoord0).rgb;
float ao = tex2D(ao_samp, Input.TexCoord1).r * 0.75;
float spec = tex2D(specular_samp, Input.TexCoord0).r;
o.gbuffer0 = float4(eyeNormal, spec * ao);
o.gbuffer1 = float4(albedo, 1 - ao);
return o;
}
technique mesh {
pass Geometry {
VertexShader = compile vs_3_0 vs_main();
PixelShader = compile ps_3_0 ps_main();
AlphaBlendEnable = False;
ZWriteEnable = True;
}
}

Some files were not shown because too many files have changed in this diff Show More